*  Neumega - FDA prescribing information, side effects and uses
Interleukin eleven (IL-11) is a thrombopoietic growth factor that directly stimulates the proliferation of hematopoietic stem ... interleukins Proleukin, oprelvekin, aldesleukin. platelet-stimulating agents Promacta, eltrombopag, Nplate, romiplostim, ... 1) Du, X. and Williams, D., Interleukin 11: review of molecular, cell biology and clinical use. Blood. 1997;89(11):3897-3908. ... IL-11 is produced by bone marrow stromal cells and is part of the cytokine family that shares the gp130 signal transducer. ...
  https://www.drugs.com/pro/neumega.html
*  Interleukin 11 - Wikipedia
Interleukin 11 (IL-11) is a protein that in humans is encoded by the IL11 gene. IL-11 is a multifunctional cytokine first ... 2002). "Interleukin-11 induces proliferation of human T-cells and its activity is associated with downregulation of p27(kip1 ... Interleukin 11 is manufactured using recombinant DNA technology and is marketed as a protein therapeutic called oprelvekin, for ... Chen HF, Lin CY, Chao KH, Wu MY, Yang YS, Ho HN (May 2002). "Defective production of interleukin-11 by decidua and chorionic ...
  https://en.wikipedia.org/wiki/Interleukin_11
*  Interleukin-11 receptor - Wikipedia
The interleukin 11 receptor is a type I cytokine receptor, binding interleukin 11. It is a heterodimer composed of an ... Receptors, Interleukin-11 at the US National Library of Medicine Medical Subject Headings (MeSH). ... "Molecular cloning of two isoforms of a receptor for the human hematopoietic cytokine interleukin-11". Blood. 86 (7): 2534-40. ... interleukin 11 receptor alpha subunit and an incompletely characterized beta subunit. Chérel M, Sorel M, Lebeau B, Dubois S, ...
  https://en.wikipedia.org/wiki/Interleukin-11_receptor
*  Interleukin 11 receptor alpha subunit - Wikipedia
Interleukin 11 is a stromal cell-derived cytokine that belongs to a family of pleiotropic and redundant cytokines that use the ... 2007). "Expression of interleukin-11 (IL-11) and IL-11 receptor alpha in human gastric carcinoma and IL-11 upregulates the ... 2006). "Expression of interleukin 11 and its receptor and their prognostic value in human breast cancer". Ann. Surg. Oncol. 13 ... 2006). "Expression of interleukin (IL)-11 and IL-11 receptor in human colorectal adenocarcinoma: IL-11 up-regulation of the ...
  https://en.wikipedia.org/wiki/Interleukin_11_receptor_alpha_subunit
*  Interleukin 11 - wikidoc
Template:Infobox gene Interleukin 11 (IL-11) is a protein that in humans is encoded by the IL11 gene.[1] ... 2002). "Interleukin-11 levels in healthy and thrombocytopenic neonates". Pediatr. Res. 51 (6): 756-60. PMID 12032273. doi: ... Interleukin 11 is manufactured using recombinant DNA technology and is marketed as a protein therapeutic called oprelvekin, for ... 1996). "Molecular cloning and characterization of murine interleukin-11.". Exp. Hematol. 24 (12): 1369-76. PMID 8913282.. ...
  http://wikidoc.org/index.php/IL-11
*  RCSB PDB - Protein Feature View - Interleukin-11 - P20809 (IL11 HUMAN)
The PDB archive contains information about experimentally-determined structures of proteins, nucleic acids, and complex assemblies. As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
  http://www.rcsb.org/pdb/protein/P20809
*  Interleukin-11 Links Oxidative Stress and Compensatory Proliferation | Science Signaling
Interleukin-11 Links Oxidative Stress and Compensatory Proliferation Message Subject. (Your Name) has forwarded a page to you ... Interleukin-11 Links Oxidative Stress and Compensatory Proliferation. By Takashi Nishina, Sachiko Komazawa-Sakon, Saeko Yanaka ... Interleukin-11 Links Oxidative Stress and Compensatory Proliferation. By Takashi Nishina, Sachiko Komazawa-Sakon, Saeko Yanaka ... Here, we showed that interleukin-11 (IL-11), a member of the IL-6 family of proinflammatory cytokines, was produced by cells in ...
