Loading...


*  3D Biology by 3DBiology - Shapeways Shops
|span style='font-size:14px'|We specialize in creating beautiful |strong|3D-printed biological models|/strong| of molecules, proteins, and vi|/span||span style='font-size:14px'|ruses with the highest scientific accuracy and quality. Don't see the model you need? Send us a personalized message requesting a specific model or change of size to an existing model!|br /| Share our site with your friends: |a href='http://www.3DBiology.org' rel='nofollow'|www.3DBiology.org|/a||/span|
  https://www.shapeways.com/shops/molecular-hub
*  DSpace@MIT: Browsing Department of Biology by Title
Genetic and physical studies of bacteriophage P22 genomes containing translocatable drug resistance elements.  ... Genetic identification of phage P22 antigens and their structural location.  Shea, Ruth Griffin (Massachusetts Institute of ... Browsing Department of Biology by Title Research and Teaching Output of the MIT Community. ...
  http://dspace.mit.edu/handle/1721.1/7761/browse?order=ASC&rpp=20&sort_by=1&etal=-1&offset=322&type=title
*  Architecture of the Complex Formed by Large and Small Terminase Subunits from Bacteriophage P22. - PubMed - NCBI
Department of Integrative Structural and Computational Biology, The Scripps Research Institute, La Jolla, CA 92037, USA.. 5. ... Architecture of the Complex Formed by Large and Small Terminase Subunits from Bacteriophage P22.. McNulty R1, Lokareddy RK2, ... Architecture of the Complex formed by Large and Small Terminase Subunits from Bacteriophage P22 ... Architecture of the Complex formed by Large and Small Terminase Subunits from Bacteriophage P22 ...
  https://www.ncbi.nlm.nih.gov/pubmed/26301600?dopt=AbstractPlus
*  DSpace@MIT: Genetic identification of phage P22 antigens and their structural location.
Keywords: Biology, Viral genetics, Antigen-antibody reactions, Immunoelectrophoresis, Bacteriophages Show full item metadata ... Genetic identification of phage P22 antigens and their structural location.. Research and Teaching Output of the MIT Community ... of Biology.; Microfiche copy available in Archives and Science.; Bibliography : leaves 272-276. ...
  http://dspace.mit.edu/handle/1721.1/64998
*  Santa Barbara Advanced School of Quantitative Biology | KITP
... and confer resistance to bacteriophage P22. Because expression of opvAB undergoes phase variation, S. enterica populations ... Santa Barbara Advanced School of Quantitative Biology. Santa Barbara Advanced School of Quantitative Biology. *2018 Course ... Between-Species Variation in Cell Biology in Insects. Above is a "t-projection" of a 26-hour whole Gryllus (cricket) embryo ... The Evolutionary Cell Biology of Gene Transfer. Instructor: Rob Phillips.. Microbial populations live in a fertile soup of ...
  https://www.kitp.ucsb.edu/qbio
*  Enterobacteria phage P22 - Wikipedia
"Information about bacteriophage P22". ASM Division M: Bacteriophage P22. American Society for Microbiology. Archived from the ... Like many phage viruses, it has been used in molecular biology to induce mutations in cultured bacteria and to introduce ... P22 shares many similarities in genetic structure and regulation with bacteriophage λ. It is a temperate double stranded DNA ... P22 research has focused on its differences from bacteriophage λ including the mechanisms by which it circularizes DNA upon ...
  https://en.wikipedia.org/wiki/Enterobacteria_phage_P22
*  William C. Earnshaw - Wikipedia
The Structure of Bacteriophage p22 and its Assembly Intermediates (PhD thesis). Massachusetts Institute of Technology. Earnshaw ... Following this, he moved to the Johns Hopkins School of Medicine, working in Tom Pollard's department of cell biology for 13 ... Earnshaw, W. C.; King, J; Eiserling, F. A. (1978). "The size of the bacteriophage T4 head in solution with comments about the ... Earnshaw, W. C.; Hendrix, R. W.; King, J (1979). "Structural studies of bacteriophage lambda heads and proheads by small angle ...
