Morpholino
A Morpholino, also known as a Morpholino oligomer and as a phosphorodiamidate Morpholino oligomer (PMO), is a type of oligomer ... Morpholinos can block ribozyme activity. U2 and U12 snRNP functions have been inhibited by Morpholinos. Morpholinos targeted to ... A Morpholino can modify splicing, block translation, or block other functional sites on RNA depending on the Morpholino's base ... Morpholino activities against this variety of targets suggest that Morpholinos can be used as a general-purpose tool for ...
Xenopus
Morpholino oligos are used in both X. laevis and X. tropicalis to probe the function of a protein by observing the results of ... Morpholino oligos (MOs) are short, antisense oligos made of modified nucleotides. MOs can knock down gene expression by ... Moreover, the use of morpholino-antisense oligonucleotides for gene knockdowns in vertebrate embryos, which is now widely used ... "A Xenopus tropicalis antisense morpholino screen". Gurdon Institute. 4 March 2014. Archived from the original on 12 June 2018. ...
Sarepta Therapeutics
A new class of Morpholino oligos, the peptide-linked Morpholinos or PPMO, are linked to an arginine-rich cell-penetrating ... Summerton, James E. (2017). "Invention and Early History of Morpholinos". In Moulton, Hong; Moulton, Jon (eds.). Morpholino ... Morpholinos can also work as splice-switching oligos, targeting pre-mRNA to alter splicing and so causing changes in the ... Morpholinos have been used in preclinical studies to inhibit replication of a broad range of viruses, including influenza, West ...
The Mollys
... and the Morpholinos. Mackender also continues to work in the visual arts. (all albums self-published) Tidings of Comfort & Joy ...
Cyanamide
doi:10.1002/anie.197308411.. S. Hünig, E. Lücke, and W. Brenninger (1961). "1-Morpholino-1-Cyclohexene". Organic Syntheses: 65 ...
Lithium aluminium hydride
6, p. 382 Chen, Y. K.; Jeon, S.-J.; Walsh, P. J.; Nugent, W. A. (2005). "(2S)-(−)-3-exo-(Morpholino)Isoborneol". Organic ...
MES (buffer)
Synonyms include: 2-morpholinoethanesulfonic acid; 2-(4-morpholino)ethanesulfonic acid; 2-(N-morpholino)ethanesulfonic acid; 2 ... MES is the common name for the compound 2-(N-morpholino)ethanesulfonic acid. Its chemical structure contains a morpholine ring ... 4-morpholino)ethanesulfonic acid; MES; MES hydrate; and morpholine-4-ethanesulfonic acid hydrate. MOPS is a similar pH ...
Isoborneol
2S)-(−)-3-exo-(morpholino)isoborneol or MIB with a morpholine substituent in the α-hydroxyl position. (2S)-(−)-3-exo-( ... Chen, Y. K.; Jeon, S.-J.; Walsh, P. J.; Nugent, W. A. (2005). "(2S)-(−)-3-exo-(Morpholino)isoborneol". Organic Syntheses. 82: ...
Spatiotemporal gene expression
Shestopalov, Ilya A; Chen, James K (2011). Spatiotemporal control of embryonic gene expression using caged morpholinos. Methods ... and also patterning of gene expression has been performed in cell monolayer and in zebrafish embryos using caged morpholino or ...
Viltolarsen
June 2009). "Efficacy of systemic morpholino exon-skipping in Duchenne dystrophy dogs". Annals of Neurology. 65 (6): 667-76. ... Viltolarsen is a Morpholino antisense oligonucleotide. The most common side effects include upper respiratory tract infection, ...
Amyl nitrite
2, p. 108 Chen YK, Jeon SJ, Walsh PJ, Nugent WA (2005). "(2S)-(−)-3-exo-(Morpholino)isoborneol ((−)-MIB)". Organic Syntheses. ...
Zebrafish
Morpholinos are commonly microinjected in 500pL directly into 1-2 cell stage zebrafish embryos. The morpholino is able to ... Morpholino oligonucleotides (MO) are stable, synthetic macromolecules that contain the same bases as DNA or RNA; by binding to ... By interfering via a dominant nonfunctional allele and a morpholino they find the T-box transcription activator Eomesodermin ... A common reverse genetics technique is to reduce gene expression or modify splicing using Morpholino antisense technology. ...
Dysferlin
"Characterization of zebrafish dysferlin by morpholino knockdown". Biochemical and Biophysical Research Communications. 413 (2 ...
Eteplirsen
... is a morpholino phosphorodiamidate antisense oligomer. CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ... Exon skipping is induced by eteplirsen, a charge-neutral, phosphorodiamidate morpholino oligomer (PMO) that selectively binds ... Moulton HM, Moulton JD (December 2010). "Morpholinos and their peptide conjugates: therapeutic promise and challenge for ... Eteplirsen is a morpholino antisense oligomer which triggers excision of exon 51 during pre-mRNA splicing of the dystrophin RNA ...
