*  SAXS and X-ray Crystallography Studies of the Cellulosome from Clostridium thermocellum
Cellulosomes are the most efficient plant cell wall degradation machines discovered to date. All cellulosomal components contain protein modules connected by linkers of varying lengths, which are predicted to be flexible. Consequently, structural studies of the cellulosome have employed a "dissect and build" strategy, whereby individual modules are studied in isolation with the hope to later model the intact complex. However, representative individual structures are now available for all of the cellulosome modules and many questions still remain. The studies described in this thesis depart from the 'dissection' stage and enter the 'build' stage of cellulosome structural studies of the cellulosome from Clostridium thermocellum. We first describe the crystal structure of a heterodimeric complex comprising the type-II cohesin (CohII) from cell surface anchoring protein SdbA and a trimodular C-terminal truncation of the CipA scaffoldin protein containing the ninth type-I cohesin ...
  http://qspace.library.queensu.ca/handle/1974/6042
*  Clostridium thermocellum CelJ protein Summary Report | CureHunter
Clostridium thermocellum CelJ protein: isolated from Clostridium thermocellum; amino acid sequence in first source; GenBank D83704
  http://www.curehunter.com/public/keywordSummaryC101903-Clostridium-thermocellum-CelJ-protein.do
*  Genome-scale metabolic analysis of Clostridium thermocellum for bioethanol production | BMC Systems Biology | Full Text
Current and future demands for renewable energy sources have spurred research in developing biofuels. One promising route for biofuel production is to use an organism-based bioprocess where cellulose could be converted to biofuel. One of the main challenges to this approach is that there are relatively few cellulolytic organisms capable of biofuel production, and none of these are especially well-characterized at present. Here we have implemented a computational modeling approach to study C. thermocellum, an anaerobic thermophile with high biofuel production potential. In this study, the development of a genome-scale metabolic model of C. thermocellum was used to provide a framework for analyzing the basic metabolic functions of C. thermocellum and improving its ethanol production capabilities. Overall, we report the construction of a genome-scale metabolic model of C. thermocellum, i SR432, and the accuracy of this model to ...
  https://bmcsystbiol.biomedcentral.com/articles/10.1186/1752-0509-4-31
*  Tracking the cellulolytic activity of Clostridium thermocellum biofilms
Background: Microbial cellulose conversion by Clostridium thermocellum 27405 occurs predominantly through the activity of substrate-adherent bacteria organized in thin, primarily single cell-layered biofilms. The importance of cellulosic surface exposure to microbial hydrolysis has received little attention despite its implied impact on conversion kinetics. Results: We showed the spatial heterogeneity of fiber distribution in pure cellulosic sheets, which made direct measurements of biofilm colonization and surface penetration impossible. Therefore, we utilized on-line measurements of carbon dioxide (CO2) production in continuous-flow reactors, in conjunction with confocal imaging, to observe patterns of biofilm invasion and to indirectly estimate microbial accessibility to the substrate's surface and the resulting limitations on conversion kinetics. A strong positive correlation was found between cellulose consumption and CO2 production (R2 = 0.996) and between surface area ...
  http://scholar.sun.ac.za/handle/10019.1/97385
*  RCSB PDB - 4JSY: Structure of Clostridium thermocellum polynucleotide kinase bound to GTP Macromolecule Annotations...
4JSY: Structural and biochemical analysis of the phosphate donor specificity of the polynucleotide kinase component of the bacterial pnkphen1 RNA repair system.
  http://www.rcsb.org/pdb/explore/derivedData.do?structureId=4JSY
*  Functional heterologous expression of an engineered full length CipA from Clostridium thermocellum in Thermoanaerobacterium...
Here we report the expression of an engineered CipA* under the control of a novel inducible promoter in T. saccharolyticum which allowed for the assembly of active cellulosomes when co-cultured with a cipA deletion strain of C. thermocellum.. The wild-type cipA gene has multiple sections with essentially identical DNA sequences, corresponding to the 9 type-I dockerin regions [7]. These repeated sequences can be problematic by complicating sequence verification via routine sequencing technology and could also lead to unwanted partial gene deletion via homologous recombination. Many strains of E. coli used to heterologously express cellulosomal proteins for biochemical studies are recA- [24, 27, 38]. However, studies such as this one which seek to integrate cellulase genes into the chromosome via native host machinery must use recA+ strains thereby exacerbating the challenge of homologous recombination. By using cipA*, designed to avoid repeated sequences, routine sequencing proceeded without ...
