S-compound oxidation, and denitrification. The pulse of acetogenesis appears to have been collectively catalyzed by a number of ... This Hydrogenophaga strain also expressed genes indicative of chemolithoautotrophy, including CO2 fixation, H2 oxidation, ... fatty acid beta-oxidation: enoyl-CoA hydratase (#1); amino acid degradation: putative amino acid ABC transporter permease (#2 ... β-oxidation: 25, Fatty acid transporters; 26, acyl-CoA dehydrogenase; 27, enoyl-CoA hydratase; 28, 3-hydroxyacyl-CoA ...

... the following chemical reaction on D-3-hydroxyacyl-CoA This enzyme catalyses a hydration step in peroxisomal beta oxidation. ... Enoyl-CoA hydratase 2 (2-enoyl-CoA hydratase 2, AtECH2, ECH2, MaoC, MFE-2, PhaJAc, D-3-hydroxyacyl-CoA hydro-lyase, D-specific ... Enoyl-CoA+hydratase+2 at the U.S. National Library of Medicine Medical Subject Headings (MeSH) Portal: Biology (EC 4.2.1). ... 2-trans-enoyl-CoA hydratase) is an enzyme (EC 4.2.1.119) with systematic name (3R)-3-hydroxyacyl-CoA hydro-lyase. This enzyme ...

Predicted to enable carboxy-lyase activity and enoyl-CoA hydratase activity. Predicted to be involved in fatty acid beta- ... involved_in fatty acid beta-oxidation IBA Inferred from Biological aspect of Ancestor. more info ... enoyl CoA hydratase domain containing 1. enoyl Coenzyme A hydratase domain containing 1. enoyl-CoA hydratase domain-containing ... CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate ...

... is supported by the immune-induction of other enzymes involved in beta-oxidation of fatty acids such as enoyl-CoA hydratase ( ... Acyl-CoA dehydrogenase. Acyl-CoA dehydrogenases catalyze the initial step of fatty acid beta-oxidation. This mitochondrial ... Carbamidomethylation was set as fixed modification, oxidation (M) as variable. We searched the general NCBI database with ...

Loss-of-function mutant lacks hydroxyacyl-CoA dehydrogenase activity and have reduced levels of long-chain enoyl-CoA hydratase ... that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA. ... ECHIA (ENOYL-COA HYDRATASE/ISOMERASE A). F:catalytic activity;P:metabolic process;C:peroxisome;BOMFPA. O.I.. C.G.. H.G.. Please ... BETA-VPE (BETA VACUOLAR PROCESSING ENZYME). Encodes a vacuolar processing enzyme belonging to a novel group of cysteine ...

Beta oxidation of octanoyl-CoA to hexanoyl-CoA (Homo sapiens) * trans-Oct-2-enoyl-CoA+H2O<=>(S)-Hydroxyoctanoyl-CoA (Homo ... enoyl-CoA hydratase activity of enoyl-CoA hydratase hexamer.. ... enoyl-CoA hydratase activity of ECHS1 hexamer [mitochondrial ... trans-Oct-2-enoyl-CoA+H2O<=>(S)-Hydroxyoctanoyl-CoA (Mus musculus) trans-Oct-2-enoyl-CoA+H2O<=>(S)-Hydroxyoctanoyl-CoA (Rattus ... trans-Oct-2-enoyl-CoA+H2O<=>(S)-Hydroxyoctanoyl-CoA (Sus scrofa) trans-Oct-2-enoyl-CoA+H2O<=>(S)-Hydroxyoctanoyl-CoA (Xenopus ...

The N-terminal region of the encoded protein contains enoyl-CoA hydratase activity while the C-terminal region contains 3- ... The protein encoded by this gene is a bifunctional enzyme and is one of the four enzymes of the peroxisomal beta-oxidation ... enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase. Synonyms. MFP, L-PBE, MFP1, L-bifunctional enzyme, ... hydroxyacyl-CoA dehydrogenase activity. Defects in this gene are a cause of peroxisomal disorders such as Zellweger syndrome. ...

