*  The cyclin B1 gene is actively transcribed during mitosis in HeLa cells | EMBO Reports
Occupancy of upstream regulatory sites in vivo coincides with major histocompatibility complex class I gene expression in mouse ... and MSO HeLa cells. (B) Northern blot analysis of CAT mRNA levels in asynchronous (Async.) and MSO cells. HeLa cells stably ... HeLa cells synchronization and transfections.. For the double thymidine block, HeLa cells were grown in Dulbecco's modified ... and MSO HeLa cells (lanes 2 and 3), and of the coding strand of the human hsp70 promoter from MSO HeLa cells (lane 5). As a ...
  http://embor.embopress.org/content/2/11/1018
*  Chemically Reducible Lipid Bilayer Coated Mesoporous Silica Nanoparticles Demonstrating Controlled Release and HeLa and Normal...
Lipid Bilayer Coated Mesoporous Silica Nanoparticles Demonstrating Controlled Release and HeLa and Normal Mouse Liver Cell ... 11217075 - Conditionally immortalized cell lines as a new in vitro model for the study of barrier .... 4455685 - Potassium ... 3170645 - Characterization of chloride uptake in drosophila kc cells.. 7287405 - Phagocytosis and complement action.. 20183135 ... labeled LB-MSNs are examined via confocal fluorescent microscopy in vivo and were found to enter both normal and cancer cell ...
  http://www.biomedsearch.com/nih/Chemically-Reducible-Lipid-Bilayer-Coated/22738645.html
*  SGDB | Show Synthetic Gene ID: 158
Hela cells, mouse spleen cells. CDS. atgggcgtgagaaactccgtcttgtcagggaagaaagcagatgaattagaaaaaattagg. ... Immunization of mice with DNA vectors encoding the mutant or chimeric Gag induced fourfold higher levels of anti-SIV Gag CD4 T ... Moreover, anti-SIV Gag CD8 T cell responses induced by DNA vectors encoding the mutant or chimeric Gag were found to be 5- to ... Then, their expression levels and immunogenicity in mice are evaluated. According to the experimental results, all of the codon ...
  http://www.umbc.edu/codon/sgdb/show_records.php?rgid=158
*  Antibodies Search | ALZFORUM
immunogen = raised against Hela cells transfected with mouse ABC-1. ABC1. -. ABC1 (AB.H10). Santa Cruz. monoclonal. IgG1. Mouse ... Mouse. immunogen = ABCA2 transfected HeLa cells. specific for ABCA2. -. ABCA4 (3F4). Abcam. monoclonal. IgG. Mouse. (liquid, ... Mouse. immunogen = mouse ABCA7 stably-transfected HeLa cells. specific for ABCA7. -. ABCB6. Abcam. polyclonal. IgG. Rabbit. ( ... Mouse. (liquid, PBS, azide, gelatin). WB. Mouse. immunogen = raised against the 50 kDa N-terminal extracellular loop of mouse ...
  https://www.alzforum.org/antibodies/search?category%5B657%5D=ABC%20proteins/%20transporters
*  Plus it
Cell Culture. HeLa cells, TAK1-deficient mouse embryonic fibroblasts (MEFs; ref. 36), and normal MEFs were maintained in DMEM ( ... HeLa cells were treated with TRAIL (200 ng/mL) or TNF-α (10 ng/mL) for the period indicated. Whole-cell lysates were analyzed ... Whole-cell lysates and immunoprecipitates were immunoblotted as described above. B, HeLa cells were pretreated with 5Z-7- ... HeLa cells were treated with 5Z-7-oxozeaenol (300 nmol/L) for 2 h and then simulated with TNF-α (10 ng/mL) for 8 h. Whole-cell ...
  http://mct.aacrjournals.org/content/5/12/2970
*  Anti-CDA antibody (ab82347) | Abcam
ICC/IF and tested in Human and Mouse. Referenced in 1 publication and 1 independent review. Immunogen… ... Mouse kidney normal tissue lysate - total protein (ab29305) *HeLa whole cell lysate (ab29545) ... ICC/IF image of ab82347 stained HeLa cells. The cells were 4% formaldehyde fixed (10 min) and then incubated in 1%BSA / 10% ... Anti-CDA antibody (ab82347) at 1/50 dilution + HeLa cell line lysate at 35 µg. Predicted band size: 16 kDa. Observed band size: ...