  https://biotechnologyforbiofuels.biomedcentral.com/articles/10.1186/1754-6834-6-32
*  Genetic engineering of Clostridium thermocellum DSM1313 for enhanced ethanol production | BMC Biotechnology | Full Text
Blending of ethanol with fossil fuel is recommended to address the problem of increasing demand for transportation fuel without environmental pollution. This implementation was planned because ethanol is derived from renewable biological sources, and has promising properties such as anti-knock potential [1, 2] and cleaner combustion [3, 4]. Several countries around the world are adopting this strategy, and are planning to increase the percentage of ethanol blending in a phased manner [5]. In this context, allocation of natural resources for ethanol production in place of food production, and completing interests in ethanol for industrial and potable purposes are the major concerns to be addressed. For example, sugarcane molasses serves as the sole feedstock for bioethanol production in India where the annual production is approximately 2.7 billion litres of which only 30 % is offered for fuel purposes [6, 7]. When considering the supply of feedstock, increasing the production of ethanol from ...
  https://bmcbiotechnol.biomedcentral.com/articles/10.1186/s12896-016-0260-2
*  Cellobiohydrolase 9A from Clostridium thermocellum, Recombinant - Creative Enzymes
Cellulose 1,4-beta-cellobiosidase (non-reducing end) (EC 3.2.1.91, exo-cellobiohydrolase, beta-1,4-glucan cellobiohydrolase, beta-1,4-glucan cellobiosylhydrolase, 1,4-bet
  https://www.creative-enzymes.com/product/Cellobiohydrolase-9A-From-Clostridium-Thermocellum-Recombinant_3531.html
*  RCSB PDB - 1GKL: S954A mutant of the feruloyl esterase module from clostridium thermocellum complexed with ferulic...
1GKL: The Structure of the Feruloyl Esterase Module of Xylanase 10B from Clostridium Thermocellum Provides Insights Into Substrate Recognition
  http://www.rcsb.org/pdb/explore/litView.do?structureId=1GKL
*  UTL Repository: A family 11 carbohydrate-binding module (CBM) improves the efficacy of a recombinant cellulase used to...
1. Exogenous microbial -1,3-1,4-glucanases and hemicellulases contribute to improving the nutritive value of cereals rich in soluble non-starch polysaccharides for poultry. 2. In general, plant cell wall hydrolases display a modular structure comprising a catalytic module linked to one or more non-catalytic carbohydrate-binding modules (CBMs). Based on primary structure similarity, CBMs have been classified in 50 different families. CBMs anchor cellulases and hemicellulases into their target substrates, therefore eliciting efficient hydrolysis of recalcitrant polysaccharides. 3. A study was undertaken to investigate the effects of a family 11 -glucan-binding domain in the function of recombinant derivatives of cellulase CtLic26A-Cel5E of Clostridium thermocellum that were used to supplement a barley-based diet at lower dosage rates. 4. The results showed that birds fed on diets supplemented with the recombinant CtLic26A-Cel5E modular derivative containing the family 11 CBM ...
  http://www.repository.utl.pt/handle/10400.5/5518
*  Evaluation of the bioconversion of genetically modified switchgrass using simultaneous saccharification and fermentation and a...
The combination of a feedstock with increased enzymatic digestibility in combination with the CBP approach, which will eliminate the need for exogenous hydrolytic enzymes, has the potential to further reduce the cost of biofuels. Therefore we examined the fermentation performance of both wild-type and transgenic switchgrass lines using Clostridium thermocellum, Caldicellulosiruptor obsidiansis, and Caldicellulosiruptor bescii. Using three lines of switchgrass down-regulated in the COMT gene[12], we have shown that a milder pretreatment process does not impact the improved product yield generated by fermentation of the COMT down-regulated switchgrass biomass during yeast-based SSF. However, when a CBP-capable bacterium is tested, a significant differential of fermentation inhibition is detected, as judged by product yield on carbohydrate. In the case of C. thermocellum fermentations of dilute acid pretreated feedstock, the cellulosome and/or ...
  https://biotechnologyforbiofuels.biomedcentral.com/articles/10.1186/1754-6834-5-81
*  IJMS | Free Full-Text | Molecular Modeling and MM-PBSA Free Energy Analysis of Endo-1,4-β-Xylanase from Ruminococcus albus 8
Endo-1,4-β-xylanase (EC 3.2.1.8) is the enzyme from Ruminococcus albus 8 (R. albus 8) (Xyn10A), and catalyzes the degradation of arabinoxylan, which is a major cell wall non-starch polysaccharide of cereals. The crystallographic structure of Xyn10A is still unknown. For this reason, we report a computer-assisted homology study conducted to build its three-dimensional structure based on the known sequence of amino acids of this enzyme. In this study, the best similarity was found with the Clostridium thermocellum (C. thermocellum) N-terminal endo-1,4-β-d-xylanase 10 b. Following the 100 ns molecular dynamics (MD) simulation, a reliable model was obtained for further studies. Molecular Mechanics/Poisson-Boltzmann Surface Area (MM-PBSA) methods were used for the substrate xylotetraose having the reactive sugar, which was bound in the −1 subsite of Xyn10A in the 4C1 (chair) and 2SO (skew boat) ground state conformations. According to the simulations and free ...