... mitochondrial enoyl-CoA hydratase. Structural and evolutionary relationships linked to the bifunctional enzyme of the ... beta-oxidation system JOURNAL Eur. J. Biochem. 185, 73-78 (1989) REFERENCE 64 AUTHORS Matsubara,Y., Indo,Y., Naito,E., Ozasa,H ... Sequence homology of four enzymes of the acyl-CoA dehydrogenase family JOURNAL J. Biol. Chem. 264, 16321-16331 (1989) REFERENCE ... CoA ligase genes in parsley JOURNAL Eur. J. Biochem. 176, 661-667 (1988) REFERENCE 75 AUTHORS Jaiswal,A.K., McBride,O.W., ...

... enoyl-CoA hydratase; 3,2-trans-enoyl-CoA isomer.... Match: gi,94314029,ref,YP_587238.1,. score: 392. e-value: 3e-107. Identity: ... putative fatty acid beta-oxidation multifunctional protein [Oryza sativa Japonica Group]. Match: gi,50931183,ref,XP_475119.1,. ... ENOYL-COA HYDRATASE AND DELTA3-CIS-DELTA2-TRANS-ENOYL-COA ISOMERAS.... Match: gi,77967421,gb,ABB08801.1,. score: 419. e-value: ... gi,39936778,ref,NP_949054.1, enoyl-CoA hydratase [Rhodopseudomonas palustris] gi,39650635,emb,CAE29158.1, enoyl-CoA h.... ...

Beta oxidation of palmitoyl-CoA to myristoyl-CoA (Sus scrofa) * trans-Hexadec-2-enoyl-CoA+H2O<=>(S)-3-Hydroxyhexadecanoyl-CoA ( ... enoyl-CoA hydratase activity of Trifunctional Protein [mitochondrial matrix] Physical Entity Trifunctional Protein [ ... Mitochondrial Fatty Acid Beta-Oxidation (Sus scrofa) * mitochondrial fatty acid beta-oxidation of saturated fatty acids (Sus ... trans-Hexadec-2-enoyl-CoA+H2O,=,(S)-3-Hydroxyhexadecanoyl-CoA Stable Identifier ...

This study characterizes two enzymes of this pathway, (E)-benzylidenesuccinyl-CoA hydratase … ... which is further degraded via β-oxidation by five enzymes encoded in the conserved bbs operon. ... Keywords: beta oxidation; pseudoenzyme; short-chain dehydrogenases/reductases; structural biology; toluene metabolism. ... BbsH, a member of the enoyl-CoA hydratase family, converts (E)-benzylidenesuccinyl-CoA to 2-(α-hydroxybenzyl)succinyl-CoA and ...

... long-chain 3-hydroxyacyl-CoA dehydrogenase (LCHAD), long-chain enoyl-CoA hydratase, and long-chain thiolase activities. ... catalyzes 3 steps in mitochondrial beta-oxidation of fatty acids: ... The mitochondrial trifunctional protein, composed of 4 alpha and 4 beta subunits, ... encoding serine/threonine-protein phosphatase PP1-beta catalytic subunit. The condition is characterized by facial features ...

Delve into the intricate world of beta-oxidation, a key metabolic pathway in energy production. Learn how fatty acids are ... Hydration: Catalyzed by enoyl-CoA hydratase, this step adds water across the double bond. ... Acetyl-CoA, generated by the beta-oxidation pathway, enters the mitochondrial TCA cycle, where it is further oxidized to ... ta-oxidation produces acetyl-CoA, NADH, and FADH2. The acetyl-CoA is then used in the citric acid cycle (also known as the TCA ...

long-chain 2-enoyl-CoA hydratase. long-chain-3-hydroxyacyl-CoA dehydrogenase. mitochondrial long-chain 2-enoyl-Coenzyme A (CoA ... part_of mitochondrial fatty acid beta-oxidation multienzyme complex IBA Inferred from Biological aspect of Ancestor. more info ... hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit. hydroxyacyl- ... with the alpha subunit catalyzing the 3-hydroxyacyl-CoA dehydrogenase and enoyl-CoA hydratase activities. Mutations in this ...

... long-chain enoyl-CoA hydratase, long-chain 3-hydroxyacyl-CoA dehydrogenase, and long-chain 3-ketoacyl-CoA thiolase. In ... Long-chain hydroxyacyl-CoA dehydrogenase (LCHAD) deficiency and trifunctional protein (TFP) deficiency are caused by impairment ... individuals with LCHAD deficiency, there is isolated deficiency of long-chain 3-hydroxyacyl-CoA dehydrogenase, while deficiency ... catalyzes 3 steps in mitochondrial beta-oxidation of fatty acids: long-chain 3-hydroxyacyl-CoA dehydrogenase (LCHAD), long- ...

