*  platelet-derived growth factor C - PDGF-C Summary Report | CureHunter
07/01/2008 - "Intraventricular injection of tPA or active PDGF-CC, in the absence of ischemia, leads to significant increases ...
  http://www.curehunter.com/public/keywordSummaryC411423-platelet-derived-growth-factor-C-PDGF-C.do
*  beta]-Endorphin suppression of acute morphine abstinence in morphine dependent monkeys: Effective given intraventricularly but...
... were implanted with a chronic indwelling needle in the lateral ventricle of the brain for sterile intraventricular injections. ... On a molar basis, [beta]-endorphin was more active than morphine in suppressing the signs of morphine abstinence. When given ...
  https://deepblue.lib.umich.edu/handle/2027.42/25633
*  Patente US8093043 - β-TrCP1, β-TrCP2 and RSK1 or RSK2 inhibitors and methods for sensitizing ... - Google Patentes
In another embodiment, the active ingredient can be delivered in a vesicle, in particular a liposome (see Langer, Science, 1990 ... For example, various host animals can be immunized by injection with the antigenic polypeptide, including but not limited to ... intraventricular, and intracranial administration. Optionally, the β-TrCP1, β-TrCP2, RSK1, or RSK2 inhibitor can be formulated ... The concentration or amount of the active ingredient depends on the desired dosage and administration regimen, as discussed ...
  http://www.google.es/patents/US8093043?hl=es&dq=flatulence
*  ACTIVE SCAFFOLDS FOR ON-DEMAND DRUG AND CELL DELIVERY - Patent application
"Injection" includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, ... Patent application title: ACTIVE SCAFFOLDS FOR ON-DEMAND DRUG AND CELL DELIVERY. Inventors: David J. Mooney (Sudbury, MA, US) ... In some embodiments, the compositions are administered by intravenous infusion or injection. [0069] For administration to a ... 0068] Exemplary modes of administration include, but are not limited to, injection, infusion, instillation, inhalation, or ...
  http://www.patentsencyclopedia.com/app/20130017229
*  WO2009091982A1 - Mir-122 agonist - Google Patents
... and intra-tissue injection (e.g., intraocular injection, intra-retinal injection, or sub-retinal injection); subcutaneous ... The implants may be permeable or impermeable to the active agent, and may be inserted into a chamber of the eye, such as the ... or intrathecal or intraventricular administration. ... Injection of the agent can be directly into the tissue at or ... Injections of 5-15 μL were done for each sample.. The unconjugated samples were purified by HPLC on a TSK-GeI SuperQ- 5PW (20) ...
  https://patents.google.com/patent/WO2009091982A1/en
*  Imidazole Derivatives Useful for Controlling Microbial Growth - Patent application
Routes of parenteral administration include intrathecal injection, intraventricular injection and intracranial injection. [0105 ... ACTIVE COMPOUNDS [0071] Active compounds are provided below. In some of the embodiments provided, active compounds are ... COVALENT COUPLING OF ACTIVE COMPOUNDS [0156] In some embodiments, active compounds as described herein are covalently coupled ... 0074] Active compounds include compounds of compounds of Formula (I): ##STR00011## wherein: [0075] R1 is an amino or ...
  http://www.patentsencyclopedia.com/app/20130177621
*  Application # 2012/0035268. SPHINGO-GUANIDINES AND THEIR USE AS INHIBITORS OF SPHINGOSINE KINASE - Patents.com
... including intraventricular and intrathecal injection; intraventricular injection can be facilitated by an intraventricular ... Alternatively, the active ingredient can be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free ... Where the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that ... injection or continuous infusion. Formulations for injection can be presented in unit dosage form, e.g., in ampoules or in ...
  http://patents.com/us-20120035268.html
*  US Patent # 9,393,305. Etanercept formulations stabilized with xylitol - Patents.com
... intraventricular, intracranial, intratracheal, intrathecal administration, intramuscular injection, intravitreal injection, and ... Another active agent may be administered either as a part of the provided compositions, or alternatively, as a separate ... such as by intravenous injection; or by injection or application to the relevant site, such as by direct injection, or direct ... Parenteral administration can be by bolus injection or continuous infusion. Pharmaceutical compositions for injection may be ...
  http://patents.com/us-9393305.html
*  TISSEEL READY FOR USE SOLUTIONS FOR SEALANT | Drugs.com
for Injections.. Component 2 = Thrombin Solution:. The active substances contained in 1 ml of the Thrombin Solution are:. Human ... intraventricular administration carries the additional risk of a thromboembolic complication. Both complications may. be life- ... Water for Injections. Component 2: Thrombin Solution. Human Albumin. Sodium Chloride. Water for Injections. 6.2 ... Soft tissue injection of TISSEEL Ready to use carries the risk. of an anaphylactoid reaction and / or local tissue damage.. In ...
