*  Patent US6905823 - Cellular arrays and methods of detecting and using genetic disorder markers - Google Patents
... providing copies of the array, and performing a different biological analysis of each copy. The results of the different ... analyses. The results of the parallel analyses are then used to detect common molecular characteristics of the genetic disorder ... analyses are compared to determine if there are correlations between the results of the different biological analyses at each ... profiling of tissue or other cellular specimens by placing a donor specimen in an assigned location in a recipient array, ...
*  SMART: Secondary literature for CXC domain
sequences deposited in the expressed sequence tag and genomic sequence databases. Full-length cDNAs for each of the genes, Cam7 ... Analysis of microtubule arrays during cell cycle in ple and hya roots indicates that the presence of several synchronized ... Using an oligonucleotide array comprising approximately 8200 Arabidopsis genes we investigated the effect of endoplasmic ... Cloning and sequencing of full-length BiP-L cDNA showed it contained a signal peptide sequence and the ER retention signal ( ...
*  Genomic resources for Myzus persicae: EST sequencing, SNP identification, and microarray design
Gene expression differences that underlie within-species variation can be identified by microarray analysis. By sequencing cDNA ... In addition, the high cost of purchasing synthesized oligonucleotides makes traditional custom printing of high density arrays ... cDNA Library Construction and Sequencing. As summarized in Table ​Table3,3, 16 cDNA libraries representing a diversity of ... Altogether, sequencing of the cDNA libraries produced a total of 26,759 high quality sequencing reads, which have been ...
*  Representational difference analysis - Wikipedia
... is a technique used in biological research to find sequence differences in two genomic or cDNA samples. Genomes or cDNA ... This technology has been further enhanced through the development of representation oligonucleotide microarray analysis (ROMA ... which uses array technology to perform such analyses. This method may also be adapted to detect DNA methylation differences, as ... As more cycles of RDA are performed, the pool of unique sequence fragment copies will grow faster than fragments found in both ...
*  JoVE | Peer Reviewed Scientific Video Journal - Methods and Protocols
Array comparative genomic hybridization (array CGH) is a method for detecting gains and losses of DNA segments or gene dosage ... Global Gene Expression Analysis Using a Zebrafish Oligonucleotide Microarray Platform. Authors: Samuel M. Peterson, Jennifer L ... For this platform, all cDNA and genomic information available for the zebrafish was collected from various genomic databases ... The array data generates high-resolution maps with the ability to identify sequence-specific and structural determinates of ...
*  CandidatusLiberibacter americanus induces significant reprogramming of the transcriptome of the susceptible citrus genotype |...
Microarray experiment and data analysis. Roche Nimblegen Systems (Madison, WI, USA) designed an oligonucleotide array at a ... Coletta-Filho HD, Takita MA, Targon MLPN, Machado MA: Analysis of the 16S rDNA sequences from citrus-huanglongbing bacteria ... primer using RevertAidTM H Minus First Strand cDNA Synthesis Kit (Fermentas, Burlington, ON, Canada). The final cDNA products ... Genomic DNA contamination was removed with recombinant DNAse I (QIAGEN). Total RNA concentration and purity were determined ...
*  Genomic and Molecular Characterization of Malignant Peripheral Nerve Sheath Tumor Identifies the IGF1R Pathway as a Primary...
These arrays represent more than 43,000 coding and noncoding human sequences yielding an average of 35-kbp oligonucleotide ... Analysis of chromosomal imbalances in sporadic and NF1-associated peripheral nerve sheath tumors by comparative genomic ... the IGF1R cDNA insert was digested by EcoR1 and then ligated to the pCDNA3.1(+). Positive clones were verified by sequencing. ... Array-based comparative genomic hybridization identifies CDK4 and FOXM1 alterations as independent predictors of survival in ...
*  Comparative multi-omics systems analysis of Escherichia coli strains B and K-12 | Genome Biology | Full Text
... were used for comparative genomic analysis. Alignments were generated by the MUMmer 3.19 package. Genomic segments specific to ... Genome analysis. Detailed procedures for genome sequencing and annotation of REL606 have been described previously [6]. RefSeq ... Construction of oligonucleotide microarray. Oligonucleotide microarrays were constructed in which both REL606 and MG1655 could ... Probes (70-mers) were designed by Array Designer (Premier Biosoft International, Palo Alto, CA, USA) and cross-hybridization ...
*  Comparative Analysis of Transcriptional Profiles of Adult Schistosoma japonicum from Different Laboratory Animals and the...