  http://stke.sciencemag.org/content/5/207/ra5
*  Recombinant Mouse Interleukin-11 | Cell Sciences
Interleukin 11 is a pleiotropic cytokine that was originally detected in the conditioned medium of an IL-1α-stimulated primat ... p,Recombinant Mouse IL-11 is a a single non-glycosylated polypeptide chain containing 179 amino acids.,/p, ,p,Background: ... Background: Interleukin 11 is a pleiotropic cytokine that was originally detected in the conditioned medium of an IL-1α- ... Many of the biological effects described for IL-11 overlap those for IL-6. In vitro, IL-11 can synergize with IL-3, IL-4 and ...
  http://www.cellsciences.com/recombinant-mouse-il-11
*  Il11ra1 - Interleukin-11 receptor subunit alpha precursor - Rattus norvegicus (Rat) - Il11ra1 gene & protein
Receptor for interleukin-11. The receptor systems for IL6, LIF, OSM, CNTF, IL11 and CT1 can utilize IL6ST for initiating signal ... Interleukin-11 receptor subunit alphaAdd BLAST. 408. Amino acid modifications. Feature key. Position(s). DescriptionActions. ... Receptor for interleukin-11. The receptor systems for IL6, LIF, OSM, CNTF, IL11 and CT1 can utilize IL6ST for initiating signal ... interleukin-11 receptor activity Source: RGDInferred from sequence orthologyi*7957045 ...
  http://www.uniprot.org/uniprot/Q99MF4
*  Targeted-glycosylation of "non-core region" of interleukin-11 modulates its biological function. (57.15) | The Journal of...
Human interleukin-11 (hIL-11) is a pleiotropic cytokine administered to patients for recovering low platelet counts. From a ... Targeted-glycosylation of "non-core region" of interleukin-11 modulates its biological function. (57.15). Saeko Yanaka-Okada, ... Targeted-glycosylation of 'non-core region' of interleukin-11 modulates its biological function. (57.15) ... Targeted-glycosylation of "non-core region" of interleukin-11 modulates its biological function. (57.15) ...
  http://www.jimmunol.org/content/186/1_Supplement/57.15
*  Recombinant Human Interleukin-11 Treatment Enhances Collateral Vessel Growth After Femoral Artery Ligation | Arteriosclerosis,...
Recombinant Human Interleukin-11 Treatment Enhances Collateral Vessel Growth After Femoral Artery Ligation. Julius Aitsebaomo, ... Recombinant Human Interleukin-11 Treatment Enhances Collateral Vessel Growth After Femoral Artery Ligation ... Recombinant Human Interleukin-11 Treatment Enhances Collateral Vessel Growth After Femoral Artery Ligation ... Recombinant Human Interleukin-11 Treatment Enhances Collateral Vessel Growth After Femoral Artery Ligation ...
  http://atvb.ahajournals.org/content/early/2010/11/11/ATVBAHA.110.216986
*  Immunolocalisation of phosphorylated STAT3, interleukin 11 and leukaemia inhibitory factor in endometrium of women with...
Interleukin (IL-11) and leukemia inhibitory factor (LIF) are essential for murine implantation and signal via intracellular ... Immunolocalisation of phosphorylated STAT3, interleukin 11 and leukaemia inhibitory factor in endometrium of women with ... Endometrial IL-11, IL-11 receptor alpha (IL-11Ralpha), LIF and pSTAT3 in women with primary unexplained infertility was ... pSTAT3, IL-11, IL-11Ralpha and LIF production was determined by immunohistochemistry. Staining intensity was determoned by two ...
  https://www.sigmaaldrich.com/catalog/papers/18047677
*  Targeting Interleukin-11 Receptor-α Impairs Human Endometrial Cancer Cell Proliferation and Invasion In Vitro and Reduces Tumor...