PLN02864; enoyl-CoA hydratase. cd03448. Location:345 → 466. HDE_HSD; HDE_HSD The R-hydratase-like hot dog fold of the 17-beta- ... The protein encoded by this gene is a bifunctional enzyme that is involved in the peroxisomal beta-oxidation pathway for fatty ... PLN02864; enoyl-CoA hydratase. cd05353. Location:5 → 254. hydroxyacyl-CoA-like_DH_SDR_c-like; (3R)-hydroxyacyl-CoA ... PLN02864; enoyl-CoA hydratase. cd05353. Location:61 → 279. hydroxyacyl-CoA-like_DH_SDR_c-like; (3R)-hydroxyacyl-CoA ...

The other 2 activities of the protein are 2-enoyl coenzyme A (CoA) hydratase (LCEH) and long-chain 3-ketoacyl CoA thiolase ( ... Schematic demonstrating mitochondrial fatty acid beta-oxidation and effects of long-chain acyl CoA dehydrogenase deficiency ( ... The other 2 activities of the protein are 2-enoyl coenzyme A (CoA) hydratase (LCEH) and long-chain 3-ketoacyl CoA thiolase ( ... Schematic demonstrating mitochondrial fatty acid beta-oxidation and effects of long-chain acyl CoA dehydrogenase deficiency ( ...

... β-oxidation proceeds by the process described above until their double bond comes into contact with enoyl-CoA hydratase. This ... It is formed when there is an excess of acetyl~CoA produced by liver beta-oxidation - the liver „pre-chews" fatty acids and ... β-oxidation is a cyclic process, one turn of which can be written as: Acyl−CoA + FAD + NAD+ + HS−CoA → acyl−CoA (2 C shorter ... 2. Enoyl-CoA-hydratase. This enzyme catalyzes the hydration of the trans double bond formed in the first step. A hydroxyl group ...

Mitochondrial Fatty Acid beta-Oxidation Trifunctional Protein Mitochondrial Long Chain Enoyl CoA Hydratase 3 Hydroxyacyl CoA ... Mitochondrial Fatty Acid beta-Oxidation Trifunctional Protein. Mitochondrial Long Chain Enoyl CoA Hydratase 3 Hydroxyacyl CoA ... It contains enoyl-CoA hydratase, long-chain-3-hydroxyacyl-CoA dehydrogenase, and acetyl-CoA C-acyltransferase activities and ... It contains enoyl-CoA hydratase, long-chain-3-hydroxyacyl-CoA dehydrogenase, and acetyl-CoA C-acyltransferase activities and ...

... β-oxidation • Ketone Bodies Lipid nomenclature • Fatty acids • triacylglycerols: know structure… ... β-oxidation. • Acyl CoA dehydrogenase. • enoyl-CoA hydratase• L-hydroxyacyl. dehydrogenase• ketoacyl-CoA thiolase• Repeat steps ... fatty acid beta-oxidation). ... Oxidation of Unsaturated Fatty acids. • New enzymes• enoyl CoA ... Lipid Metabolism • Lipid nomenclature • Oxidation of Fatty acids • β-oxidation • Ketone Bodies ...

... severe pediatric disorder of mitochondrial fatty acid beta-oxidation of short-chain hydroxyacyl CoAs. To understand the ... kinetic constants for HADH 1 and HADH 2 suggest that type 1 is the major enzyme involved in mitochondrial beta-oxidation of ... relative contributions of the two known short-chain hydroxyacyl CoA dehydrogenases (HADH) tissue biopsies of six distinct ... Short-chain hydroxyacyl CoA dehydrogenase deficiency is an ill-defined, ...

Beta oxidation. General. *Acyl CoA dehydrogenase (ACADL. *ACADM. *ACADS. *ACADVL. *ACADSB). *Enoyl-CoA hydratase ... 2-enoyl-CoA hydratase, 3-hydroxyacyl-CoA dehydrogenase and 3-oxoacyl-CoA thiolase". Biochem. Soc. Trans. 22 (2): 427-31. PMID ... Trifunctional enzyme subunit beta, mitochondrial (TP-beta) also known as 3-ketoacyl-CoA thiolase, acetyl-CoA acyltransferase, ... File:Beta-ketothiolase.png. Enzymatic activity of HADHB in beta-oxidation. This gene encodes the beta subunit of the ...