... were provided to Roche NimbleGen for array design. For each sequence, 3 or 4 60-mer oligonucleotide probes were designed. ... cDNA was labeled with a fluorescent dye (Cy3-dCTP) using cRNA Amplification and Labeling Kit (CapitalBio, Beijing, China). ... Total RNA was extracted from worms from different animals using the RNeasy Mini kit (QIAGEN), and contaminating genomic DNA was ... Sequence alignment analysis revealed that these genes shared no sequence similarity to any sequence present in the non- ...
*  Custom oligonucleotide array-based CGH: a reliable diagnostic tool for detection of exonic copy-number changes in multiple...
Comprehensive oligonucleotide array-comparative genomic hybridization analysis: new insights into the molecular pathology of ... DNA sequencing CGH array results were used to target the genomic region to design primers for sequencing breakpoints. Primers ... Interestingly, in a case of isolated duplication of exon 44 detected by cDNA analysis but not by QF-PCR, CGH array identified ... We developed a custom-targeted oligonucleotide-based CGH array containing 135 000 oligonucleotide probes covering genomic ...
*  Extracellular RNA - Wikipedia
... next-generation sequencing) lead to variations in DNA sequencing that allowed for high-throughput analyses of many genomic ... Microarrays used for RNA studies first generate different cDNA oligonucleotides (probes) that are attached to the microarray ... Micro RNA arrays have been used in exRNA studies to generate miRNA profiles of bodily fluids. The advent of massively parallel ... RT-PCR, cDNA microarrays, and RNA sequencing are common techniques for RNA analysis. Applying these methods to study exRNAs ...
*  Publication Announcements - Canada's Michael Smith Genome Sciences Centre
Software for CNV analysis using Affymetrix SNP arrays Assessment of algorithms for high throughput detection of genomic copy ... Whole Transciptome Shotgun Sequencing Profiling the HeLa S3 transciptome using randomly primed cDNA and massively parallel ... number variation in oligonucleotide microarray data. Publication. Jul 01, 2008. Optimal pooling of BACs for genome re- ... A physical map of the highly heterozygous Populus genome: integration with the genome sequence and genetic map and analysis of ...
*  Gene annotation overlap between experiments. Venn diagr | Open-i
Oligonucleotide Array Sequence Analysis/methods*. Minor. *Artificial Intelligence. *Data Compression/methods. *Databases, ... two channel cDNA arrays and single channel Affymetrix arrays) [14]. ... we used mappings that matched each feature to genomic information available from the NCBI Entrez gene database. We used the R ... two channel cDNA arrays and single channel Affymetrix arrays) [14]. ...
*  Transcriptome and Proteome Research in Veterinary Science: What Is Possible and What Questions Can Be Asked?
Another advantage of RNA-Seq is potential analysis of genomes from organisms without complete genomic sequence information, ... "Determination of ancestral alleles for human single-nucleotide polymorphisms using high-density oligonucleotide arrays," Nature ... sequencing has been applied to cDNA sequencing to obtain information on the full set of all transcribed RNA sequences within a ... pairwise hybridization of the given sequences on the chip with complementary DNA or cDNA sequences (targets) in a tissue lysate ...
*  Bacterial RNA Isolation From Infected Eukaryotic Hosts ( Remove 90% of mamma...)
Enables microarray expression analysis with bacteri...,Bacterial,RNA,Isolation,From,Infected,Eukaryotic,Hosts,biological, ... such as array analysis. Figure 3 shows Sigma-Genosys Panorama E. coli arrays that were hybridized with labeled cDNA derived ... Monitoring Bacterial Genetic Diversity in a Freshwater Lake Using TTGE and DNA Sequence Analysis. 10. Use of the DCode System ... Next, the rRNA/oligo nucleotide hybrids and all polyadenylated mRNAs are removed from the mixture with oligonucleotide- ...
*  Plus it
Analysis of the RDN1 Gene Sequence. The sequence of RDN1 cDNA amplified from root tissue shows an open reading frame (ORF) of ... The Gene Chip Medicago Genome Array (Affymetrix) was used for oligonucleotide hybridization experiments comparing transcript ... Alignment of the cDNA sequence with the genomic sequence shows a 7.4-kb gene consisting of nine exons and eight introns ... Sequences from selected organisms with sequenced genomes were used for analysis. No sequences with a probability relationship ...
*  Mapping the Genetic Architecture of Gene Expression in Human Liver
... noncontrol oligonucleotides extracted from mouse Unigene clusters and combined with RefSeq sequences and RIKEN full-length cDNA ... Each DNA sample was genotyped on the Affymetrix 500K SNP and Illumina 650Y SNP genotyping arrays. Analysis was restricted to ... Because RNA-free genomic DNA was required for processing, 4 μl RNase A (100 mg/ml) was added and mixed by vortexing, followed ... Array design and preparation of labeled cDNA and hybridizations to microarrays for the human liver cohort. RNA preparation and ...
