Loading...
*  Histochemical studies of fibroblasts from patients with Menkes kinky hair disease and Wilson's disease | SpringerLink
Cytochrome oxidase activity, however, was greatly reduced in... ... biogenic amines and amine oxidases. InBiological Role of Copper ... Cultured fibroblasts from Menkes kinky hair disease patients showed markedly reduced succinate dehydrogenase and amine oxidase ... Kapeller-Alden, R. (1970)Amine Oxidase and Methods for Their Study. pp. 258-259. New York: Wiley Interscience.Google Scholar ... Amine oxidase activity was only slightly reduced when compared to that of normal. These results indicated that the ...
  https://link.springer.com/article/10.1007/BF01033627
*  Copper distributed by Atx1 is available to copper amine oxidase 1 in schizosaccharomyces pombe on Environmental XPRT
Copper amine oxidases (CAOs) have been proposed to be involved in the metabolism of xenobiotic and biogenic amines. The ... Article Copper distributed by Atx1 is available to copper amine oxidase 1 in schizosaccharomyces pombe. ... Copper distributed by Atx1 is available to copper amine oxidase .... Copper distributed by Atx1 is available to copper amine ... Copper amine oxidases (CAOs) have been proposed to be involved in the metabolism of xenobiotic and biogenic amines. The ...
  https://www.environmental-expert.com/articles/copper-distributed-by-atx1-is-available-to-copper-amine-oxidase-1-in-schizosaccharomyces-pombe-39534
*  Copper amine oxidase-like, N-terminal domain superfamily (IPR036582) | InterPro | EMBL-EBI
Amine oxidases (AO) are enzymes that catalyse the oxidation of a wide range of biogenic amines including many neurotransmitters ... The copper amine oxidases occur as mushroom-shaped homodimers of 70-95 kDa, each monomer containing a copper ion and a ... There are two classes of amine oxidases: flavin-containing (EC:1.4.3.4) and copper-containing (EC:1.4.3.6). Copper-containing ... Copper-containing amine oxidases are found in bacteria, fungi, plants and animals. In prokaryotes, the enzyme enables various ...
  http://www.ebi.ac.uk/interpro/entry/IPR036582
*  AOC2 (Human) Recombinant Protein (P01) - (H00000314-P01) - Products - Abnova
Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes and ammonia in the presence of copper and ... It may be a critical modulator of signal transmission in retina, possibly by degrading the biogenic amines dopamine, histamine ... This gene shows high sequence similarity to copper amine oxidases from various species ranging from bacteria to mammals. The ... several conserved motifs including the active site of amine oxidases and the histidine residues that likely bind copper. ...
  http://www.abnova.com/products/products_detail.asp?catalog_id=H00000314-P01
*  AOC2 Gene - GeneCards | AOC2 Protein | AOC2 Antibody
Copper Containing 2, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene ... Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes and ammonia in the presence of copper and ... It may be a critical modulator of signal transmission in retina, possibly by degrading the biogenic amines dopamine, histamine ... AOC2 (Amine Oxidase, Copper Containing 2) is a Protein Coding gene. Diseases associated with AOC2 include Median Neuropathy and ...
  http://www.genecards.org/cgi-bin/carddisp.pl?gene=AOC2
*  AOC2 - Wikipedia
Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes and ammonia in the presence of copper and ... It may be a critical modulator of signal transmission in retina, possibly by degrading the biogenic amines dopamine, histamine ... Amine oxidase, copper containing 2 is a protein that in humans is encoded by the AOC2 gene. ... This gene shows high sequence similarity to copper amine oxidases from various species ranging from bacteria to mammals. The ...
  https://en.wikipedia.org/wiki/AOC2
*  Amine oxidase (copper-containing) - Wikipedia
... these enzymes catalyze the oxidation of a wide range of biogenic amines including many neurotransmitters, histamine and ... The copper amine oxidase 3-dimensional structure was determined through X-ray crystallography. The copper amine oxidases occur ... Amine oxidase (copper-containing) (AOC) (EC 1.4.3.21 and EC 1.4.3.22; formerly EC 1.4.3.6) is a family of amine oxidase enzymes ... Yamada H, Adachi O & Ogata K (1965). "Amine oxidases of microorganisms. Part III. Properties of amine oxidase of Aspergillus ...
  https://en.wikipedia.org/wiki/Amine_oxidase_(copper-containing)
*  Sensors | Free Full-Text | Fiber-Optic Chemical Sensors and Fiber-Optic Bio-Sensors | HTML
... catechol amines, biogenic amines, gamma-amino butyric acid [116], phosphate, nitrate, sulphate [117], hydrogen peroxide, phenol ... Glucose oxidase is one of the enzyme oxidases which react with molecular oxygen to catalyze the oxidation of a substrate. ... Amine, A.; Palleschi, G. Phosphate, nitrate, and sulfate biosensors. Anal. Lett. 2004, 37, 1-19. [Google Scholar] [CrossRef] ... The sensor of adrenaline [121] employed an enzyme laccase immobilized on the copper tetra-aminophthalocyanine magnetite ...