  https://www.abcam.com/cda-antibody-ab82347.html
*  Anti-Nuclear Receptor Corepressor NCoR antibody - ChIP Grade (ab3482)
ICC/IF and tested in Human and Mouse. Referenced in 6… ... 270 kDa representing N-CoR from HeLa cell extracts and mouse ... in the nucleus and cytoplasm of HeLa cells by Immunocytochemistry/Immunofluorescence. Formalin-fixed cells were permeabilized ... Cell Biology. Epigenetics. Metabolism. Developmental Biology. By research area. Immunology. Microbiology. Neuroscience. Signal ... Cell and tissue imaging tools. Cellular and biochemical assays. By product type. Proteins and Peptides. Proteomics tools. ...
  http://www.abcam.com/nuclear-receptor-corepressor-ncor-antibody-chip-grade-ab3482.html
*  RPA4 Antibody 18144-1-AP | Proteintech
18144-1-AP detected 29-32 kDa band in HeLa cells with 1:200-1:1000 dilution... ... HeLa cells were subjected to SDS PAGE followed by western blot with 18144-1-AP( RPA4 Antibody) at dilution of 1:300 incubated ... mouse spleen tissue were subjected to SDS PAGE followed by western blot with 18144-1-AP( RPA4 Antibody) at dilution of 1:300 ... HeLa cells were subjected to SDS PAGE followed by western blot with 18144-1-AP( RPA4 Antibody) at dilution of 1:300 incubated ...
  https://www.ptglab.com/Products/RPA4-Antibody-18144-1-AP.htm
*  MEK4 Antibody 51142-1-AP | Proteintech
51142-1-AP detected 44-46 kDa band in mouse brain tissue with 1:500-1:1000 dilution... ... HeLa cells were subjected to SDS PAGE followed by western blot with 51142-1-AP(MEK4 antibody) at dilution of 1:300 incubated at ... mouse brain tissue were subjected to SDS PAGE followed by western blot with 51142-1-AP (MEK4 antibody) at dilution of 1:600 ... mouse brain tissue were subjected to SDS PAGE followed by western blot with 51142-1-AP (MEK4 antibody) at dilution of 1:600 ...
  https://www.ptglab.com/Products/MAP2K4-Antibody-51142-1-AP.htm
*  ABT1 Antibody 14148-1-AP | Proteintech
14148-1-AP detected 31-32 kDa band in mouse liver tissue with 1:200-1:1000 dilution... ... human, mouse, rat Positive WB detected in:. mouse liver tissue, HeLa cells ... HeLa cells were subjected to SDS PAGE followed by western blot with 14148-1-AP(ABT1 antibody) at dilution of 1:300 incubated at ... Immunofluorescent analysis of ( 4% PFA ) fixed HeLa cells using 14148-1-AP(ABT1 antibody) at dilution of 1:50 and Alexa Fluor ...
  https://www.ptglab.com/products/ABT1-Antibody-14148-1-AP.htm
*  Anti-NPR3 Antibody, Clone OTI11B6 - OriGene
... mouse monoclonal antibody, clone OTI11B6 (formerly 11B6) available from OriGene ... Immunofluorescent staining of HeLa cells using anti-NPR3 mouse monoclonal antibody (TA501077). ... Anti-NPR3 mouse monoclonal antibody (TA501077) immunofluorescent staining of COS7 cells transiently transfected by pCMV6-ENTRY ... Immunofluorescent staining of HT29 cells using anti-NPR3 mouse monoclonal antibody (TA501077). ...
  http://www.origene.com/antibody/TA501077.aspx
*  TXNL6 Antibody 11203-1-AP | Proteintech
11203-1-AP detected 26-28 kDa band in mouse brain tissue with 1:500-1:3000 dilution... ... mouse brain tissue, HeLa cells. Positive IP detected in:. mouse brain tissue ... HeLa cells were subjected to SDS PAGE followed by western blot with 11203-1-AP(TXNL6 antibody) at dilution of 1:1000 incubated ... mouse brain tissue were subjected to SDS PAGE followed by western blot with 11203-1-AP(TXNL6 antibody) at dilution of 1:800 ...
  https://www.ptglab.com/Products/NXNL1-Antibody-11203-1-AP.htm
*  TMEM38A Antibody 19920-1-AP | Proteintech
19920-1-AP detected 33 kDa band in mouse skeletal muscle tissue with 1:500-1:2000 dilution... ... human, mouse, rat Positive WB detected in:. mouse skeletal muscle tissue, HeLa cells ... HeLa cells were subjected to SDS PAGE followed by western blot with 19920-1-AP(TMEM38A antibody) at dilution of 1:400 incubated ... mouse skeletal muscle tissue were subjected to SDS PAGE followed by western blot with 19920-1-AP(TMEM38A antibody) at dilution ...
