Loading...
*  Alpha-1D adrenergic receptor - Wikipedia
The alpha-1D adrenergic receptor (α1D adrenoreceptor), also known as ADRA1D, is an alpha-1 adrenergic receptor, and also ... This gene encodes alpha-1D-adrenergic receptor. Similar to alpha-1B-adrenergic receptor gene, this gene comprises 2 exons and a ... 1994). "Cloning, expression and characterization of human alpha adrenergic receptors alpha 1a, alpha 1b and alpha 1c". Biochem ... Receptor[edit]. There are 3 alpha-1 adrenergic receptor subtypes: alpha-1A, -1B and -1D, all of which signal through the Gq/11 ...
  https://en.wikipedia.org/wiki/Alpha-1D_adrenergic_receptor
*  Alpha-2B adrenergic receptor - Wikipedia
"Expansion of the alpha 2-adrenergic receptor family: cloning and characterization of a human alpha 2-adrenergic receptor ... The alpha-2B adrenergic receptor (α2B adrenoceptor), is a G-protein coupled receptor. It is a subtype of the adrenergic ... Klein U, Ramirez MT, Kobilka BK, von Zastrow M (Aug 1997). "A novel interaction between adrenergic receptors and the alpha- ... McClue SJ, Milligan G (Sep 1990). "The alpha 2B adrenergic receptor of undifferentiated neuroblastoma x glioma hybrid NG108-15 ...
  https://en.wikipedia.org/wiki/Alpha-2B_adrenergic_receptor
*  Myocardial alpha 1-adrenergic receptor stimulation. | Circulation
Myocardial alpha 1-adrenergic receptor stimulation.. R Curiel, J F Pérez-González ...
  http://circ.ahajournals.org/content/85/5/1958
*  alpha-1 adrenergic receptor Protein Superfamily Detail
Term: alpha-1 adrenergic receptor. ID: PIRSF038550 Mouse Protein Superfamily Annotations. Select one or more mouse PIRSF ...
  http://www.informatics.jax.org/vocab/pirsf/PIRSF038550
*  Alpha-2B adrenergic receptor - DrugBank
Alpha-2BAR. Gene Name. ADRA2B. Organism. Human. Amino acid sequence. ,lcl,BSEQ0010396,Alpha-2B adrenergic receptor ... Alpha-2 adrenergic receptors mediate the catecholamine-induced inhibition of adenylate cyclase through the action of G proteins ... lcl,BSEQ0010397,Alpha-2B adrenergic receptor (ADRA2B) ATGGACCACCAGGACCCCTACTCCGTGCAGGCCACAGCGGCCATAGCGGCGGCCATCACC ... blood coagulation / activation of MAPK activity by adrenergic receptor signaling pathway / activation of protein kinase B ...
  https://www.drugbank.ca/biodb/polypeptides/P18089
*  alpha 1 Adrenergic Receptor peptide (ab41797) | Abcam
Buy our alpha 1 Adrenergic Receptor peptide. Ab41797 is a blocking peptide for ab3462 and has been validated in Neut, BL. Abcam ... alpha 1 Adrenergic Receptor peptide. See all alpha 1 Adrenergic Receptor proteins and peptides. ... This alpha-adrenergic receptor mediates its effect through the influx of extracellular calcium. ... Belongs to the G-protein coupled receptor 1 family. Adrenergic receptor subfamily. ADRA1D sub-subfamily. ...
  http://www.abcam.com/alpha-1-adrenergic-receptor-peptide-ab41797.html
*  Insulin Downregulates Alpha-2 Adrenergic Receptors in Cultured Glial Cells | SpringerLink
Richards E.M., Raizada M.K., Sumners C. (1987) Insulin Downregulates Alpha-2 Adrenergic Receptors in Cultured Glial Cells. In: ... Using [3H]-yohimbine as a ligand for α2-adrenergic receptors, we have demonstrated that insulin is able to decrease [3H]- ... These results suggest that insulin, by modulating α2adrenergic receptor levels, is able to regulate the amount of NE present in ... Neuronal and glial cells in culture contain a2-adrenergic receptors, in preparation.Google Scholar ...