... enoyl-CoA hydratase, ECH; 3-ketoacyl-CoA thiolase, 3KCT; isovaleryl-CoA dehydrogenase, IVD; 3-hydroxyisobutyryl-CoA hydrolase, ... S4b and c). Finally, at 24 and 48 hpi, we detected the upregulation of genes related to fatty acid oxidation and the catabolism ... 11-Oxo-beta-amyrin 30-oxidase. 1.14.13.173. 6.00 e−38. 27. 43. Triterpenoid. ... such as those coding for enoyl-CoA hydratase (ECH), 3-ketoacyl-CoA thiolase (3KCT), isovaleryl-CoA dehydrogenase (IVD), 3- ...

enoyl-CoA hydratase/isomerase family protein. Position: -21. Score: 5.4. Sequence: TGTTAAACAATCGTTTGAAT ... Funciton: fatty oxidation complex, beta subunit Locus tag: Sama_2167. Name: fadJ. Funciton: fatty oxidation complex, alpha ...

... including acyl-CoA oxidase (ACX), enoyl-CoA hydratase (ECH), and 3-ketoacyl-CoA thiolase (KAT) displayed a significant up- ... genome and transcriptome sequencing reveals co-ordinate up-regulation of fatty acid beta-oxidation and triacylglycerol ... Acyl-CoA:diacylglycerol acyltransferase; EAR: Enoyl-ACP reductase; ECH: Enoyl-CoA hydratase; EFA: Epoxy fatty acid; FA: Fatty ... NADPH-dependent beta-ketoacyl-ACP reductase; KAS: Beta-ketoacyl-ACP synthase; KAT: 3-ketoacyl-CoA thiolase; KOG: Eukaryotic ...

6-carboxyhex-2-enoyl-CoA hydratase. 50%. 613.2. med. PGA1_c12020. fatty acid oxidation complex FadJ subunit alpha. fatty acid ... Probable 3-hydroxybutyryl-CoA dehydrogenase; Beta-hydroxybutyryl-CoA dehydrogenase; BHBD; EC 1.1.1.157. 58%. 333.2. ... 6-carboxyhex-2-enoyl-CoA hydratase. 43%. 543.5. hi. PGA1_c11320. 3-hydroxyacyl-CoA dehydrogenase type-2. GDP-6-deoxy-D-talose 4 ... HP15_1512 (GFF1550) is annotated as enoyl-CoA hydratase but likely has 3-hydroxyacyl-CoA dehydrogenase activity as well. ...

3 enoyl-CoA hydrase; ECHD, enoyl-CoA hydratase; ER, endoplasmic reticulum; EtOH, ethanol; FFA, medium/short chain free fatty ... beta-hydroxybutyrate dehydrogenase; B-OH, beta-hydroxybutyric acid; Cit, citrate; CoA, coenzyme A; CPT1, carnitine ... Generation of acetyl-CoA can be induced by a number of different metabolic inputs (primarily glycolysis and β-oxidation), and ... 3 enoyl-CoA hydrase; ECHD, enoyl-CoA hydratase; ER, endoplasmic reticulum; EtOH, ethanol; FFA, medium/short chain free fatty ...

Second trifunctional enzyme acting on the beta-oxidation pathway for fatty acids, possessing hydratase-dehydrogenase- epimerase ... Converts trans-2-enoyl-CoA via D-3- hydroxyacyl-CoA to 3-ketoacyl-CoA. Gene Name:. FOX2. Uniprot ID:. Q02207 Molecular weight: ... Acyl-CoA + acetyl-CoA = CoA + 3-oxoacyl-CoA. Gene Name:. POT1. Uniprot ID:. P27796 Molecular weight:. 44729.89844. Reactions. ... Coenzyme A + 3-oxopalmitoyl-CoA → Acetyl-CoA + Tetradecanoyl-CoA NADPH + hydron + 3-oxopalmitoyl-CoA ↔ NADP + (S)-3- ...