*  Targeted Analysis of Whole Genome Sequence Data to Diagnose Genetic CardiomyopathyCLINICAL PERSPECTIVE | Circulation: Genomic...
... off-target sequencing, and omission of noncanonical transcripts, all especially important in the heart.7,8 WES arrays are ... WES interrogates only the coding sequence and relies on an exon capture step. This capture step is limited by oligonucleotide ... Full-length human desmin cDNA (Origene) was mutated. Wild-type and mutant plasmid was placed into pcDNA3.1/His C (Invitrogen) ... NISC Comparative Sequencing Program. Distribution and intensity of constraint in mammalian genomic sequence. Genome Res. 2005; ...
*  Annexin A7 - Wikipedia
2004). "Optimization of oligonucleotide arrays and RNA amplification protocols for analysis of transcript structure and ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... 1994). "Genomic organization and chromosomal localization of the mouse synexin gene". Biochem. J. 301 (Pt 3): 835-45. PMC ... Structural analysis of the protein suggests that Annexin VII is a membrane binding protein with diverse properties including ...
*  Gene expression profiling in cancer - Wikipedia
Techniques include DNA microarray technology or sequenced-based techniques such as serial analysis of gene expression (SAGE). ... makes use primarily of DNA microarrays in which an arrayed series of microscopic spots of pre-defined DNA oligonucleotides ... cDNA) sequences on the gene chip. The chip is then scanned for the presence and strength of the fluorescent labels at each spot ... In a particular type of cell or tissue, only a small subset of an organism's genomic DNA will be expressed as mRNAs at any ...
*  Alternative Isoform Detection Using Exon Arrays: Medicine & Healthcare Book Chapter | IGI Global
Eukaryotic genes have the ability to produce several distinct products from a single genomic locus. Recent developments in ... Alternative Isoform Detection Using Exon Arrays: 10.4018/978-1-60566-076-9.ch015: ... EST: Expressed sequence tag. Short sequence reads are produced on large scale from cDNA libraries. EST sequencing allowed ... Here, we use our study to illustrate the use of Exon Arrays to detect alternative isoforms, to outline the analysis involved, ...
*  Patent US20030228601 - Transfection method and uses related thereto - Google Patents
For example, the transfection array can include coding sequence from cDNAs or genomic DNA. In addition to native sequences, the ... Array of oligonucleotides on a solid substrate. US5654185 *. Jun 7, 1995. Aug 5, 1997. The Regents Of The University Of ... Currently, in vivo analysis can be done, on a gene-by-gene scale, by expressing with cells a nucleic acid construct that ... To illustrate, the subject method contemplates (a) constructing a cDNA or genomic transfection array including cDNA or genomic ...
*  Methods and strategies for analyzing copy number variation using DNA microarrays
... cDNA clones (0.5-2 kb), genomic PCR products (100 bp-1.5 kb) and oligonucleotides (25-80 bp). While the resolution of an array ... Sequence variation in genes and genomic DNA: methods for large-scale analysis. Annu. Rev. Genomics Hum. Genet. 2000;1:329-360. ... Oligonucleotide arrays. Oligonucleotides provide the highest potential resolution for array-CGH, and early arrays were ... BAC to the future! or oligonucleotides: a perspective for micro array comparative genomic hybridization (array CGH) Nucleic ...
*  Seminar Bio-Datenbanken WS02/03 Literatur | Abteilung Datenbanken Leipzig
Cornell, M., Paton, N.; Goble, C.A. et al.: GIMS - A Data Warehouse for Storage and Analysis of Genome Sequence and Functional ... Lockhart, D.J. et al.: Expression Monitoring by Hybridization to High-density Oligonucleotide Arrays. Nat. biotechnol. 14, 1675 ... Gelbart, W.M.: Databases in Genomic Research. Science, 1998, Vol. 282. Baxevanis, A.D.: The Molecular Biology Database ... Cheung, V.G. et al.: Expression profiling using cDNA microarrays. Nature genetics supplement, 1999, Vol. 21. ...
*  Plus it
Ras mutation analysis. Genomic DNA was isolated from normal skin, three squamous papillomas, and a squamous cell carcinoma ... We used the Nimblegen mouse promoter array to examine binding to 21,815 promoters, each represented by 15 oligonucleotides. ... This plasmid was digested with HindIII (partial) and NdeI and ligated to the A-FOS cDNA digested with the same enzymes from the ... The sequences of the 28-mer DNA probes are GTCAGTCAGAATGACTCATATCGGTCAG (AP-1) for FOS/JUND heterodimer, GTCAGTCAGATTGCGCAAT ...