  https://link.springer.com/chapter/10.1007/978-1-4684-5380-5_17
*  Anti-alpha 1b Adrenergic Receptor antibody (ab15851) | Abcam
Chicken polyclonal alpha 1b Adrenergic Receptor antibody validated for WB and tested in Human. Referenced in 1 publication. ... Anti-alpha 1b Adrenergic Receptor antibody. See all alpha 1b Adrenergic Receptor primary antibodies. ... This alpha-adrenergic receptor mediates its action by association with G proteins that activate a phosphatidylinositol-calcium ... Ten commercial antibodies for alpha-1-adrenergic receptor subtypes are nonspecific.. Naunyn Schmiedebergs Arch Pharmacol 379: ...
  https://www.abcam.com/alpha-1b-adrenergic-receptor-antibody-ab15851.html
*  Recombinant human alpha 2a Adrenergic Receptor protein (ab54291)
Buy our Recombinant human alpha 2a Adrenergic Receptor protein. Ab54291 is an active full length protein produced in ... Recombinant human alpha 2a Adrenergic Receptor protein. See all alpha 2a Adrenergic Receptor proteins and peptides. ... Alpha-2 adrenergic receptors mediate the catecholamine-induced inhibition of adenylate cyclase through the action of G proteins ... This product is an aliquot of membranes from Sf9 cells transfected with the human recombinant alpha 2a Adrenergic Receptor. The ...
  http://www.abcam.com/recombinant-human-alpha-2a-adrenergic-receptor-protein-ab54291.html
*  Produktübersicht alpha 1 Adrenergic Receptor ELISA
alpha 1 Adrenergic Receptor ELISA Kits vergleichen und bestellen. ... alpha 1 Adrenergic Receptor ELISA Kits für viele Reaktivitäten ... alpha-1C adrenergic receptor , adrenergic alpha 1c receptor , adrenergic receptor alpha 1c subtype , adrenergic receptor, alpha ... adrenergic, alpha-1A-, receptor variant 5 , adrenergic, alpha-1A-, receptor variant 8 , alpha-1A adrenergic receptor , alpha-1A ... alpha 1C-adrenergic receptor , alpha 1a-adrenoceptor , alpha-1A-adrenergic receptor , adrenergic receptor alpha-1A ...
  http://www.antikoerper-online.de/ampk-signaling-pathway-15/alpha-1-adrenergic-receptor-elisa-kit-19728/
*  alpha 1b Adrenergic Receptor Proteins
Order alpha 1b Adrenergic Receptor Proteins from many different species. Find the right product on antibodies-online.com. ... alpha-1B-adrenergic receptor , Adrenergic alpha 1B- receptor , adrenergic receptor, alpha 1b , alpha 1B-adrenoceptor , alpha 1B ... alpha-1B adrenoceptor , adrenergic, alpha-1B-, receptor , alpha-1B adrenergic receptor-like , alpha-1B adrenergic receptor , ... alpha 1b Adrenergic Receptor (ADRA1B) Protein Überblick Protein Überblick Alpha-1-adrenergic receptors (alpha-1-ARs) are ...
  https://www.antikoerper-online.de/ampk-signaling-pathway-15/alpha-1b-adrenergic-receptor-protein-43992/
*  3H]rauwolscine (alpha-yohimbine): a specific antagonist radioligand for brain alpha 2-adrenergic receptors. - PubMed - NCBI
3H]rauwolscine (alpha-yohimbine): a specific antagonist radioligand for brain alpha 2-adrenergic receptors.. Perry BD, ... 3H]Rauwolscine, a specific and potent alpha 2-antagonist radioligand, was used to characterize alpha 2-receptor binding in ... These results suggest that [3H]rauwolscine specifically labels both the high and low affinity states of the alpha 2-receptor in ... rauwolscine labeled the alpha 2-receptor. Agonists inhibited [3H]rauwolscine binding in a shallow, GTP-sensitive manner. ...
  https://www.ncbi.nlm.nih.gov/pubmed/6276200
*  anti-alpha 2c Adrenergic Receptor antibody | GeneTex
... adrenergic, alpha-2C-, receptor) for IHC-P. Anti-alpha 2c Adrenergic Receptor pAb (GTX71833) is tested in Human samples. 100% ... adrenergic, alpha-2C-, receptor. Background. The Alpha 2c- Adrenergic Receptor controls the release of neurotransmitter from ... alpha 2c Adrenergic Receptor antibody See all alpha 2c Adrenergic Receptor products ... Storage Conditions: alpha 2c Adrenergic Receptor antibody. Storage Buffer. Phosphate buffered saline, pH 7.4 containing 0.01% ...
