Loading...


*  platelet-derived growth factor C - PDGF-C Summary Report | CureHunter
07/01/2008 - "Intraventricular injection of tPA or active PDGF-CC, in the absence of ischemia, leads to significant increases ...
  http://www.curehunter.com/public/keywordSummaryC411423-platelet-derived-growth-factor-C-PDGF-C.do
*  Matrix Metalloproteinase Inhibition Alters Functional and Structural Correlates of Deafferentation-Induced Sprouting in the...
Intraventricular FN-439 injection. FN-439 (MMP inhibitor 1; Calbiochem, La Jolla, CA) is a synthetic peptide hydroxamate with ... This study evaluated the effects of MMP inhibition at 7 d postlesion to observe treatment effects during the process of active ... the significant suppression of this capacity by a single intraventricular FN-439 injection demonstrates that this survival ... Intracerebral ventricular injection of drug or saline vehicle was achieved by a modification of the method of Buki et al. (1999 ...
  http://www.jneurosci.org/content/23/32/10182?ijkey=82538be133b20d6f0a7c917eac7fc186aee84f41&keytype2=tf_ipsecsha
*  Edge Therapeutics Loses Edge on Failure of Late-Stage Study
Patients in the active comparator arm received a single dose of intraventricular normal saline and up to 21 days of oral ... Patients enrolled in the experimental arm received a single 600 mg intraventricular injection of EG-1962 plus placebo capsules ...
  https://finance.yahoo.com/news/edge-therapeutics-loses-edge-failure-142502001.html
*  Open field locomotor effects in rats after intraventricular injections of ethanol and the ethanol metabolites acetaldehyde and...
... and suggest that acetaldehyde may be an active metabolite of ethanol that also can facilitate locomotor activity. Moreover, it ... Nevertheless, recent studies indicate that intraventricular (ICV) injections of ethanol can produce signs of behavioral ... which suggests that ethanol may have active metabolites with central actions. The present study was undertaken to investigate ... Open field locomotor effects in rats after intraventricular injections of ethanol and the ethanol metabolites acetaldehyde and ...
  https://www.semanticscholar.org/paper/Open-field-locomotor-effects-in-rats-after-of-and-Correa-Arizzi/1019b537a751a086f30b3da091652ee791157474
*  beta]-Endorphin suppression of acute morphine abstinence in morphine dependent monkeys: Effective given intraventricularly but...
... were implanted with a chronic indwelling needle in the lateral ventricle of the brain for sterile intraventricular injections. ... On a molar basis, [beta]-endorphin was more active than morphine in suppressing the signs of morphine abstinence. When given ...
  https://deepblue.lib.umich.edu/handle/2027.42/25633
*  Nestin-positive mesenchymal stem cells favour the astroglial lineage in neural progenitors and stem cells by releasing active...
... this cytokine is present in a biologically-active form only in nestin-positive mesenchymal stem cells conditioned medium and 2 ... Recently, it has been demonstrated that following ischemia in the adult striatum, intra-ventricular EGF injections are able to ... Release of an active form of BMP4 by nestin-positive MSCs. (A)RT-PCR and quantitative RT-PCR were performed on npMSCs and ... We then demonstrated that BMP4 is present in a biologically-active form in the npMSCs but not in nnMSCs conditioned medium and ...
  https://bmcneurosci.biomedcentral.com/articles/10.1186/1471-2202-5-33
*  Patente US8093043 - β-TrCP1, β-TrCP2 and RSK1 or RSK2 inhibitors and methods for sensitizing ... - Google Patentes
In another embodiment, the active ingredient can be delivered in a vesicle, in particular a liposome (see Langer, Science, 1990 ... For example, various host animals can be immunized by injection with the antigenic polypeptide, including but not limited to ... intraventricular, and intracranial administration. Optionally, the β-TrCP1, β-TrCP2, RSK1, or RSK2 inhibitor can be formulated ... The concentration or amount of the active ingredient depends on the desired dosage and administration regimen, as discussed ...
  http://www.google.es/patents/US8093043?hl=es&dq=flatulence
*  ACTIVE SCAFFOLDS FOR ON-DEMAND DRUG AND CELL DELIVERY - Patent application
"Injection" includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, ... Patent application title: ACTIVE SCAFFOLDS FOR ON-DEMAND DRUG AND CELL DELIVERY. Inventors: David J. Mooney (Sudbury, MA, US) ... In some embodiments, the compositions are administered by intravenous infusion or injection. [0069] For administration to a ... 0068] Exemplary modes of administration include, but are not limited to, injection, infusion, instillation, inhalation, or ...