  https://www.drugs.com/uk/tisseel-ready-for-use-solutions-for-sealant-leaflet.html
*  Patent US6025193 - Methods and compositions for diagnosis and treatment of pathological ... - Google Patents
Mice were administered intraventricular injections of various doses of the D1 antisense every 12 hr for three injections. ... The use of such media for pharmaceutically active substances is known in the art. Except insofar as any conventional media or ... Mice were administered intraventricular injections of vehicle (2 μl of artificial CSF), or D1 antisense (2.5 nmol/2 μl) at 12 ... Mice were administered intraventricular injections of vehicle (2 μl of artificial CSF), D1 antisense (2.5 nmol/2 μl) or random ...
  http://www.google.com/patents/US6025193?dq=7143430
*  Linking neuronal lineage and wiring specificity | Springer for Research & Development
Sister excitatory neurons in ontogenetic radial clones labeled by in utero intraventricular injection of eGFP-expressing ... Self-organized formation of polarized cortical tissues from ESCs and its active manipulation by extrinsic signals. Cell Stem ... in which early viral injections resulted in labeling of neurons of all layers and later viral injections resulted in labeling ... a transcription factor active in proliferating GCPs, and this signaling is disrupted in mouse models of medulloblastoma [174]. ...
  https://rd.springer.com/article/10.1186/s13064-018-0102-0
*  METHODS AND COMPOSITIONS FOR RNA-GUIDED TREATMENT OF HIV INFECTION - TEMPLE UNIVERSITY OF THE COMMONWEALTH SYSTEM OF HIGHER...
... or a biologically active variant thereof) but may include additional residues as well. Biologically active variants will retain ... Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal or intramuscular injection or ... infusion; or intracranial, e.g., intrathecal or intraventricular administration. Parenteral administration can be in the form ... beta-globin gene control region which is active in myeloid cells, myelin basic protein gene control region which is active in ...
  http://www.freepatentsonline.com/y2016/0250300.html
*  Patent US8097435 - Polynucleotides encoding long-acting growth hormone polypeptides and methods ... - Google Patents
... subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intravenous, intraperitoneal, ... In one embodiment, "active ingredient" refers to the polypeptide sequence of interest, which is accountable for the biological ... The injection volume did not exceed 10 ml/kg. The length of the experiment was 22 days. A morbidity and mortality check was ... The injection volume did not exceed 10 ml/kg. The length of the experiment was 14 days. A morbidity and mortality check was ...
  http://www.google.com/patents/US8097435?dq=6,243,373
*  Application # 2011/0230544. MODULATION OF C-REACTIVE PROTEIN EXPRESSION - Patents.com
Injections were administered twice weekly for a period of 2 weeks. At the end of the treatment period, mice were sacrificed. No ... TARGET REV SITE SEQ ID TARGET COMP OF SEQ ID NO SITE SEQUENCE SEQ ID ACTIVE IN ID NO 44586 11 16 cccgaagctctgacacctgc 19 H. ... 0143] Compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous ... Injections were administered twice weekly for a period of 4 weeks. At the end of the treatment period, mice were sacrificed. ...
  http://patents.com/us-20110230544.html
*  RTA 744 Injection in Patients With Leptomeningeal Disease - Full Text View - ClinicalTrials.gov
Concurrent intrathecal or intraventricular therapy for leptomeningeal disease or other malignancy.. *Concurrent oral or ... Active or uncontrolled infection. 3) Acute or chronic liver disease (i.e., hepatitis, cirrhosis). 4) Confirmed diagnosis of HIV ... RTA 744 Injection in Patients With Leptomeningeal Disease. This study has been terminated. ... To determine the tolerability of RTA 744 Injection in patients with leptomeningeal disease (LMD) secondary to any type of ...
  https://clinicaltrials.gov/ct2/show/NCT00512460
*  Patent US20130136779 - Method of producing nano- and microcapsules of spider silk protein - Google Patents
... intramedular injections as well as intrathecal, direct intraventricular, intravenous, intraperitoneal or intranasal injections. ... Thus, the active components of the present invention are preferably used in such a pharmaceutical composition in doses mixed ... In cosmetics the transport of water active ingredients into the skin could be facilitated by the presented bags/balloons, after ... Such a composition can (in addition to the active component and the carrier) include filling material, salts, buffer, ...