  http://www.genetex.com/alpha-2c-Adrenoceptor-antibody-GTX71833.html
*  Selective modification of renal alpha 2-adrenergic receptors in Milan hypertensive rat strain. | Hypertension
In the cerebral cortex, no between-strain differences in alpha 1-adrenergic and alpha 2-adrenergic receptor density and ... Cerebral and renal alpha-adrenergic receptors play an important role in the control of blood pressure. We studied alpha- ... Binding of the selective alpha 1-adrenergic antagonist [3H]prazosin and the alpha 2-adrenergic antagonist [3H]rauwolscine was ... Selective modification of renal alpha 2-adrenergic receptors in Milan hypertensive rat strain.. A Parini, L Diop, P Ferrari, G ...
  http://hyper.ahajournals.org/content/10/5/505
*  beta-Adrenergic regulation of alpha 2-adrenergic receptors in the central nervous system | Science
beta-Adrenergic regulation of alpha 2-adrenergic receptors in the central nervous system ... beta-Adrenergic regulation of alpha 2-adrenergic receptors in the central nervous system ... beta-Adrenergic regulation of alpha 2-adrenergic receptors in the central nervous system ... beta-Adrenergic regulation of alpha 2-adrenergic receptors in the central nervous system ...
  http://science.sciencemag.org/content/207/4431/645
*  Changes in brain alpha-adrenergic receptors after alpha-methyldopa administration to spontaneously hypertensive rats. |...
The down regulation of alpha 2-adrenergic receptors and the up regulation of alpha 1-adrenergic receptors are compatible with ... larger up regulation of alpha 1-adrenergic receptors, and greater down regulation of alpha 2-adrenergic receptors than did the ... Changes in brain alpha-adrenergic receptors after alpha-methyldopa administration to spontaneously hypertensive rats.. C R ... Changes in brain alpha-adrenergic receptors after alpha-methyldopa administration to spontaneously hypertensive rats. ...
  http://hyper.ahajournals.org/content/6/5_Pt_2/II34
*  Alpha-2B adrenergic receptor | definition of alpha-2B adrenergic receptor by Medical dictionary
... alpha-2B adrenergic receptor explanation free. What is alpha-2B adrenergic receptor? Meaning of alpha-2B adrenergic receptor ... Looking for online definition of alpha-2B adrenergic receptor in the Medical Dictionary? ... redirected from alpha-2B adrenergic receptor) ADRA2B. A gene on chromosome 2p13-q13 that encodes alpha-2B-adrenergic receptor, ... Alpha-2B adrenergic receptor , definition of alpha-2B adrenergic receptor by Medical dictionary https://medical-dictionary. ...
  http://medical-dictionary.thefreedictionary.com/alpha-2B+adrenergic+receptor
*  p-[125I]iodoclonidine is a partial agonist at the alpha 2-adrenergic receptor.
0/Adrenergic alpha-Agonists; 0/Iodine Radioisotopes; 0/Receptors, Adrenergic, alpha; 108294-53-7/4-iodoclonidine; 146-48-5/ ... 125I]PIC bound to the same number of high affinity sites as the alpha 2-adrenergic receptor (alpha 2-AR) full agonist [3H] ... Adrenergic alpha-Agonists / pharmacokinetics*. Blood Platelets / metabolism*. Cell Membrane / metabolism. Chromatography, Thin ... 6147954 - Adrenergic nerves and the alpha 2-adrenoceptor system regulating melanosome aggregation.... 14557414 - Prevention of ...
  http://www.biomedsearch.com/nih/p-125Iiodoclonidine-partial-agonist-at/1974694.html
*  Alpha adrenergic receptor | definition of Alpha adrenergic receptor by Medical dictionary
What is Alpha adrenergic receptor? Meaning of Alpha adrenergic receptor medical term. What does Alpha adrenergic receptor mean? ... Looking for online definition of Alpha adrenergic receptor in the Medical Dictionary? Alpha adrenergic receptor explanation ... adrenergic receptor. (redirected from Alpha adrenergic receptor) adrenergic receptor. Etymology: L, ad + ren, kidney; Gk, ergon ... Adrenergic receptor. There are three families of adrenergic receptors, alpha1, alpha2 and beta, and each family contains three ...