  https://en.wikipedia.org/wiki/William_C._Earnshaw
*  Nanoscience NY - Bio|Nano|Med Poster Abstracts
This project modifies the viral capsid of P22 bacteriophage to serve as a tunable nanocontainer for the packaging and ... Bio,Nano,Med. CUNY Advanced Science Research Center 85 St Nicholas Terrace, New York, NY 10031. June 23rd and 24th 2016 ... Synthesis of chlorin conjugates for Bio-medical applications N V S Dinesh K Bhupathiraju, William Perea, Chu Huong, Junior ... Combining (bio-)catalysis and molecular self-assembly provides an effective approach for developing smart biomaterials, ...
  http://nanoscienceny.com/bionanomed/posterabs.htm
*  Bacteriophage P22, Computer Model Photograph by Gabriel Lander
Bacteriophage P22, Computer Model is a photograph by Gabriel Lander which was uploaded on May 2nd, 2013. The photograph may be ... p22 virus phage bacteriophage biology microbiology molecular biology structural biology virology artwork molecular model cryo- ... Bacteriophage P22, Computer Model. Bacteriophage P22, computer model. Four views of P22 created with molecular modelling ... Bacteriophage P22, computer model. Four views of P22 created with molecular modelling software and data from cryo-electron ...
  https://fineartamerica.com/featured/1-bacteriophage-p22-computer-model-gabriel-lander.html
*  Phage (disambiguation) - Wikipedia
... filamentous bacteriophage composed of circular single stranded DNA P22 phage, virus that infects salmonella Phi-X174 phage, the ... books published on the topic of bacteriophage Phage therapy, alternative disease treatment to antibiotics In cellular biology: ... Phage is the shortened form of bacteriophage, a virus that infects bacteria. Phage (from Greek φαγεῖν phagein, 'to eat') may ... phage capable of infecting susceptible bacterial cells In molecular biology: Phage display, test to screen for protein ...
  https://en.wikipedia.org/wiki/Phage_(disambiguation)
*  Oh, the humanity of it all!: Noted Women Scientists of India - an attempt at enumeration
... and of the functions of bacteriophage P22.. Vidya Avinash Arankalle. INSA, IAS. Virology. Director-In-Charge & Scientist, ... Botany, Plant Molecular Biology. (1938-2007) Former Professor of Plant Molecular Biology at JNU; mid-60s onwards, she did ... Cell Biology. Chief Scientist at the Center for Cellular and Molecular Biology; her work has significantly elucidated the ... Plant Molecular Biology & Biotechnology. Professor of Plant molecular biology, Bose Institute, CSIR; she has worked on ...
  http://ohthehumanityofitall.blogspot.com.tr/2013/07/noted-women-scientists-of-india-attempt.html
*  The Gonen Lab: CV for Tamir Gonen, Ph.D., MRSNZ
Zheng H., Olia A.S., Gonen M., Andrews S., Cingolani G*. and Gonen T*. A conformational switch in bacteriophage P22 portal ... Nature Cell Biology 9(7): 832-837 (2007). 2006. Gonen T*. and Walz T*. The structure of aquaporins. Quarterly Reviews of ... Zheng H., Wisedchaisri G. and Gonen T*. Single particle electron cryomicroscopy of bacteriophage P22 portal protein complexes. ... Journal of Molecular Biology 367: 80-88 (2007). Hite R.K., Gonen T., Harrison S.C. and Walz T. Interactions of lipids with ...