Expression of interleukin 11 and its receptor and their prognostic value in human breast cancer. Ann Surg Oncol 2006;13:802-8. ... Targeting the interleukin-11 receptor alpha in metastatic prostate cancer: A first-in-man study. Cancer 2015;121:2411-21. ... Interleukin 11 regulates endometrial cancer cell adhesion and migration via STAT3. Int J Oncol 2012;41:759-64. ... Interleukin 11: similar or opposite roles in female reproduction and reproductive cancer? Reprod Fertil Dev 2014 Aug 25. [Epub ...
  http://mct.aacrjournals.org/content/15/4/720
*  Pathways: Interleukin-11 Signaling Pathwayfrom GENTAUR antibody-antibodies.com The Marketplace for Antibodies
Il33] Interleukin-33 (IL-33) [Cleaved into: Interleukin-33(102-266); Interleukin-33(109-266)]. [IRAK4] Interleukin-1 receptor- ... Interleukin-1 HY1) (IL-1HY1) (Interleukin-1 delta) (IL-1 delta) (Interleukin-1 family member 5) (IL-1F5) (Interleukin-1 homolog ... Interleukin-1 HY1) (IL-1HY1) (Interleukin-1 delta) (IL-1 delta) (Interleukin-1 family member 5) (IL-1F5) (Interleukin-1 ... Interleukin-33 (95-270); Interleukin-33 (99-270); Interleukin-33 (109-270)]. [IL36RN Fil1d Il1f5 Il1h3 Il1hy1] Interleukin-36 ...
  http://www.antibody-antibodies.com/pthw.php?pwid=WP2332
*  Interleukin-11: A cytokine signaling through gp130 with pleiotropic effects and potential clinical utility within and outside...
Interleukin-11: A cytokine signaling through gp130 with pleiotropic effects and potential clinical utility within and outside ... Interleukin-11: A cytokine signaling through gp130 with pleiotropic effects and potential clinical utility within and outside ... Interleukin-11: A cytokine signaling through gp130 with pleiotropic effects and potential clinical utility within and outside ...
  https://www.rdm.ox.ac.uk/publications/573549
*  Interleukin-6 and interleukin-11 support human osteoclast formation by a RANKL-independent mechanism. - Nuffield Department of...
... and interleukin-11 (IL-11) are known to influence osteoclast formation and bone resorption. In order to determine whether IL-6 ... These results indicate that IL-6 and IL-11, which are thought to play a role in several osteolytic bone disorders, are directly ... Osteoclastogenesis induced by IL-6 and IL-11 was inhibited by the addition of an anti-gp130 antibody but not by osteoprotegerin ... IL-6 and IL-11 induced the formation of multinucleated cells which were positive for TRAP, VNR, and calcitonin receptor and ...
  https://www.ndorms.ox.ac.uk/publications/103838
*  Marc Lacroix (biochemist) - Wikipedia
1998). "interleukin-11". Cancer Letters. 127 (1-2): 29-35. doi:10.1016/S0304-3835(97)00542-9. PMID 9619855. Sotiriou C, Lacroix ... 2001). "Interleukins-6 and-11 expression in primary breast cancer and subsequent development of bone metastases". Cancer ... notably interleukin-11, the production of which is reduced by the cyclooxygenase inhibitor aspirin. BCC also reduce the ... 11 (3): 497-522. doi:10.1677/erc.1.00758. PMID 15369451. Leclercq G, Lacroix M, Seo HS, Larsimont D. "Mechanisms regulating ...
  https://en.wikipedia.org/wiki/Marc_Lacroix_(biochemist)
*  Insight Biotechnology limited : : AAB-IL-1-2 : : RayBio C-Series Bovine Interleukin Array 1 Kit. Detects 11 Bovine Interleukin...