  http://www.mdpi.com/1422-0067/15/10/17284
*  "Superiority of the PCR-based Approach for Cloning the Acetate Kinase G" by G. Ozcengiz, J-H Kim et al.
Cloning of Clostridium thermocellum acetate kinase (ack) and/or phosphotransacetylase (pta) genes in Escherichia coli by functional complementation of ack and/or pta mutants was complicated by an alternative acetate assimilation pathway involving acetyl-CoA synthetase (ACS). In addition to the problems encountered with the complementation approach, cloning of these genes was not readily achieved using heterologous probing with corresponding genes from Escherichia coli and Methanosarcina thermophila due to the lack of sufficient homology. The use of a PCR-based approach, on the other hand, yielded a specific C. Thermocellum gene fragment which showed significant sequence identity to the ack gene for which primers were designed. The subcloned ack fragment was then successfully used as a probe for the isolation of the corresponding gene and restriction analysis of that region.
  http://scholarsmine.mst.edu/biosci_facwork/10/
*  Reassembly and co-crystallization of a family 9 processive endoglucanase from its component parts: Structural and functional...
Non-cellulosomal processive endoglucanase 9I (Cel9I) from Clostridium thermocellum is a modular protein, consisting of a family-9 glycoside hydrolase (GH9) catalytic module and two family-3 carbohydrate-binding modules (CBM3c and CBM3b), separated by linker regions. GH9 does not show cellulase activity when expressed without CBM3c and CBM3b and the presence of the CBM3c was previously shown to be essential for endoglucanase activity. Physical reassociation of independently expressed GH9 and CBM3c modules (containing linker sequences) restored 60-70% of the intact Cel9I endocellulase activity. However, the mechanism responsible for recovery of activity remained unclear. In this work we independently expressed recombinant GH9 and CBM3c with and without their interconnecting linker in Escherichia coli. We crystallized and determined the molecular structure of the GH9/linker-CBM3c heterodimer at a resolution of 1.68 Å to understand the functional and structural importance of the ...
  https://peerj.com/preprints/1133/
*  Metabolic control ofClostridium thermocellumvia inhibition of hydrogenase activity and the glucose transport rate | SpringerLink
Clostridium thermocellum has the ability to catabolize cellulosic biomass into ethanol, but acetic acid, lactic acid, carbon dioxide, and hydrogen gas (H2) are also produced. The effect of hydrogenase
  https://link.springer.com/article/10.1007%2Fs00253-011-3812-3
*  KEGG ENZYME: 3.2.1.176
Some exocellulases, most of which belong to the glycoside hydrolase family 48 (GH48, formerly known as cellulase family L), act at the reducing ends of cellulose and similar substrates. The CelS enzyme from Clostridium thermocellum is the most abundant subunit of the cellulosome formed by the organism. It liberates cellobiose units from the reducing end by hydrolysis of the glycosidic bond, employing an inverting reaction mechanism [2]. Different from EC 3.2.1.91, which attacks cellulose from the non-reducing end ...
  http://www.genome.jp/dbget-bin/www_bget?ec:3.2.1.176
*  RCSB PDB - 1GMM: Carbohydrate binding module CBM6 from xylanase U Clostridium thermocellum Macromolecule Annotations...
1GMM: The Location of the Ligand-Binding Site of Carbohydrate-Binding Modules that Have Evolved from a Common Sequence is not Conserved.
  http://www.rcsb.org/pdb/explore/derivedData.do?structureId=1GMM
*  Single, key gene discovery could streamline production of... ( WASHINGTON DC -- A team of researche...)