  https://cryoem.ucla.edu/pages/TamirGonen
*  The Gonen Lab: Our Laboratory
Zheng H., Olia A.S., Gonen M., Andrews S., Cingolani G*. and Gonen T*. A conformational switch in bacteriophage P22 portal ... Nature Cell Biology 9(7): 832-837 (2007). 2006. *Gonen T*. and Walz T*. The structure of aquaporins. Quarterly Reviews of ... Zheng H., Wisedchaisri G. and Gonen T*. Single particle electron cryomicroscopy of bacteriophage P22 portal protein complexes. ... Methods in Molecular Biology. 955: 243 - 272 (2013). 2012. *Gonen S., Akiyoshi B., Iadanza MG., Shi D., Duggan N., Biggins S*. ...
  https://cryoem.ucla.edu/publications.php
*  ASMscience | Mycobacteriophages
Proceedings: bacteriophage typing of strains of Mycobacterium tuberculosis isolated in south-east England. J Med Microbiol 8:ix ... Superinfection exclusion by P22 prophage in lysogens of Salmonella typhimurium. III. Failure of superinfecting phage DNA to ... The biology of restriction and anti-restriction. Curr Opin Microbiol 8:466-472 http://dx.doi.org/10.1016/j.mib.2005.06.003. [ ... Bacteriophage active against virulent Mycobacterium tuberculosis. I. Isolation and activity. Am J Public Health Nations Health ...
  http://www.asmscience.org/content/journal/microbiolspec/10.1128/microbiolspec.GPP3-0026-2018
*  The Gonen Lab: Cover Art
Zheng H., Olia A.S., Gonen M., Andrews S., Cingolani G. and Gonen T. A conformational switch in bacteriophage P22 portal ... Nature Structural and Molecular Biology. *Co-Corresponding authors. 20 (2): 150 - 158 (2013). ...
  https://cryoem.ucla.edu/pages/Cover%20Art
*  Specificity of the Mnt protein determined by binding to random...
The relative binding affinities of Mnt protein from bacteriophage P22 are determi ... Biology Abstract. The relative binding affinities of Mnt protein from bacteriophage P22 are determined for each possible base ...
  https://www.mysciencework.com/publication/show/specificity-of-the-mnt-protein-determined-by-binding-to-randomized-operators
*  ASMscience | Bacteriophages and the B
... the nature of the bacterial chromosome are necessarily based on extrapolations from things we know about bacteriophage biology ... Bacteriophages may thus have contributed to the current compact nature of bacterial genomes. The approximately 100 currently ... only a few are known to be fully functional bacteriophages. There are two rather complex types of genetic entity in which this ... published bacterial genome complete nucleotide sequences, and about 285 prophages are related to known bacteriophages. Of the ...
  http://www.asmscience.org/content/book/10.1128/9781555817640.chap3
*  Welcome to Wen Jiang Group
Coat protein fold and maturation transition of bacteriophage p22 seen at subnanometer resolutions. Nat. Struct. Biol. 10:131- ... Cryo-EM asymmetric reconstruction of bacteriophage P22 reveals organization of its DNA packaging and infecting machinery. ... Visualization of Bacteriophage T3 Capsids with DNA Incompletely Packaged In Vivo. J. Mol. Biol. 384(5):1384-99. PubMed. pdf ... Common ancestry of herpesviruses and tailed DNA bacteriophages. J. Virol. 79(23):14967-70. PubMed pdf ...
  http://jiang.bio.purdue.edu/publications-old.php
*  Sensors | Free Full-Text | Recent Advances in Bacteriophage Based Biosensors for Food-Borne Pathogen Detection | HTML
Bacteriophages are one such unique biological entity that show excellent host selectivity and have been actively used as ... This review summarizes the extensive literature search on the application of bacteriophages (and recently their receptor ... For example, Singh et al. immobilized genetically engineered tailspike proteins (TSP) from P22 bacteriophage onto the gold- ... Bio-probes are often argued as the most vital component of any biosensor since they define the recognition specificity for the ...