  http://medical-dictionary.thefreedictionary.com/Alpha+adrenergic+receptor
*  Alpha-1 adrenergic receptor - Wikipedia
The alpha-1 (α1) adrenergic receptor is a G protein-coupled receptor (GPCR) associated with the Gq heterotrimeric G-protein. It ... Note that only active muscle α1-adrenergic receptors will be blocked. Resting muscle will not have its α1-adrenergic receptors ... Adrenergic receptor Graham, Robert (May 1, 1996). "α1-Adrenergic Receptor Subtypes Molecular Structure, Function, and Signaling ... In contrast to α2-adrenergic receptors, α1-adrenergic-receptors in the arterial vasculature of skeletal muscle are more ...
  https://en.wikipedia.org/wiki/Alpha-1_adrenergic_receptor
*  Alpha-2 adrenergic receptor - Wikipedia
The alpha-2 (α2) adrenergic receptor (or adrenoceptor) is a G protein-coupled receptor (GPCR) associated with the Gi ... signal through the α2-adrenergic receptor in the central and peripheral nervous systems. The α2A adrenergic receptor is ... where it sits alongside the more plentiful α1-adrenergic receptor. The α2-adrenergic receptor binds both norepinephrine ... "Inhibition of the lipolytic action of beta-adrenergic agonists in human adipocytes by alpha-adrenergic agonists". J. Lipid Res ...
  https://en.wikipedia.org/wiki/Alpha-2_adrenergic_receptor
*  Alpha-2A adrenergic receptor - Wikipedia
The alpha-2A adrenergic receptor (α2A adrenoceptor), also known as ADRA2A, is an α2 adrenergic receptor, and also denotes the ... the sites for beta-adrenergic receptor kinase-mediated phosphorylation and desensitization of the alpha 2A-adrenergic receptor ... ADRA2A adrenergic, alpha-2A-, receptor". "α2A-adrenoceptor". IUPHAR Database of Receptors and Ion Channels. International Union ... Handy DE, Gavras H (Nov 1992). "Promoter region of the human alpha 2A adrenergic receptor gene". The Journal of Biological ...
  https://en.wikipedia.org/wiki/Alpha-2A_adrenergic_receptor
*  Alpha-1B adrenergic receptor - Wikipedia
The alpha-1B adrenergic receptor (α1B adrenoreceptor), also known as ADRA1B, is an alpha-1 adrenergic receptor, and also ... 1994). "Cloning, expression and characterization of human alpha adrenergic receptors alpha 1a, alpha 1b and alpha 1c". Biochem ... There are 3 alpha-1 adrenergic receptor subtypes: alpha-1A, -1B and -1D, all of which signal through the Gq/11 family of G- ... 2003). "The adaptor complex 2 directly interacts with the alpha 1b-adrenergic receptor and plays a role in receptor endocytosis ...
  https://en.wikipedia.org/wiki/Alpha-1B_adrenergic_receptor
*  Alpha-2C adrenergic receptor - Wikipedia
The alpha-2C adrenergic receptor (α2C adrenoceptor), also known as ADRA2C, is an alpha-2 adrenergic receptor, and also denotes ... "Human alpha 2-adrenergic receptor subtype distribution: widespread and subtype-selective expression of alpha 2C10, alpha 2C4, ... Alpha-2-adrenergic receptors include 3 highly homologous subtypes: alpha2A, alpha2B, and alpha2C. These receptors have a ... Klein U, Ramirez MT, Kobilka BK, von Zastrow M (1997). "A novel interaction between adrenergic receptors and the alpha-subunit ...
  https://en.wikipedia.org/wiki/Alpha-2C_adrenergic_receptor
*  Alpha-1A adrenergic receptor - Wikipedia
1994). "Cloning, expression and characterization of human alpha adrenergic receptors alpha 1a, alpha 1b and alpha 1c". Biochem ... formerly known also as the alpha-1C adrenergic receptor, is an alpha-1 adrenergic receptor, and also denotes the human gene ... a potent alpha 1-adrenergic receptor agonist, selective for the alpha 1A receptor subtype". J. Pharmacol. Exp. Ther. 274 (1): ... There are 3 alpha-1 adrenergic receptor subtypes: alpha-1A, -1B and -1D, all of which signal through the Gq/11 family of G- ...
  https://en.wikipedia.org/wiki/Alpha-1A_adrenergic_receptor