Loading...
*  Caracterização genotípica e fenotípica do clone de HIV-1 recombinante intersubtipo D/B com reversão com reversão fenotípica...
As regioes genicas de gag, pol e env, os genes nef e tat e a LTR foram sequenciadas. A analise do sequenciamento revelou duas ...
  http://h-vml029.epm.br/handle/11600/17325
*  Vírus da imunodeficiência humana - Wikipedia
O genoma de ARN consiste em pelo menos sete marcos estruturais (LTR, TAR, RRE, PE, SLIP, CRS e INS) e nove genes ('gag, pol, ... Três destes genes, gag, pol e env, contêm a informação necessária para produzir as proteínas estruturais de novas partículas ... Os restantes seis genes, 'tat, rev, nef, vif, vpr, e vpu (ou vpx no caso do VIH-2), são genes reguladores para proteínas que ... As poliproteínas Gag (p55) e Gag-Pol (p160) também interagem com a superfície interior da membrana plasmática, em conjunto com ...
  https://pt.wikipedia.org/wiki/V%C3%ADrus_da_imunodefici%C3%AAncia_humana
*  Estrutura e genoma do VIH - Wikipedia
O HIV tem muitos genes que codificam proteínas estruturais. Genes retrovírus gerais gag. proteínas derivadas do gag sintetizam ... Além disso, a pol codifica uma protease viral específica (PR). Essa enzima cliva o gag e as proteínas derivadas de gag e pol em ... Genes específicos do HIV tat. Um porção da estrutura do RNA do HIV é uma estrutura como um grampo de cabelo que inicialmente ...
  https://pt.wikipedia.org/wiki/Estrutura_e_genoma_do_VIH
*  UNIVERSIDADE FEDERAL DO PARÁ INSTITUTO DE CIÊNCIAS BIOLÓGICAS PROGRAMA DE PÓS-GRADUAÇÃO EM BIOLOGIA DE AGENTES INFECCIOSOS E...
A estrutura genômica proviral contém os genes estruturais gag, pol e env (próprios dos retrovírus), os genes reguladores tax e ... Essas proteínas, que derivam dos genes gag (group-specific antigen), pol (polimerase) e env (envelope), são componentes ... situada sobreposta aos genes gag e pol. O gene pol codifica a transcriptase reversa, e a integrase, e o gene env codifica duas ... há genes adicionais que se sobrepõem com os genes principais (Coffin, 1996). ...
  http://docplayer.com.br/8212066-Universidade-federal-do-para-instituto-de-ciencias-biologicas-programa-de-pos-graduacao-em-biologia-de-agentes-infecciosos-e-parasitarios.html
*  HIV/AIDS: Relato sobre a epidemia, terapias anti-retrovirais disponíveis e fatores relacionados à aq - Brasil Escola
Os produtos dos genes gag e pol são traduzidos inicialmente em grandes poliproteínas precursoras, que devem ser clivadas pela ... Os genes podem ser divididos em dois grupos: os que codificam as proteínas estruturais (gag, pol e env) e os que codificam ... impedindo o processamento dos precursores virais das poliproteínas Gag e Gag-Pol e resultando na formação de virions imaturos ... A expressão subseqüente dos genes virais resulta na transcrição do RNA a partir do DNA do HIV e na tradução das proteínas ...
  http://monografias.brasilescola.uol.com.br/imprimir/14157
*  Biologia Evolutiva: July 2006
Analysis of a rape case by direct sequencing of the human immunodeficiency virus type 1 pol and gag genes. J Virol 68: 5918-24 ... à variação nos genes e nas características.. A adaptação não é definida meramente de acordo com o que sobrevive, a despeito do ... a frequência gênica de um organismo com novos genes envolvidos na quebra de ingredientes de pesticidas não aumentasse.Mas tudo ... é válido até para aquelas características definidas por vários genes e nenhum dos alelos envolvidos possui um efeito forte o ...
  http://biologiaevolutiva.blogspot.com/2006/07/
*  UNIVERSIDADE FEDERAL DE MINAS GERAIS INSTITUTO DE CIÊNCIAS BIOLÓGICAS DEPARTAMENTO DE MICROBIOLOGIA - PDF
UNIVERSIDADE FEDERAL DE MINAS GERAIS INSTITUTO DE CIÊNCIAS BIOLÓGICAS DEPARTAMENTO DE MICROBIOLOGIA Modulação de genes e ... Houve alteração da expressão dos genes virais gag/pol, tax/rex (que codificam para proteínas estruturais, polimerase viral e ... A regulação da expressão da via NFκB por PCR array foi avaliada para um conjunto de 84 genes, pós-tratamento com 17β-estradiol ... Neste contexto, o objetivo deste trabalho foi avaliar a regulação pelo 17 β estradiol de genes e proteínas virais, e da via NF ...
  http://docplayer.com.br/4872861-Universidade-federal-de-minas-gerais-instituto-de-ciencias-biologicas-departamento-de-microbiologia.html
*  Design e Síntese de Possíveis Inibidores da Proteína Auxiliar Nef do Vírus HIV-1. Carlos Eduardo de Melo Salvador. Dissertação...
