Loading...


*  Molecules | Free Full-Text | Beneficial Effects of Monascus sp. KCCM 10093 Pigments and Derivatives: A Mini Review | HTML
The amino acid is strongly related to CETP inhibition. The amino acid phenyl structure is essential to inhibition. During ... Since the HCV NS5B RNA-dependent RNA polymerase (RdRp) enzyme is considered a key enzyme of HCV replication, the inhibition or ... gram-negative bacteria, and filamentous fungi. However, these pigment derivatives (which were cultivated with amino acids) ... Barter, P.J.; Brewer, H.B.; Chapman, M.J.; Hennekens, C.H.; Rader, D.J.; Tall, A.R. Cholesteryl ester transfer protein: A novel ...
  http://www.mdpi.com/1420-3049/23/1/98/htm
*  IJMS | Free Full-Text | Structural Analysis of Hypothetical Proteins from Helicobacter pylori: An Approach to Estimate...
In this regard, knowledge on the 3D structure of a protein, especially unknown or hypothetical protein, is frequently useful to ... elucidate the structure-function relationship of the uncharacterized gene product. That is, a structural comparison with known ... of genes to be biologically or biochemically characterized to understand the whole picture of gene functions in the bacteria. ... The S4 domain is a small domain consisting of 60-65 amino acid residues that probably mediates binding to RNA [100]. The ...
  http://www.mdpi.com/1422-0067/13/6/7109/htm
*  Biochemistry essay topics, buy custom Biochemistry essay paper sample cheap, service
This is because this enzyme is capable of retaining the CPI domain by actively increasing the presence of amino acids ... This CPI domain is normally present in the isoleucyl, the leucyl - t RNA, and in the valyl - tRNA synthetases. This CPI domain ... The results of the IleuRS reveals that the CPI domain is further linked to the tRNA - dependant activity of the pre-transfer ... This eventually led to the enhancement of the fidelity between the cognate, and the non - cognate CPI domains of the bacteria ...
  https://exclusivepapers.com/essays/medicine/biochemistry.php
*  JoVE | Peer Reviewed Scientific Video Journal - Methods and Protocols
Amino acids are abundant in protein and thus can be obtained from biomass hydrolysis. Amino acids can be derivatized by N-(tert ... Bacteria, Soil extracellular enzyme activities (EEAs), fluorometric enzyme assays, substrate degradation, 4-methylumbelliferone ... RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also ... Laboratory Estimation of Net Trophic Transfer Efficiencies of PCB Congeners to Lake Trout (Salvelinus namaycush) from Its Prey ...
  https://www.jove.com/visualize/abstract/21311756/isotopic-investigation-contemporary-historic-changes-penguin-trophic
*  US Patent # 4,871,670. Molecular cloning and characterization of a gene sequence coding for human relaxin - Patents.com
... including genes and transfer vectors for expression of human prorelaxin and the individual A, B and C pepti ... Genes and DNA transfer vectors for the expression of human preprorelaxin; sub-units thereof, ... messenger RNA ______________________________________ The coding relationships between nucleotide sequence in DNA and amino acid ... Asn Ser U Ile Thr Asn Ser C A Ile Thr Lys Arg A Met Thr Lys Arg G Val Ala Asp Gly U Val Ala Asp Gly C G Val Ala Glu Gly A Val ...
  http://patents.com/us-4871670.html
*  Biology-Online • View topic - 20 Amino Acids
... containing mostly hydrophobic amino acids. Formyl-L-Val-Gly-L-Ala-D-Leu-L-Ala-D-Val-L-Val-D-Val-L-Trp- -D-Leu-L-Trp-D-Leu-L-Trp ... You should only know the names and the structure of each amino acid. To memorize the values of pka of each amino acid is ... The OH of Tyr can also be phosphorylated--regulation of enzyme activity Sulfur containing amino acids (Met, Cys) Met is (almost ... His is the least basic, pKa= ~6-7; catalysis involving proton transfer Acidic Amino Acids and Their Amides (Asp, Glu, Asn, Gln ...
  http://www.biology-online.org/biology-forum/about4313.html?p=32063&hilit=Dipeptide
*  Application # 2004/0137586. Biological systems for manufacture of polyhydroxyalkanoate polymers containing 4-hydroxyacids ...