  http://www.mdpi.com/1424-8220/13/2/1763/htm
*  Viruses | Free Full-Text | Development of an Assay for the Identification of Receptor Binding Proteins from Bacteriophages
When phage P22 was screened using this assay, Gp9 was the only RBP discovered, confirming previous predictions that this is the ... This general approach has the potential to assist in the identification of RBPs from other bacteriophages. ... a large number of new technologies have been developed that exploit the unique properties of bacteriophage receptor binding ... This article belongs to the Special Issue 21st Evergreen International Phage Biology Meeting - Emerging Research) ...
  http://www.mdpi.com/1999-4915/8/1/17
*  The T7 Group | SpringerLink
In this chapter I shall not try to review in detail the genetics and molecular biology of phage T7, since this topic has been ... Poteete, A. R., 1988, Bacteriophage P22, in: The Bacteriophages, Vol. 2 ( R. Calendar, ed.), pp. 647-682, Plenum Press, New ... Reanney, D. C., and Ackermann, H. W., 1982, Comparative biology and evolution of bacteriophages, Adv. Virus Res. 27: 205.PubMed ... Modrich, P., and Richardson, C. C., 1975, Bacteriophage T7 deoxyribonucleic acid replication in vitro. Bacteriophage T7 DNA ...
  https://link.springer.com/chapter/10.1007/978-1-4684-5424-6_8
*  Cro repressor family - Wikipedia
In molecular biology, the Cro repressor family of proteins includes the bacteriophage lambda Cro repressor. Bacteriophage ... Most Cro proteins, such as Enterobacteria phage P22 Cro and Bacteriophage 434 Cro, have an all-alpha structure that is thought ... Ohlendorf DH, Tronrud DE, Matthews BW (July 1998). "Refined structure of Cro repressor protein from bacteriophage lambda ...
  https://en.wikipedia.org/wiki/Cro_repressor_family
*  US6451527B1 - Methods using genetic package display for selecting internalizing ligands for gene delivery - Google...
48 5′Bio. AAAGGATCCGGGTTCCCGCGTGGGCGATGGTTGTTGTCATTGTCGGC (SEQ ID NO: 5). M3rev2. 25 bio. CCGTAACACTGAGTTTCGTCACCAG (SEQ ID NO ... In some embodiments, the bacteriophage carries a genome vector. In other embodiments, the bacteriophage carries a hybrid vector ... and P22 tailspike protein (Carbonell and Villaverde, Gene 176:225, 1996). Techniques for inserting foreign coding sequence into ... In preferred embodiments, the ligand displaying genetic package comprises a bacteriophage. The bacteriophage are filamentous ...
  https://patents.google.com/patent/US6451527B1/en
*  Ambivalent bacteriophages of different species active on Escherichia coli K12 and Salmonella sp. strains, Russian Journal of...
"Ambivalent bacteriophages of different species active on Escherichia coli K12 and Salmonella sp. strains, Russian Journal of ... General Transducing Phages Like Salmonella Phage P22 Isolated Using a Smooth Strain of Escherichia coli As Host ... Comparative Molecular Biology of Lambdoid Phages. Campbell, A.. * Comparative Sequences Analysis of the DNA Packaging, Head, ... Genomic Sequences of Bacteriophages HK97 and HK022: Pervasive Genetic Mosaicism in the Lambdoid Bacteriophages ...
  https://www.deepdyve.com/lp/springer_journal/ambivalent-bacteriophages-of-different-species-active-on-escherichia-DBbzQl28SV
*  Transduction | Encyclopedia.com
See also Bacterial ultrastructure; Bacteriophage and bacteriophage typing; Molecular biology and molecular genetics; Viral ... The Lambda virus begins its life cycle in much the same way as P22. A tail fiber on the end of the virus specifically binds to ... A Dictionary of Biology © A Dictionary of Biology 2004, originally published by Oxford University Press 2004. ... Invitation to Biology, 5th ed. New York: WorthPublishers, 1994.. Ingraham, John, and Catherine Ingraham. Introduction to ...
  https://www.encyclopedia.com/science-and-technology/biology-and-genetics/genetics-and-genetic-engineering/transduction