Kit Components: Bovine Interleukin Array C1 Membranes, Wash Buffer 1, Wash Buffer 2, Biotinylated Detection Antibody Cocktail, ... RayBio C-Series Bovine Interleukin Array 1 Kit. Detects 11 Bovine Interleukin proteins. Suitable for all liquid sample types. 5 ... RayBio C-Series Bovine Interleukin Array 1 Kit. Detects 11 Bovine Interleukin proteins. Suitable for all liquid sample types. 5 ...
  https://www.insightbio.com/productinfo/AAB-IL-1-2/RayBiotech%2C+Inc.
*  Oprelvekin (Professional Patient Advice) - Drugs.com
interleukins Proleukin, aldesleukin, Neumega. platelet-stimulating agents Promacta, romiplostim, Nplate, eltrombopag, Doptelet ... rhIL-11. Dosage Forms. Excipient information presented when available (limited, particularly for generics); consult specific ... Neuromuscular & skeletal: Severe weakness (14%), periosteal disease (children: 11%), arthralgia. Ophthalmic: Conjunctival edema ...
  https://www.drugs.com/ppa/oprelvekin.html
*  Patent US5489743 - Transgenic animal models for thrombocytopenia - Google Patents
Interleukin-11 Fusion Proteins. US20080317761 *. Apr 28, 2005. Dec 25, 2008. The Trustees Of The University Of Pennsylvania. ... xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:GCTTGAATTCCTTTACTCTGCG22(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) ... Interleukin-11 Fusion Proteins. US20100199367 *. Jun 4, 2007. Aug 5, 2010. Anziano Paul Q. Manganese superoxide dismutase exon ... interleukin 3 and/or stem cell factor at appropriate levels. Incubation of the cells is at 33 C., 37 C. or 39 C. The culture ...
  http://www.google.com/patents/US5489743?dq=5,894,079
*  Browsing by Title
Interleukin-11 dependent NFkB activation in cultured intestinal epithelial cells  Leung, Jeffrey Daniel Hawk-Ling (2008-08-01) ... Interleukin-17 modulates Ca2+ currents and neurite outgrowth in sympathetic neurons  Chisholm, Susan (2009-09-03) ... Interleukin-11 (IL-11) is a cytokine that promotes intestinal epithelial resistance to injury, however the mechanisms remain ... Panwar, Vivek (2011-11-07) Accurate registration of 3D data is one of the most challenging problems in a number of Computer ...
  http://qspace.library.queensu.ca/jspui/browse?type=title&sort_by=1&order=ASC&rpp=20&etal=-1&null=&offset=5958
*  SCF | definition of SCF by Medical dictionary
Interleukin-2.. T-cell growth factor II. Interleukin-4.. thyroid-stimulating hormone-releasing factor. Abbreviation: TSH-RF. An ... factor XI, plasma thromboplastin antecedent; factor XII, Hageman factor; factor XIII, fibrin-stabilizing factor; prekallikrein ... Interleukin-4.. B cell stimulatory factor II. Interleukin-6.. Bucky factor. See: Bucky, Gustav P.. cervical factor. In ... Interleukin-3.. mast cell growth factor II. Interleukin-4.. maturation-promoting factor. Abbreviation: MPF. A complex cellular ...
  https://medical-dictionary.thefreedictionary.com/SCF
*  Mir-10 microRNA precursor family - Wikipedia
Teramura, M; Kobayashi, S; Hoshino, S; Oshimi, K; Mizoguchi, H (1992). "Interleukin-11 enhances human megakaryocytopoiesis in ... acid miR-10b modulates invasiveness of endometriotic cells via dysregulation of the proteolytic milieu and interleukin-6 ... miR10 reappears by stage 11 (320-440 minutes post-fertilisation), where it is found in the ventral nerve cord, posterior midgut ...
  https://en.wikipedia.org/wiki/Mir-10_microRNA_precursor_family