The gene encoding a 4-hydroxybutyryl-Co A transferase has been isolated from bacteria and integrated into the genome of ... bacteria also expressing a polyhydroxyalkanoate synthase, to yield an improved p ... 0051] Bacteria such as Escherichia coli are capable of catabolizing at least four different amino acids (arginine, proline, ... 15 Ala Val Ser Lys Ile Glu Asn His Ser Arg Val Val Phe Ala His Ala 20 25 30 Val Gly Glu Pro Val Asp Leu Val Asn Ala Leu Val Lys ...
  http://patents.com/us-20040137586.html
*  Amino acid synthesis - Wikipedia
"A Novel Two-domain Architecture Within the Amino Acid Kinase Enzyme Family Revealed by the Crystal Structure of Escherichia ... Cysteine is a very important molecule for a bacterium's survival. This amino acid harbors a sulfur atom and can actively ... which binds glutamine and uses it as the amino group donor so that the amine group can transfer to the chorismate. Anthranilate ... This operon has a distinct block of the leader sequence, called block 1: Met-Thr-Arg-Val-Gln-Phe-Lys-His-His-His-His-His-His- ...
  https://en.wikipedia.org/wiki/Amino_acid_synthesis
*  Frontiers | New Insights into the Regulation of Cell-Surface Signaling Activity Acquired from a Mutagenesis Screen of the...
In contrast, Prc is only required for mutant variants with a periplasmic domain longer than 50 amino acids, which indicates ... of the exact mechanism behind CSS activation will enable the development of strategies to block CSS in pathogenic bacteria. ... 50 amino acids creating the RseP substrate. Moreover, we have identified several conserved residues in the CSS anti-sigma ... is a signal transfer system that allows Gram-negative bacteria to detect environmental signals and generate a cytosolic ...
  https://www.frontiersin.org/articles/10.3389/fmicb.2017.00747/full
*  Browse by Academic Unit (A-Z) - White Rose Research Online
2 more authors) (2012) Identification of a putative glycosyltransferase responsible for the transfer of pseudaminic acid onto ... 7 more authors) (2017) Oxidative Stickland reactions in an obligate aerobic organism - amino acid catabolism in the ... Val Martin, M. orcid.org/0000-0001-9715-0504, Heald, C. L., Lamarque, J. F. et al. (3 more authors) (2015) How emissions, ... Bánsági, T. and Taylor, A.F. orcid.org/0000-0003-0071-8306 (2018) Switches induced by quorum sensing in a model of enzyme- ...
  http://eprints.whiterose.ac.uk/view/iau/Sheffield=2ECPE.html
*  Transfer RNA methyltransferases with a SpoU-TrmD (SPOUT) fold and their modified nucleosides in tRNA
A structure-based site-directed mutagenesis study of T. thermophilus TrmH [62] revealed that the conserved basic amino acid ... Transfer RNA from H. influenzae, a respiratory infectious bacterium, induces dimer formation by Toll like receptor-7 (TLR7), ... A primordial RNA modification enzyme: the case of tRNA (m1A) methyltransferase. Nucleic Acids Res. 2004;32:465-476. doi: ... the half-life of tRNAVal is shortened and the strain shows a growth defect [146]. Therefore, tRNA modifications stabilize tRNA ...
  http://pubmedcentralcanada.ca/pmcc/articles/PMC5372735/
*  Biology 156, Unit 13 Self-Test Flashcards - Cram.com
A. a supply of amino acids B. enzymes for attaching amino acids to tRNA C. rRNA D. energy ... Met-Val-Ala-His Which of the following is the enzyme that links together the nucleotides in an RNA molecule? ... In the process of protein synthesis, a transfer RNA pairs with the mRNA codon. What is the nucleotide sequence of the tRNA ... If this composite phage were allowed to infect a bacterium, the phages produced in the host cell would have ______. ...
  http://www.cram.com/flashcards/biology-156-unit-13-self-test-282700
*  Patent US5639853 - Respiratory syncytial virus vaccines - Google Patents
... the amino acid sequence Gln-Gln-Ser-Tyr-Ser-Ile-Met-Ser-Ile-Ile-Lys-Glu-Glu-Val-Leu-Ala-Tyr-Val-Val-Gln-Leu-Pro-Leu-Tyr-Gly-Val ... Enzyme Immunoassay (EIA). Antibody titer in serum samples was determined using an Enzyme Immunoassay (EIA) performed as follows ... Normally, the recombinant transfer vector is amplified in appropriate host cells. Second, the recombinant transfer vector ... allow for initiation of transcription by vaccinia RNA polymerase, but not by cellular RNA polymerase. ...