  https://www.ptglab.com/Products/TMEM38A-Antibody-19920-1-AP.htm
*  Anti-TNF beta antibody [AT15A3] (ab100844) | Abcam
ICC/IF and tested in Human and Mouse. Immunogen corresponding to recombinant fragment ... Mouse monoclonal TNF beta antibody [AT15A3] validated for WB, ELISA, IHC, ... HeLa cells and Mouse Spleen lysate IHC-P: Human skin melanoma FFPE tissue sections. ... Immunofluorescence of Human HeLa cells stained with ab100844 at 1/500 with Texas Red (Red). Nucleus was stained by Hoechst ...
  http://www.abcam.com/tnf-beta-antibody-at15a3-ab100844.html
*  ANKS1B Antibody 24783-1-AP | Proteintech
24783-1-AP detected 65-70 kDa band in A549 cells with 1:500-1:2000 dilution... ... A549 cells, HeLa cells, mouse testis tissue. Positive IP detected in:. HeLa cells ... HeLa cells were subjected to SDS PAGE followed by western blot with 24783-1-AP( ANKS1B Antibody) at dilution of 1:1000 ... IP Result of anti-ANKS1B (IP:24783-1-AP, 4ug; Detection:24783-1-AP 1:1000) with HeLa cells lysate 3200ug. ...
  https://www.ptglab.com/Products/ANKS1B-Antibody-24783-1-AP.htm
*  DDA1 Antibody 14995-1-AP | Proteintech
14995-1-AP detected 12 kDa band in HepG2 cells with 1:500-1:1000 dilution... ... human, mouse, rat Positive WB detected in:. HepG2 cells, HeLa cells, mouse liver tissue ... HeLa cells were subjected to SDS PAGE followed by western blot with 14995-1-AP(DDA1 antibody) at dilution of 1:500 incubated at ... HepG2 cells were subjected to SDS PAGE followed by western blot with 14995-1-AP(DDA1 antibody) at dilution of 1:100 incubated ...
  https://www.ptglab.com/Products/DDA1-Antibody-14995-1-AP.htm
*  PSMB8 antibody | acris-antibodies.com
Immunofluorescence analysis of Hela cells using PSMB8 mouse mAb (green). Blue: DRAQ5 fluorescent DNA dye. Red: Actin filaments ... Gel: 8%SDS-PAGE,Lysate: 40 ug,Lane 1-6: 231 cells, A431 cells, Mouse liver tissue, Human placenta tissue, Jurkat cells, Raji ... Western blot analysis using PSMB8 mouse mAb against Hela (1), MCF-7 (2), A431 (3), RAJI (4), MOTL4 (5) and PC-12 (6) cell ... Hela Whole Cell lysates; Antibody Dilution: 1.0 ug/ml.PSMB8 is supported by BioGPS gene expression data to be expressed in HeLa ...
  https://www.acris-antibodies.com/target/psmb8-antibody.htm
*  RNASEH2B - Wikipedia
2) Ribonucleotides in mtDNA (Mouse and HeLa cells). Low levels of ribonucleotides incorporation in the nuclear genome may be ... Collins FS, Rossant J, Wurst W (Jan 2007). "A mouse for all reasons". Cell. 128 (1): 9-13. doi:10.1016/j.cell.2006.12.018. PMID ... A conditional knockout mouse line, called Rnaseh2btm1a(EUCOMM)Wtsi was generated as part of the International Knockout Mouse ... "International Knockout Mouse Consortium". "Mouse Genome Informatics". Skarnes WC, Rosen B, West AP, Koutsourakis M, Bushell W, ...
  https://en.wikipedia.org/wiki/RNASEH2B
*  ADH4 Antibody 16474-1-AP | Proteintech
16474-1-AP detected 43 kDa band in mouse liver tissue with 1:500-1:1000 dilution... ... mouse liver tissue, HeLa cells, mouse brain tissue. Positive IHC detected in: ... HeLa cells were subjected to SDS PAGE followed by western blot with 16474-1-AP(ADH4 antibody) at dilution of 1:300 incubated at ... mouse liver tissue were subjected to SDS PAGE followed by western blot with 16474-1-AP(ADH4 antibody) at dilution of 1:200 ...