  http://www.mdpi.com/1424-8220/15/10/25208/htm
*  Human Metabolome Database: Showing metabocard for 3,4-Dihydroxyphenylacetaldehyde (HMDB0003791)
7. Retina-specific copper amine oxidase. General function:. Involved in copper ion binding. Specific function:. Has a monoamine ... MAOA preferentially oxidizes biogenic amines such as 5-hydroxytryptamine (5-HT), norepinephrine and epinephrine. Gene Name:. ... 5. Amiloride-sensitive amine oxidase [copper-containing]. General function:. Involved in copper ion binding. Specific function: ... 6. Membrane primary amine oxidase. General function:. Involved in copper ion binding. Specific function:. Cell adhesion protein ...
  http://www.hmdb.ca/metabolites/HMDB03791
*  Aldehyde dehydrogenase activity in xenografted human brain tumor in nude mice. Preliminary results in human glioma biopsies |...
Copper amine oxidases and amines as regulators of cellular processus. In: Mondovi (ed) Structure and functions of amine ... Nilsson GE, Tottmar O: Biogenic aldehydes in brain: on their preparation and reactions with rat brain tissue. J Neurochem 48: ... Mondovi B, Pierluigi R: Animal intracellular amine oxidases. In: Mondovi (ed) Structure and functions of amine oxidases. CRC ... In: Mondovi (ed), Structure and functions of amine oxidases. CRC Press, Florida, 1985, pp 89-104Google Scholar ...
  https://link.springer.com/article/10.1007/BF02427831
*  Enzymes Involved in the Biosynthesis and Degradation of Catecholamines | SpringerLink
Amine oxidase. XIV. Isolation and characterization of the multiple beef amine oxidase components, Arch. Biochem. Biophys. 132: ... In: Iversen L.L., Iversen S.D., Snyder S.H. (eds) Biochemistry of Biogenic Amines. Handbook of Psychopharmacology (Section I: ... Goldstein, M., 1966, Dopamine-/?-hydroxylase: A copper enzyme, in: Biochemistry of Copper ( J. Peisach, ed.), pp. 443-453, ... Blaschko, H., 1966, Amine oxidases, in: Molecular Basisof Some Aspects of Mental Activity, Vol. 1 ( O. Walaas, ed.), pp. 403- ...
  https://link.springer.com/chapter/10.1007/978-1-4684-3171-1_1
*  Histamine, Histamine Degradation, and Histamine Intolerance | Clinical Education
Biogenic amines: their importance in foods. Int J Food Microbiol. 1996 Apr;29(2-3):213-31. View Abstract ... Association of single nucleotide polymorphisms in the diamine oxidase gene with diamine oxidase serum activities. Allergy. 2011 ... and copper are co-factors necessary for the proper function of DAO.[12],[13],[14] ... the ingestion of histamine containing foods by someone ill equipped to adequately render the amine neutralised can result in an ...
  http://www.clinicaleducation.org/resources/reviews/histamine-histamine-degradation-and-histamine-intolerance/
*  Human Metabolome Database: Showing metabocard for Hydrogen peroxide (HMDB0003125)
Retina-specific copper amine oxidase. General function:. Involved in copper ion binding. Specific function:. Has a monoamine ... MAOA preferentially oxidizes biogenic amines such as 5-hydroxytryptamine (5-HT), norepinephrine and epinephrine. Gene Name:. ... Amiloride-sensitive amine oxidase [copper-containing]. General function:. Involved in copper ion binding. Specific function:. ... Membrane primary amine oxidase. General function:. Involved in copper ion binding. Specific function:. Cell adhesion protein ...
  http://www.hmdb.ca/metabolites/HMDB0003125
*  Vpt 311 General and Systemic Veterinary Pharamacology Tanuvas Lect Notes | Pharmacology | Cell Membrane
Non-microsomal reactions Mono Amine Oxidase (for biogenic and other amines) Esterases (for choline and dietary esters) ... Copper deficiency, if suspected is treated by administering copper containing salts such as copper sulphate or copper glycinate ... CopperCopper is utilized as a cofactor in the synthesis of haemoglobin. ... 1-2% copper sulphate is useful in sheep. Onset of reflex response takes about 510seconds and the groove may remain closed for ...
  https://www.scribd.com/doc/105615542/Vpt-311-General-and-Systemic-Veterinary-Pharamacology-Tanuvas-Lect-Notes
*  Amine oxidase [flavin-containing] B - DrugBank
Primary amine oxidase activity. Specific Function. Catalyzes the oxidative deamination of biogenic and xenobiotic amines and ... Copper. approved, investigational. yes. cofactor. Details. DB01171. Moclobemide. approved, investigational. unknown. antagonist ... Monoamine oxidase type B. Gene Name. MAOB. Organism. Human. Amino acid sequence. ,lcl,BSEQ0004309,Amine oxidase [flavin- ... lcl,BSEQ0016709,Amine oxidase [flavin-containing] B (MAOB) ATGAGCAACAAATGCGACGTGGTCGTGGTGGGGGGCGGCATCTCAGGTATGGCAGCAGCC ...
  https://www.drugbank.ca/biodb/polypeptides/P27338