  http://www.patentsencyclopedia.com/app/20130017229
*  WO2009091982A1 - Mir-122 agonist - Google Patents
... and intra-tissue injection (e.g., intraocular injection, intra-retinal injection, or sub-retinal injection); subcutaneous ... The implants may be permeable or impermeable to the active agent, and may be inserted into a chamber of the eye, such as the ... or intrathecal or intraventricular administration. ... Injection of the agent can be directly into the tissue at or ... Injections of 5-15 μL were done for each sample.. The unconjugated samples were purified by HPLC on a TSK-GeI SuperQ- 5PW (20) ...
  https://patents.google.com/patent/WO2009091982A1/en
*  WO1995011894A1 - Histamine h3-receptor antagonists and therapeutic uses thereof - Google Patents
... including but not limited to intraventricular, intramuscular, intraperitoneal, intra-arteriolar, and subcutaneous injection, ... With thioperamide alone (i.e., in the absence of the α-methylhistamine H3 receptor agonist) , animals were very active, ... 2 , thioperamide at doses of 2, 5, and 10 mg/kg, when measured 15 min after injection, decreased the binding of [3H]-Nα- ... Figure 3 shows that compound 1 also penetrates the blood-brain barrier one hour after injections of doses of 50 and 70 mg/kg. ...
  https://patents.google.com/patent/WO1995011894A1/en
*  Imidazole Derivatives Useful for Controlling Microbial Growth - Patent application
Routes of parenteral administration include intrathecal injection, intraventricular injection and intracranial injection. [0105 ... ACTIVE COMPOUNDS [0071] Active compounds are provided below. In some of the embodiments provided, active compounds are ... COVALENT COUPLING OF ACTIVE COMPOUNDS [0156] In some embodiments, active compounds as described herein are covalently coupled ... 0074] Active compounds include compounds of compounds of Formula (I): ##STR00011## wherein: [0075] R1 is an amino or ...
  http://www.patentsencyclopedia.com/app/20130177621
*  Application # 2012/0035268. SPHINGO-GUANIDINES AND THEIR USE AS INHIBITORS OF SPHINGOSINE KINASE - Patents.com
... including intraventricular and intrathecal injection; intraventricular injection can be facilitated by an intraventricular ... Alternatively, the active ingredient can be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free ... Where the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that ... injection or continuous infusion. Formulations for injection can be presented in unit dosage form, e.g., in ampoules or in ...
  http://patents.com/us-20120035268.html
*  US Patent # 9,393,305. Etanercept formulations stabilized with xylitol - Patents.com
... intraventricular, intracranial, intratracheal, intrathecal administration, intramuscular injection, intravitreal injection, and ... Another active agent may be administered either as a part of the provided compositions, or alternatively, as a separate ... such as by intravenous injection; or by injection or application to the relevant site, such as by direct injection, or direct ... Parenteral administration can be by bolus injection or continuous infusion. Pharmaceutical compositions for injection may be ...
  http://patents.com/us-9393305.html
*  TISSEEL READY FOR USE SOLUTIONS FOR SEALANT | Drugs.com
for Injections.. Component 2 = Thrombin Solution:. The active substances contained in 1 ml of the Thrombin Solution are:. Human ... intraventricular administration carries the additional risk of a thromboembolic complication. Both complications may. be life- ... Water for Injections. Component 2: Thrombin Solution. Human Albumin. Sodium Chloride. Water for Injections. 6.2 ... Soft tissue injection of TISSEEL Ready to use carries the risk. of an anaphylactoid reaction and / or local tissue damage.. In ...
  https://www.drugs.com/uk/tisseel-ready-for-use-solutions-for-sealant-leaflet.html
*  Patent US6025193 - Methods and compositions for diagnosis and treatment of pathological ... - Google Patents
Mice were administered intraventricular injections of various doses of the D1 antisense every 12 hr for three injections. ... The use of such media for pharmaceutically active substances is known in the art. Except insofar as any conventional media or ... Mice were administered intraventricular injections of vehicle (2 μl of artificial CSF), or D1 antisense (2.5 nmol/2 μl) at 12 ... Mice were administered intraventricular injections of vehicle (2 μl of artificial CSF), D1 antisense (2.5 nmol/2 μl) or random ...
  http://www.google.com/patents/US6025193?dq=7143430
*  Linking neuronal lineage and wiring specificity | Springer for Research & Development
Sister excitatory neurons in ontogenetic radial clones labeled by in utero intraventricular injection of eGFP-expressing ... Self-organized formation of polarized cortical tissues from ESCs and its active manipulation by extrinsic signals. Cell Stem ... in which early viral injections resulted in labeling of neurons of all layers and later viral injections resulted in labeling ... a transcription factor active in proliferating GCPs, and this signaling is disrupted in mouse models of medulloblastoma [174]. ...
  https://rd.springer.com/article/10.1186/s13064-018-0102-0
*  METHODS AND COMPOSITIONS FOR RNA-GUIDED TREATMENT OF HIV INFECTION - TEMPLE UNIVERSITY OF THE COMMONWEALTH SYSTEM OF HIGHER...