...WASHINGTON DC -- A team of researchers at the Department of Energy's ... The Department of Energy relies on the scientific discoveries of its ...The discovery of the gene controlling ethanol production in a microorg...Although scientists have studied Clostridium thermocellum for decades...,Single,,key,gene,discovery,could,streamline,production,of,biofuels,,biological,biology news articles,biology news today,latest biology news,current biology news,biology newsletters
  http://www.bio-medicine.org/biology-news-1/Single--key-gene-discovery-could-streamline-production-of-biofuels--20819-1/
*  Characterization ofClostridium thermocellumstrains with disrupted fermentation end-product pathways | SpringerLink
Clostridium thermocellum is a thermophilic, cellulolytic anaerobe that is a candidate microorganism for industrial biofuels production. Strains with mutations in genes associated with production of l-
  https://link.springer.com/article/10.1007%2Fs10295-013-1275-5
*  Cellobiosio fosforilasi - Wikipedia
La cellobiosio fosforilasi è un enzima appartenente alla classe delle transferasi, che catalizza la seguente reazione: cellobiosio + fosfato ⇄ α-D-glucosio 1-fosfato + D-glucosio Alexander, J.K., Purification and specificity of cellobiose phosphorylase from Clostridium thermocellum, in J. Biol. Chem., vol. 243, 1968, pp. 2899-2904, Entrez PubMed 5653182. Ayers, W.A., Phosphorolysis and synthesis of cellobiose by cell extracts from Ruminococcus flavefaciens, in J. Biol. Chem., vol. 234, 1959, pp. 2819-2822, Entrez PubMed 13795349 ...
  https://it.wikipedia.org/wiki/Cellobiosio_fosforilasi
*  High Force And High Stress Destructuring Of Cellulosic Biomass (E I Du Pont De Nemours And)
A process for mechanical destructuring of cellulosic biomass was developed that makes use of a short application of high compression, impact, and shearing forces. The biomass may be destructured using a specific energy input that is less than 40% of the total combustible energy of the biomass. The destructured biomass,
  http://www.freshpatents.com/-dt20150528ptan20150147311.php
*  Necessity of enzymatic hydrolysis for production and functionalization of nanocelluloses
Nanocellulose (NC) from cellulosic biomass has recently gained attention owing to their biodegradable nature, low density, high mechanical properties, economic value and renewability. They still suffer, however, some drawbacks. The challenges are the exploration of raw materials, scaling, recovery of chemicals utilized for the production or functionalization and most important is toxic behavior that hinders them from implementing in medical/pharmaceutical field. This review emphasizes the structural behavior of cellulosic biomass and biological barriers for enzyme interactions, which are pertinent to understand the enzymatic hydrolysis of cellulose for the production of NCs. Additionally, the enzymatic catalysis for the modification of solid and NC is discussed. The utility of various classes of enzymes for introducing desired functional groups on the surface of NC has been further examined. Thereafter, a green mechanistic approach is applied for ...
  http://ltu.diva-portal.org/smash/record.jsf?pid=diva2:1076811
*  RNA repair - Humpath.com - Human pathology
References Mansfield SG, Chao H, Walsh CE. RNA repair using spliceosome-mediated RNA trans-splicing. Trends Mol Med. 2004 Jun;10(6):263-8. (...)
  http://www.humpath.com/spip.php?article3823
*  The Role of Cdh1p in Maintaining Genomic Stability in Budding Yeast | Genetics
hxt13::URA3 was constucted by PCR using pRS306 (Sikorski and Hieter 1989) as a template and primers consisting of 50 bases 5′ and 3′ to HXT13 followed by sequences that anneal to the regions flanking the URA3 gene in pRS306 [KRO230 (hxt13-forward) 5′-CACGTAAGGCATAACAATCAAAAAAAG AAAAAAGAAACAAAAGTTAAACCGCATCAGAGCAGATT GTACTG-3′ and KRO231 (hxt13-reverse) 5′-AACTATAATA TACAATGTTGCCTATCAAGACAAACATATGCACTCTATG ACTCCTTACGCATCTGTGCGG-3′]. The PCR product was tranformed into BY4742 (MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0; S288c background; Yeast Consortium, ResGen, Invitrogen, Huntsville, AL) to create strain 3118. sic1::kan and cdh1::kan (strain 3124) with 400 bases of flanking sequence 5′ and 3′ were amplified from the sic1::kan and cdh1::kan strains from the Saccharomyces Genome Deletion Project MATa Collection (Yeast Consortium; ResGen, Invitrogen) using the following primers: KRO235 (sic1-forward), 5′-GGCCAACTCTTGTT GTAGTTG-3′; KRO195 (sic1-reverse), 5′-GTCACTTCTAGCA AATTTGG-3; ...
  http://www.genetics.org/content/165/2/489
*  Difference between CIP & CIPA
The difference between CIP & CIPA is that in CIP the person only cant feel pain but in case of CIPA the person cannot sweat and probably has malformations in his/ her body. ...
  http://raregeneticdisorder.blogspot.com/2012/07/difference-between-cip-cipa.html