Cada filamento é constituído por três genes estruturais (gag, pol e env), dois regulatórios (tat e ver), quatro genes ... TRANSCRICAO E PROCESSAMENTO DE RNA Número de genes para RNA RNA ribossômico - rrna Os rrnas correspondem a 85 % do RNA total da ... MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA Os biólogos supunham que apenas as proteínas regulassem os genes dos seres ... www.tioronni.com ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande ...
  http://docplayer.com.br/2553662-Design-e-sintese-de-possiveis-inibidores-da-proteina-auxiliar-nef-do-virus-hiv-1-carlos-eduardo-de-melo-salvador-dissertacao-de-mestrado.html
*  Selecção e caracterização de anticorpos de domínio único específicos para a proteína gp41 de VIH-1 - PDF
De um modo geral, as proteínas essenciais à infecção e replicação de VIH derivam de três genes principais sendo eles gag (group ... 60 Amplificação, por PCR, dos genes correspondentes às famílias de sdab VL A obtenção dos genes que codificam para as ... REPLICAÇÃO DE DNA MAPA DO CROMOSSOMA DE E.coli TERMINOLOGIA Regras básicas para a designação de genes e proteínas: Genes ... promoção da interacção Gag-Gag, a encapsidação do RNA viral, a associação com a glicoproteína viral Env e a promoção da saída ...
  http://docplayer.com.br/1553517-Seleccao-e-caracterizacao-de-anticorpos-de-dominio-unico-especificos-para-a-proteina-gp41-de-vih-1.html
*  Van Helsing Rede social & Pesquisas: 06/01/2011 - 07/01/2011
O HIV tem muitos genes que codificam proteínas estruturais.. *Genes retrovírus gerais *gag. proteínas derivadas do gag ... Além disso, a pol codifica uma protease viral específica (PR). Essa enzima cliva o gag e as proteínas derivadas de gag e pol em ... Genes específicos do HIV *tat. Um porção da estrutura do RNA do HIV é uma estrutura como um grampo de cabelo que inicialmente ...
  http://bloggerdobem.blogspot.com/2011/06/
*  SIDA - Universidade do Porto
Genoma do Vírus 3 genes que codificam proteínas de estrutura do vírus: • gag - Codifica Proteínas do capsídeo e do core • pol ... Codifica as glicoproteínas do invólucro 6 genes que codificam proteínas da regulação da expressão de genes. Acredita-se que ... São: •tat, nef, ver, vif, vpr, vpu (o HIV-2 tem vpx em vez de vpu) Estes genes são flanqueados por repetições terminais longas ... LTR (Long Terminal Repeat) - elementos reguladores envolvidos na expressão dos genes. Ciclo de Replicação Provírus integrado ...
  http://livrozilla.com/doc/111529/sida---universidade-do-porto
*  Fonte Do Saber - Mania de Conhecimento ::: - PDF
Cada grupo de três bases (ACC, GAG, CGU. 6 etc.) é chamado códon e é específico para um tipo de aminoácido. Um pedaço de ácido ... O código genético, na forma de unidades conhecidas como genes, está no DNA, no núcleo das células. Já a 'fábrica' de proteínas ... Na transcrição, apenas os genes relacionados à proteína que se quer produzir são copiados na forma de RNA mensageiro. ...
  http://docplayer.com.br/17411055-Fonte-do-saber-mania-de-conhecimento.html
*  INSTITUTO DE ENSINO E PESQUISA SANTA CASA DE MISERICÓRDIA DE BELO HORIZONTE - PDF
Os genes podem ser divididos em dois grupos: os que codificam as proteínas estruturais (gag, pol e env) e os que codificam ... env Glicoproteína de superfície gp120 gag Proteína da matriz associada à membrana p17 gag Proteína do capsídio p24 AIDS ... gp120 gp41 p17 Dupla camada de lipídeos p24 Material genético e enzimas Estrutura do genoma do HIV-1 vpr rev rev gag vif ... que há evidências da associação de produtos de genes ligados ao HIV responsáveis pela patogênese das lesões dermatológicas ...
  http://docplayer.com.br/8250881-Instituto-de-ensino-e-pesquisa-santa-casa-de-misericordia-de-belo-horizonte.html
*  V rus infecta, ataca tumor cerebral e sobrevida de pacientes dobra - Uai Sa de
Os gliomas de alto grau (GAGs) s o um tipo agressivo de tumor no c rebro, com baixa expectativa de vida e tratamento sofrido. ... que ajudam a regular a express o dos genes - associadas sobreviv ncia dos pacientes, o que pode, potencialmente, prever a ... "Nossas an lises moleculares refor am a heterogeneidade dos tumores GAG e da metila o deles, que um fator que pode sensibilizar ...