  http://www.google.ca/patents/US20130136779
*  Patent US7524827 - Methods and compositions for the inhibition of gene expression - Google Patents
A kariotype of MCF10CA1a shows an extra copy of chromosome 1. It metastasizes into the lung 36 days after IV injection of the ... Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or ... Compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous ... Thus, for example, the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example ...
  http://www.google.com/patents/US7524827?dq=6,548,982
*  US9072766B2 - Methods of treating obesity by inhibiting nicotinamide N-methyl transferase (NNMT) - Google Patents
Active Application number. US13885284. Other versions. US20130243790A1 (en ) Inventor. Barbara B. Kahn. Qin Yang. Daniel Kraus ... Delivery can also be by injection into the brain or body cavity of a patient or by use of a timed release or sustained release ... Parenteral administration can include, for example, intraarticular, intramuscular, intravenous, intraventricular, intraarterial ... or a biologically-active variant or fragment thereof. As used herein, a "biologically-active" NNMT protein, variant or fragment ...
  https://patents.google.com/patent/US9072766B2/en
*  CELL-FREE PREPARATION OF CARBAPENEMS - GreenLight Biosciences, Inc.
The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a ... Jet injection devices which deliver liquid vaccines to the dermis via a liquid jet injector and/or via a needle which pierces ... intraventricular, transdermal, interdermal, rectal, intravaginal, intraperitoneal, topical (as by powders, ointments, creams, ... although the concentration of the active ingredient can be as high as the solubility limit of the active ingredient in the ...
  http://www.freepatentsonline.com/y2017/0096692.html
*  US Patent # 9,708,339. 1,3-benzothiazinone, sulfoxide, and sulfone compounds with electrophilic substituent - Patents.com
Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Suitable ... direct intraventricular, intravenous, intraperitoneal, intranasal, or intraocular injections, and optionally in a depot or ... The compounds may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. ... Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added ...
  http://patents.com/us-9708339.html
*  RTA 744 Injection in Patients With Leptomeningeal Disease
1. The primary objectives of this study are: 1. To determine the tolerability of RTA 744 Injection in patients with ... for glucose levels above 250 mg/dL). 2) Active or uncontrolled infection. 3) Acute or. chronic liver disease (i.e., hepatitis, ... 1. Concurrent intrathecal or intraventricular therapy for leptomeningeal disease or. other malignancy.. 2. Concurrent oral or ... RTA 744 Injection). 7. Total urinary protein in 24 hours urine collection > 500 mg. 8. Any of the following concurrent severe ...
  http://www.knowcancer.com/cancer-trials/NCT00512460/
*  Compositions and methods for the diagnosis and treatment of sepsis - The Regents of the University of Michigan
Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Suitable ... intraventricular, intravenous, intraperitoneal, or intranasal administration. ... In some embodiments, mice are immunized with a primary injection of C5aR peptides, followed by a number of boosting injections ... Data are expressed as percent of blood values obtained immediately after i.v. injection of 125I-C5aRa. Mean±SE of 5 animals at ...
  http://www.freepatentsonline.com/7455837.html
*  METHOD FOR TREATING DEFICIENCY IN HEMATOPOIESIS - Patent application
... including intraventricular and intrathecal injection; intraventricular injection may be facilitated by an intraventricular ... Active LT-HSCs not only rescue lethally irradiated mice but also can completely repopulate the hematopoietic system. IL-12- ... TABLE-US-00003 TABLE 3 Radioprotective effects of IL-12 is injection-time dependent Injection time Injection time before IR ( ... 36 hours injection time for tested 5 animals in each group) or little (20% survival rate at -12 and +24 hours injection time ...
  http://www.patentsencyclopedia.com/app/20100278777
*  METHOD OF REGULATING PROLIFERATION AND DIFFERENTIATION OF KERATINOCYES - Patent application
0194] The active agent can be administered into the dermal layer of the skin of the subject by an intradermal injection as ... and intramedullary injections as well as intrathecal, direct intraventricular, intracardiac, e.g., into the right or left ... 0221] For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, ... Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. ...
  http://www.patentsencyclopedia.com/app/20110207665
*  Patent US6814933 - Multiwell scanner and scanning method - Google Patents
Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Suitable ... intramedullary injections, as well as intrathecal, direct intraventricular, intravenous, intraperitoneal, intranasal, or ... Multiplexed active biologic array. US5981268. May 30, 1997. Nov 9, 1999. Board Of Trustees, Leland Stanford, Jr. University. ... For injection, the agents of the invention may be formulated in aqueous solutions, preferably in physiologically compatible ...
  http://www.google.com/patents/US6814933?dq=6,631,400