... or a biologically active variant thereof) but may include additional residues as well. Biologically active variants will retain ... Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal or intramuscular injection or ... infusion; or intracranial, e.g., intrathecal or intraventricular administration. Parenteral administration can be in the form ... beta-globin gene control region which is active in myeloid cells, myelin basic protein gene control region which is active in ...
  http://www.freepatentsonline.com/y2016/0250300.html
*  Patent US8097435 - Polynucleotides encoding long-acting growth hormone polypeptides and methods ... - Google Patents
... subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intravenous, intraperitoneal, ... In one embodiment, "active ingredient" refers to the polypeptide sequence of interest, which is accountable for the biological ... The injection volume did not exceed 10 ml/kg. The length of the experiment was 22 days. A morbidity and mortality check was ... The injection volume did not exceed 10 ml/kg. The length of the experiment was 14 days. A morbidity and mortality check was ...
  http://www.google.com/patents/US8097435?dq=6,243,373
*  Application # 2011/0230544. MODULATION OF C-REACTIVE PROTEIN EXPRESSION - Patents.com
Injections were administered twice weekly for a period of 2 weeks. At the end of the treatment period, mice were sacrificed. No ... TARGET REV SITE SEQ ID TARGET COMP OF SEQ ID NO SITE SEQUENCE SEQ ID ACTIVE IN ID NO 44586 11 16 cccgaagctctgacacctgc 19 H. ... 0143] Compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous ... Injections were administered twice weekly for a period of 4 weeks. At the end of the treatment period, mice were sacrificed. ...
  http://patents.com/us-20110230544.html
*  RTA 744 Injection in Patients With Leptomeningeal Disease - Full Text View - ClinicalTrials.gov
Concurrent intrathecal or intraventricular therapy for leptomeningeal disease or other malignancy.. *Concurrent oral or ... Active or uncontrolled infection. 3) Acute or chronic liver disease (i.e., hepatitis, cirrhosis). 4) Confirmed diagnosis of HIV ... RTA 744 Injection in Patients With Leptomeningeal Disease. This study has been terminated. ... To determine the tolerability of RTA 744 Injection in patients with leptomeningeal disease (LMD) secondary to any type of ...
  https://clinicaltrials.gov/ct2/show/NCT00512460
*  Patent US20130136779 - Method of producing nano- and microcapsules of spider silk protein - Google Patents
... intramedular injections as well as intrathecal, direct intraventricular, intravenous, intraperitoneal or intranasal injections. ... Thus, the active components of the present invention are preferably used in such a pharmaceutical composition in doses mixed ... In cosmetics the transport of water active ingredients into the skin could be facilitated by the presented bags/balloons, after ... Such a composition can (in addition to the active component and the carrier) include filling material, salts, buffer, ...
  http://www.google.ca/patents/US20130136779
*  Patent US7524827 - Methods and compositions for the inhibition of gene expression - Google Patents
A kariotype of MCF10CA1a shows an extra copy of chromosome 1. It metastasizes into the lung 36 days after IV injection of the ... Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or ... Compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous ... Thus, for example, the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example ...
  http://www.google.com/patents/US7524827?dq=6,548,982
*  US9072766B2 - Methods of treating obesity by inhibiting nicotinamide N-methyl transferase (NNMT) - Google Patents
Active Application number. US13885284. Other versions. US20130243790A1 (en ) Inventor. Barbara B. Kahn. Qin Yang. Daniel Kraus ... Delivery can also be by injection into the brain or body cavity of a patient or by use of a timed release or sustained release ... Parenteral administration can include, for example, intraarticular, intramuscular, intravenous, intraventricular, intraarterial ... or a biologically-active variant or fragment thereof. As used herein, a "biologically-active" NNMT protein, variant or fragment ...
  https://patents.google.com/patent/US9072766B2/en
*  CELL-FREE PREPARATION OF CARBAPENEMS - GreenLight Biosciences, Inc.
The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a ... Jet injection devices which deliver liquid vaccines to the dermis via a liquid jet injector and/or via a needle which pierces ... intraventricular, transdermal, interdermal, rectal, intravaginal, intraperitoneal, topical (as by powders, ointments, creams, ... although the concentration of the active ingredient can be as high as the solubility limit of the active ingredient in the ...
  http://www.freepatentsonline.com/y2017/0096692.html
*  US Patent # 9,708,339. 1,3-benzothiazinone, sulfoxide, and sulfone compounds with electrophilic substituent - Patents.com
Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Suitable ... direct intraventricular, intravenous, intraperitoneal, intranasal, or intraocular injections, and optionally in a depot or ... The compounds may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. ... Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added ...
  http://patents.com/us-9708339.html