  https://www.uai.com.br/app/noticia/saude/2016/06/17/noticias-saude,190028/virus-infecta-ataca-tumor-cerebral-e-sobrevida-de-pacientes-dobra.shtml
*  Maria José Ferreira Alves Glutaminólise em astrocitomas
A seleção dos genes foi feita comparando-se os níveis de expressão dos genes nos tecidos tumorais em relação aos níveis de ... GAG CAC ACA GAG GGC TAC AA 118 200nM F: AAATACGTGGTTGGAGAGCTCATT R: CCGAGTGAAGATCCCCTTTTTA 101 400nM 98 200nM 119 200nM 80 ... Entre os genes estudados, a expressão de LAT1 correlacionou-se com maior frequência e significância com os demais genes. As co- ... Seleção dos genes a partir dos dados de microarray de oligonucleotídeos A seleção dos genes envolvidos na via da glutaminólise ...
  http://ptdocz.com/doc/404019/maria-jos%C3%A9-ferreira-alves-glutamin%C3%B3lise-em-astrocitomas
*  ANÁLISE DE DNA POR ESPECTROSCOPIA INFRAVERMELHA POR TRANSFORMADA DE FOURIER - PDF
da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e ... Glicosaminoglicanos (GAGS) Introdução. heteropolissacarídeos lineares constituídos por unidades dissacarídicas repetitivas. ... JOGO BANCO GENÔMICO: TRABALHANDO COM GENES E ORGANISMOS TRANSGÊNICOS, UMA PRÁTICA PARA O ENSINO DE GENÉTICA ISSN 1980-3540 ... 03.02, 29-36 (2008) www.sbg.org.br JOGO BANCO GENÔMICO: TRABALHANDO COM GENES E ORGANISMOS TRANSGÊNICOS, UMA PRÁTICA PARA O ...
  http://docplayer.com.br/2723924-Analise-de-dna-por-espectroscopia-infravermelha-por-transformada-de-fourier.html
*  Ácido glutâmico - Wikipedia
Seus códons são GAA e GAG. O ânion carboxilato e os sais do ácido glutâmico são conhecidos como glutamatos. O glutamato é um ... amplificação ou superexpressão de factores de transcrição de genes pró-apoptóticos ou repressão de factores de transcrição de ... genes antiapoptóticos mediada pelo glutamato e pelo Ca2+. A excitotoxicidade devida à acumulação de glutamato ocorre em ...
  https://pt.wikipedia.org/wiki/%C3%81cido_glut%C3%A2mico
*  Apoio Oriflame Portugal - Teresa David: Março 2013
Atua a nível genético para estimular os 3 Genes de BelezaTM da pele, permitindo-lhe exibir uma aparência jovem e bonita;. - ... Além disso, a pele perde importantes moléculas de açúcar (GAG) que atraem água e deixam a pele preenchida e com mais ...
  http://oriconceito.blogspot.com/2013/03/
*  MNEMÔNICO MASSAPINA: Caracterização de duplicação
... é sempre analisado o perfil de mutação apenas dos genes alvos da terapia", afirmou Angélica.Atualmente, os medicamentos para ... identificou-se através da genotipagm do Gag que algumas crianças em falha terapêutica, que haviam sido contaminadas por ...
  http://mnemonicomassapina.blogspot.com/2007/09/caracterizao-de-duplicao.html
*  Currículo do Sistema de Currículos Lattes (Flavio Faloppa)
COMPORTAMENTO DOS GAGs NA REGENERA??O SSEA AP S A APLICA??O DE TERAPIA DE ONDAS DE CHOQUE EM OSSO LONGOS DE RATOS. 2011. Tese ( ... An lise dos polimorfismos dos genes TGFβ1, TGBβ1R e KLF6 nos pacientes com capsulite adesiva do ombro. In cio: 2014. Tese ( ... Comportamento dos GAGs na regenera o ssea ap s a aplica o de terapia por ondas de choque em ossos longos de ratos. ... Os GAGs s o elementos importantes na constitui o ssea, cartilaginea e pele e de outras estruturas e sua deficiencia causa in ...
  http://buscatextual.cnpq.br/buscatextual/visualizacv.do?metodo=apresentar&id=K4792444D7
*  UNIVERSIDADE FEDERAL DE CAMPINA GRANDE - ppt carregar
Logo após a amplificação, foi feita a purificação do produto de PCR dos genes ou dos segmentos de genes de interesse utilizando ... As seqüências são: Primer SH01 forward: 5' - TCG AAC GAT GAG CTG AAC A - 3' e Primer SH01 reverse: 5' - AGT GTC GCC TGG CAT ATT ... pois os plasmídeos pQE-30 e pREP4 apresentam genes para resistência a estes antibióticos. Para que ocorra expressão dos genes ... Esses dados podem ser utilizados para estudar a função de diversos genes, podendo esclarecer aspectos da relação hospedeiro/ ...
  http://slideplayer.com.br/slide/1836355/