  http://www.google.co.uk/patents/US5639853
*  JoVE | Peer Reviewed Scientific Video Journal - Methods and Protocols
If desired, mutagenesis can then be used to elucidate the specific amino acids or domains required for adhesion. This assay ... RNA synthesis, RNA processing, RNA decay, 4-thiouridine, 4sU-tagging, microarray analysis, RNA-seq, RNA, DNA, PCR, sequencing ... 6 Our recent work has shown that Ehmeth methylates tRNAAsp, and this finding indicates that this enzyme has a dual DNA/tRNAAsp ... A useful alternative for high-throughput applications is the injection of bacteria into the yolk of embryos within the first ...
  https://www.jove.com/visualize/abstract/20949015/the-dictyostelium-discoideum-acaa-gene-is-transcribed-from
*  Index of genetics articles - Wikipedia
Alternative splicing Altruism Alu family Alzheimer's disease Amber codon Ames test Amino acid Amino acid sequence Amino acids ... Quaternary structure R factor R plasmid Radiation hybrid RAM mutation Random genetic drift Random mating Rare-cutter enzyme ... Trans-acting Transcription Transcription factor Transcriptome Transducing particle Transduction Transfection Transfer RNA ... Molecular biology Uptake signal sequence Uracil Uridine V-J joining Val Variable region Variance Variate Genetic diversity ...
  https://en.wikipedia.org/wiki/Index_of_genetics_articles
*  Patent US6815188 - Human kinases and polynucleotides encoding the same - Google Patentsuche
... amino acids include arginine, lysine, and histidine; and negatively charged (acidic) amino acids include aspartic acid and ... Acids Res. 15:6131-6148), or a chimeric RNA-DNA analogue (Inoue et al., 1987, FEBS Lett. 215:327-330). Alternatively, double ... 4,873,191); retrovirus mediated gene transfer into germ lines (Van der Putten et al., 1985, Proc. Natl. Acad. Sci. USA 82:6148- ... Greenspan et al, 1993, "Idiotypes: structure and immunogenicity", FASEB Journal 7:437-444. ...
  http://www.google.de/patents/US6815188?hl=de&output=html_text
*  SMART: Secondary literature for CVNH domain
... distant amino acid sequence identity yet close structural similarity to the cohesin modules of cellulolytic anaerobic bacteria ... Cyanovirin prevents the transfer of viral RNA into human cells. In this study, we found that, among all residues that show ... The solution structure of apo-CopK revealed an all-beta fold formed of two beta-sheets in perpendicular orientation with an ... Substitution of Thr(293) and Gln(296) in site I to corresponding residues (Val(294) and Asp(297)) of maize BGAF1 resulted in ...
  http://smart.embl-heidelberg.de/smart/show_secondary.cgi?domain=CVNH
*  From Gene to Protein How Genes Work - ppt video online download
40 Transfer RNA structure. "Clover leaf" structure anticodon on "clover leaf" end amino acid attached on 3 end ... enzyme 1 enzyme 2 enzyme 3 enzyme 4 8 from DNA nucleic acid language to RNA nucleic acid language. Transcription from DNA ... 3 5 DNA TACGCACATTTACGTACGCGG 5 3 mRNA AUGCGUGUAAAUGCAUGCGCC codon 3 5 UAC Met GCA Arg tRNA CAU Val anti-codon amino acid ... Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being ...
  http://slideplayer.com/slide/273626/
*  Patent US4394443 - Method for cloning genes - Google Patents
... and is complementary to a longer region of the target mRNA coding for a longer portion of the known amino acid sequence. ... primer having a nucleotide sequence complementary to a region of the target mRNA coding for a portion of the known amino acid ... at least a short amino acid sequence of which is known, by effecting cDNA synthesis on a mixture of mRNAs containing the mRNA ... A further amino acid sequence is now known for the HLA-B7 antigen, and has the sequence -gly-ala-val-val-ala-ala-val-met up to ...