  https://www.ptglab.com/Products/ADH4-Antibody-16474-1-AP.htm
*  CD171 / L1CAM antibody | acris-antibodies.com
... it is a neuronal cell adhesion molecule, member of the L1 protein family, of 200-220 kDa, and… ... Immunofluorescent staining of HeLa cells using anti-L1CAM mouse monoclonal antibody (TA500729).. *TA500729 ... CD171 has been shown to function as a cell adhesion molecule mediating homotypic and heterotypic cell-cell interactions in ... L1CAM mouse monoclonal antibody, clone OTI2C7 (formerly 2C7). Mouse. IgG1. OTI2C7. Purified. Hu. F, ICC/IF, P, WB. 0.1 ml / € ...
  https://www.acris-antibodies.com/target/cd171-antibody-l1cam-antibody.htm
*  anti-BUB1B antibody [6E5] | GeneTex
Immunofluorescent staining of HeLa cells using anti-BUB1B mouse monoclonal antibody (GTX84765).. Top ... Immunofluorescent staining of HeLa cells using anti-BUB1B mouse monoclonal antibody (GTX84765).. Top ... Anti-BUB1B mouse monoclonal antibody (GTX84765) immunofluorescent staining of COS7 cells transiently transfected with BUB1B. ... Anti-BUB1B mouse monoclonal antibody (GTX84765) immunofluorescent staining of COS7 cells transiently transfected with BUB1B. ...
  http://www.genetex.com/BUB1B-antibody-6E5-GTX84765.html
*  Switch to Europe/Worldwide website
Immunofluorescent staining of HeLa cells using anti-TRIM2 mouse monoclonal antibody (TA501553).. *TA501553 ... Anti-TRIM2 mouse monoclonal antibody (TA501553) immunofluorescent staining of COS7 cells transiently transfected by pCMV6-ENTRY ... Flow cytometric Analysis of Hela cells, using anti-TRIM2 antibody(TA501551),(Red), compared to a nonspecific negative control ... Flow cytometric Analysis of Hela cells, using anti-TRIM2 antibody(TA501552),(Red), compared to a nonspecific negative control ...
  https://www.acris-antibodies.com/target/trim2-antibody-rnf86-antibody.htm?ab_ag_reactivity=Hst&images_t=WB
*  anti-EpCAM antibody [2H9] | GeneTex
... epithelial cell adhesion molecule) for ICC/IF, WB. Anti-EpCAM mAb (GTX84573) is tested in Human samples. 100% Ab-Assurance. ... Immunofluorescent staining of HeLa cells using anti-EpCAM mouse monoclonal antibody (GTX84573).. Top ... Immunofluorescent staining of HeLa cells using anti-EpCAM mouse monoclonal antibody (GTX84573).. Top ... Anti-EpCAM mouse monoclonal antibody (GTX84573) immunofluorescent staining of HeLa cells transiently transfected by pCMV6-ENTRY ...
  http://www.genetex.com/EpCAM-antibody-2H9-GTX84573.html
*  C17orf62 antibody | acris-antibodies.com
Immunofluorescent staining of HeLa cells using anti-C17orf62 mouse monoclonal antibody (TA506979).. *TA506979 ... Immunofluorescent staining of HeLa cells using anti-C17orf62 mouse monoclonal antibody (TA506995).. *TA506995 ... Immunofluorescent staining of HeLa cells using anti-C17orf62 mouse monoclonal antibody (TA507020).. *TA507020 ... C17orf62 mouse monoclonal antibody, clone OTI3B5 (formerly 3B5). Mouse. IgG1. OTI3B5. Purified. Hu. ICC/IF, WB. 0.1 ml / € ...
  https://www.acris-antibodies.com/target/c17orf62-antibody.htm
*  IL1F9 / IL1H1 antibody | acris-antibodies.com
Immunofluorescent staining of HeLa cells using anti-IL1F9 mouse monoclonal antibody (TA505994).. *TA505994 ... IL1F9 (IL36 gamma) mouse monoclonal antibody, clone OTI6E4 (formerly 6E4). Mouse. IgG2b. OTI6E4. Purified. Hu. P, WB. 0.1 ml / ... IL1F9 (IL36 gamma) mouse monoclonal antibody, clone OTI2F4 (formerly 2F4). Mouse. IgG1. OTI2F4. Purified. Hu. ICC/IF, P, WB. ... Sample(30 ug of whole cell lysate). A:H1299. B:HeLa S3. 12% SDS PAGE. TA308154 diluted at 1:500. *TA308154 ...
  https://www.acris-antibodies.com/target/il1f9-antibody-il1h1-antibody.htm