Nucleic acid analogue
Artificial nucleic acids include peptide nucleic acid (PNA), Morpholino and locked nucleic acid (LNA), as well as glycol ... Summerton J (December 1999). "Morpholino antisense oligomers: the case for an RNase H-independent structural type". Biochimica ... Summerton J, Weller D (June 1997). "Morpholino antisense oligomers: design, preparation, and properties". Antisense & Nucleic ... morpholino, and peptide nucleic acid (PNA). Although these oligonucleotides have a different backbone sugar or, in the case of ...
Xenbase
Morpholinos are synthetic oligonucleotides that can be used to inhibit nuclear RNA splicing or mRNA translation and are the ... Traditionally, antisense morpholino oligonucleotides have been the method of choice to study the effects of transient gene ... In comparison to morpholinos which disrupt gene expression by inhibiting translational machinery TALENs disrupt gene expression ... For example, you could identify papers describing HOX genes and limit your results to only papers which used morpholinos. ...
MTOR inhibitors
Their structure is derived from morpholino pyrazolopyrimidine scaffold. Improvements of this type of inhibitors have been made ...
Gene Tools
Current products include Morpholino oligos and Vivo-Morpholinos (for improved delivery into cells). The manager and general ... Gene Tools, LLC is a limited liability company located in Philomath, Oregon, United States that manufactures Morpholino ... Morcos, PA (2001). "Achieving efficient delivery of morpholino oligos in cultured cells". Genesis. 30 (3): 94-102. doi:10.1002/ ... Gene Tools was founded in 1997 and began regularly shipping custom-sequence Morpholino oligos in 2000. ...
Oligonucleotide
The use of Morpholino antisense oligonucleotides for gene knockdowns in vertebrates, which is now a standard technique in ... FDA-approved Morpholino drugs include eteplirsen and golodirsen. The antisense oligonucleotides have also been used to inhibit ... Aptamers, oligonucleotides with important biological applications Morpholinos, oligos with non-natural backbones, which do not ...
Nucleoside
These analogues include locked nucleic acids (LNA), morpholinos and peptide nucleic acids (PNA). In sequencing, ...
Bradley L. Pentelute
"Fully automated fast-flow synthesis of antisense phosphorodiamidate morpholino oligomers". Nature Communications. 12 (1): 4396 ... achieve stepwise total chemical synthesis of functional protein chains and was adapted to produce phosphorodiamidate morpholino ...
Casimersen
... is an antisense phosphorodiamidate morpholino oligonucleotide designed to bind to the exon 45 of the DMD pre-MRNA, ... It is an antisense oligonucleotide of phosphorodiamidate morpholino oligomer (PMO). Duchenne muscular dystrophy is a rare ...
Toshifumi Yokota
Supported by the Heart and Stroke Foundation of Canada, his team developed a cocktail of peptide-conjugated morpholinos (PPMOs ... With support from CIHR and muscular dystrophy Canada, the team also identified novel peptide-conjugated morpholinos called DG9- ... Efficacy of morpholino systemic exon-skipping in Duchenne dystrophy dogs. Ann. Neurol., 2009, 65:667-76. Echigoya Y, Lim K, ... "DG9-conjugated morpholino rescues phenotype in SMA mice by reaching the CNS via a subcutaneous administration". JCI Insight. 8 ...
Hybridization probe
Instead, RNA analogues may be used, in particular morpholino- derivatives. Molecular DNA- or RNA-based probes are routinely ...
Exon
... to pre-mRNA using Morpholino antisense oligos. This has become a standard technique in developmental biology. Morpholino oligos ... Morcos PA (June 2007). "Achieving targeted and quantifiable alteration of mRNA splicing with Morpholino oligos". Biochemical ...
Antisense therapy
Several morpholino oligos have been approved to treat specific groups of mutations causing Duchenne muscular dystrophy. In ... Antisense Antisense mRNA Locked nucleic acid Morpholino Oligonucleotide synthesis Peptide nucleic acid RNA interference (which ... "Achieving targeted and quantifiable alteration of mRNA splicing with Morpholino oligos". Biochemical and Biophysical Research ...
RNA splicing
Draper BW, Morcos PA, Kimmel CB (July 2001). "Inhibition of zebrafish fgf8 pre-mRNA splicing with morpholino oligos: a ... Splicing events can be experimentally altered by binding steric-blocking antisense oligos, such as Morpholinos or Peptide ... Morcos PA (June 2007). "Achieving targeted and quantifiable alteration of mRNA splicing with Morpholino oligos". Biochemical ...
Cell-penetrating peptide
Two types of neutral ON analogues, peptide nucleic acid (PNA) and phosphorodiamidate morpholino oligomers (PMO or Morpholino) ... November 2006). "Inhibition of multiple subtypes of influenza A virus in cell cultures with morpholino oligomers". ... "Inhibition and escape of SARS-CoV treated with antisense morpholino oligomers". The Nidoviruses. Advances in Experimental ... "Effective rescue of dystrophin improves cardiac function in dystrophin-deficient mice by a modified morpholino oligomer". ...
Cingulin
The role of cingulin in development has been studied by morpholino. oligonucleotide-mediated depletion in chicken, indicating ...
Jaagsiekte sheep retrovirus
Following the injection of morpholinos, it was observed that pregnancy loss occurred 12 days later. This work supports the ... Furthermore, it was observed that an injection of morpholinos (an enJSRV envelope production inhibitor) into the uteri of ...