  http://www.google.com/patents/US4394443?dq=6,460,050
*  Patente US6359115 - Human receptor tyrosine kinase, KDR - Google Patentes
An isolated nucleic acid molecule encoding a novel human receptor type tyrosine kinase gene, KDR, is disclosed. The isolation ... 1356 amino acids. amino acid. single. linear. 2 Met Glu Ser Lys Val Leu Leu Ala Val Ala Leu Trp Leu Cys Val Glu 1 5 10 15 Thr ... The isolated nucleic acid molecule of the present invention may also include a ribonucleic acid molecule (RNA). ... considered to be variants even if the structure of one of the molecules is not found in the other or even if the two amino acid ...
  http://www.google.es/patents/US6359115?dq=flatulence
*  WO2003025137A2 - Sweet taste receptors - Google Patents
Similarly, 'conservative amino acid substitutions,' in one or a few amino acids in an amino acid sequence are substituted with ... wherein the hTlR2 nucleic acid is a cDNA or an RNA.. 18. The hTlR2 nucleic acid of claim 15, wherein the hTlR2 nucleic acid ... Vectors include, e.g., plasmids, cosmids, viruses, YACs, bacteria, poly-lysine, etc. A 'vector nucleic acid' is a nucleic acid ... In the case of an enzyme immunoassay, an enzyme is conjugated to the second antibody, usually by means of glutaraldehyde or ...
  https://patents.google.com/patent/WO2003025137A2/en
*  Patent WO2011044186A1 - Human single-chain t cell receptors - Google Patents
... having the structure: Vα2-L-Vβ or Vβ-L-Vα2, wherein L is a linker peptide that links Vβ with Vα, Vβ is a TCR variable β region ... A coding sequence is the part of a gene or cDNA which codes for the amino acid sequence of a protein, or for a functional RNA ... spectroscopic or enzyme-based methods 21 . The TCR of claim 19, wherein the detectable group is a fluorescent group, a ... A stable single-chain TCR of Va-L-Vp or νβ-L-Va form that has been linked to signaling domains that yields an active TCR on the ...
  http://www.google.com.au/patents/WO2011044186A1?cl=en
*  Patente US5486599 - Construction and use of synthetic constructs encoding syndecan - Google Patentes
... where Xac represents an amino acid residue having an acidic sidechain, and Z represents from 1 to 10 amino acid residues. ... and comprising a hydrophilic amino terminal extracellular region, a hydrophilic carboxy terminal cytoplasmic region, a ... The primer should be present in 50 to 500-fold molar excess over the RNA template and the enzyme should be present in similar ... Val, Ile, Leu, Ser, Thr or an amino acid gap; Xaa(4) is Gly, Ala, Val, Ile, Leu, Ser, Thr or an amino acid gap; and Xaa(5) is ...
  http://www.google.es/patents/US5486599?dq=flatulence
*  Application # 2016/0376573. FAGOPYRITOL SYNTHASE GENES AND USES THEREOF - Patents.com
Such a synthesis is carried out using known amino acid sequences for a fagopyritol synthase enzyme being produced. ... Val Val Ala Val Leu Pro Asp Val Pro Pro Glu His Arg Arg Ile Leu 20 25 30 Val Glu Gln Gly Cys Val Val Arg Glu Ile Glu Pro Val ... the deletion or addition of amino acids that have minimal influence on the properties, secondary structure, and hydropathic ... Bacteria from 500 mL of LB-Amp were lysed using 5 mL of BugBuster.TM. solution. Nucleic acids and non-soluble cellular matter ...
  http://patents.com/us-20160376573.html
*  Nuclear Magnetic Resonance (Nmr) | SpringerLink
Pseudo-structures for the 20 common amino acids for use in studies of protein conformations by measurements of intramolecular ... Theory of self-organization of protein secondary structure: Dependence of the native globule structure on the secondary ... Electron transfer as the first step in electrophilic aromatic substitution, J. Chem. Soc., Chem. Commun. 1972:1058.CrossRef ... The binding of sodium to halotolerant bacteria, Biochim. Biophys. Acta. 538:268.PubMedCrossRefGoogle Scholar ...
  https://link.springer.com/chapter/10.1007/978-1-4684-4997-6_2