*  Nódulos linfóides medulares Bone marrow lymphoid nodules - PDF
Tornou-se, portanto, um importante estudo complementar na avaliação das desordens linfoproliferativas. 17 O estudo de DNA ... A monoclonalidade pode ser demonstrada pela restrição de cadeias leves ou através do rearranjo do DNA da cadeia pesada das ... Avaliação do Conteúdo de DNA por citometria de fluxo em Linfomas não Hodgkin de células B: situação actual e perspectivas ... 2003;25(2):81-87 Magalhães SMM et al degradação do DNA, resultado do processo de fixação e descalcificação e competição na ...
  http://docplayer.com.br/2832475-Nodulos-linfoides-medulares-bone-marrow-lymphoid-nodules.html
*  Seminários turma 2010 Bacharelado - Vida primordial - A UFOP e a Ecologia Evolutiva
Quanto ao DNA, a sua origem e a de seus mecanismos de replicação permanecem obscuras, mas elas devem ser posteriores ao ... Essa hipótese é reforçada pelo pareamento complementar dos nucleotídeos; o que promove a cópia exata de uma seqüência, pois, ... Em biologia, a hipótese do mundo do RNA propõe que o mundo atual com vida baseada principalmente no DNA e proteínas foi ... A desoxirribose, comparada com a ribose, forma cadeias mais estáveis o que faz com que o DNA possa se alongar sem perigos de ...
  http://ufopeaecologiaevolutiva.blogs.sapo.pt/18913.html
*  Transc. Eucariontes :: Genética Virtual
... dando um filamento de DNA que está livre para funcionar como molde para a síntese de um filamento complementar de RNA. ... TFIIA e TFIIB; TFIIF se liga à RNA polimerase II e depois ao complexo de iniciação - e promove desenrolamento do DNA; ... Esses fatores de transcrição devem se ligar a uma região promotora no DNA e formar um complexo de iniciação apropriado antes ... TFIIE se junta ao complexo de iniciação ligando-se ao DNA e em seguida ao ponto de iniciação da transcrição; ...
  http://geneticavirtual.webnode.com.br/genetica-virtual-home/prefacio/transcri%C3%A7%C3%A3o/transc-em-eucariontes/
*  BURGOS (Cãogrino): Equador defenderá a povo waorani de coleta ilegal do seu DNA
... às pessoas que tomaram as amostras sanguíneas e também para levantar informação complementar.. Benalcázar explicou que os ... Um comitê jurídico equatoriano levará a tribunais internacionais a denúncia sobre a coleta de amostras de DNA do povo waorani ... extraía seu DNA com fins de pesquisa e de comercialização.. Deste modo, considerou, violaram as leis de bioética e atentaram ...
  http://burgos4patas.blogspot.com/2012/09/equador-defendera-povo-waorani-de.html
*  Currículo do Sistema de Currículos Lattes (Marcello Henrique Araujo Da Silva)
From DNA to Protein Function Using Bioinformatics. (Carga hor ria: 40h). Wellcome Trust Sanger Institute, SANGER, Inglaterra. ... Formação Complementar. 2018 Controle e Processos Industriais. (Carga hor ria: 40h). Universidade de Bras lia, UnB, Brasil. ... T cnicas de sequenciamento de DNA. (Carga hor ria: 4h). Universidade Federal Fluminense, UFF, Brasil. ...
  http://buscatextual.cnpq.br/buscatextual/visualizacv.do?metodo=apresentar&id=K8741061D2
*  Caracterização molecular dos ácidos nucléicos - Biomedicina Brasil
Um fragmento de DNA marcado por uma substância radioativa é usado como sonda para determinar a presença da fita complementar em ... Tanto o DNA quanto o RNA são utilizados na pesquisa, dependendo, principalmente, do objetivo de cada trabalho. O DNA apresenta ... o DNA e o RNA. A unidade básica tanto do DNA como do RNA são polímeros de subunidades monoméricas, denominadas nucleotídeos, ... O DNA de todas as bactérias (organismos procarióticos) e de muitos vírus são arranjados de forma circular. O cromossomo da ...
  http://www.biomedicinabrasil.com/2010/11/caracterizacao-molecular-dos-acidos.html
*  mosaico - Resumos Diversos - Maxwelll9
... das fitas de DNA e RNA. Fitas senso positivo (+) apresentam sequência idêntica à do mRNA, enquanto as senso negativo (-) ... apresentam sequência nucleotídica complementar. Diante destacomplexidade de características, as estratégias de transcrição do ... das fitas de DNA e RNA. Fitas senso positivo (+) apresentam sequência idêntica à do mRNA, enquanto as senso negativo (-) ...
  http://www.trabalhosfeitos.com/ensaios/Mosaico/45471016.html
*  Anticódon - Wikipedia
Veja o exemplo a seguir: DNA fita molde AAT TCG GGA ACC DNA fita sense TTA AGC CCT TGG RNA m (códons) UUA AGC CCU UGG RNA t ( ... uma região complementar que reconhece o códon, chamada de anticódon. Cada RNAt correspondem a um aminoácido diferente, e ... No processo de transcrição do DNA, obtém-se o pré RNAm (a partir da fita molde), que contém seqüências de nucleotídeos ... a formação de peptídeos que originarão o produto da expressão do DNA. ...
  https://pt.wikipedia.org/wiki/Antic%C3%B3don
*  Problema do clique - Wikipedia
Metodologias incomuns de computação para achar cliques incluem computação em DNA e computação quântica adiabática. O problema ... um caso que não faz sentido para o problema do clique complementar, também houve trabalho em algoritmos de aproximação que não ... DNA solution of the maximal clique problem», Science, 278 (5337): 446-449, PMID 9334300, doi:10.1126/science.278.5337.446 . ... é pré computada para todos os pequenos subgrafos conectados do grafo complementar e essas soluções parciais são usadas como um ...
  https://pt.wikipedia.org/wiki/Problema_do_clique
*  Liberdade Mental: O Sangue/Ouro dos deuses! ... O Fogo de Estrelas, DNA, Maná, a Pedra Filosofal, Ormus ou o Pó de Ouro branco!
Pra complementar, já que vc veio aqui, eu sempre procuro deixar links e docs interessantes para que a pessoa possa acessar ... retrata as hélices do DNA, pois ele era um arquiteto geneticista ou um programador de DNA. [Não é a toa que o DNA é descrito ... Está em nosso DNA. Essa prova é o nosso DNA. Antes de Terra ser Terra, o universo sempre foi universo. O que vc chama de Deus, ... Flor, Fluxo, Sangue, Vermelho, DNA, Cruz, Rosa] ... Ligou os pontos?. O "Dragão messiânico" em essência era representado como ...
  http://rmorais76.blogspot.com/2013/09/o-sangueouro-dos-deuses-o-fogo-de.html
*  Aminoacil-RNAt - Wikipedia
A leitura do códon complementar (anticódon) correto é feita ao entrar em contato com o RNAm, mas ligação aos outros aminoácidos ... É por esse motivo que o código de DNA é considerado "degenerado". Sob certas circunstâncias, aminoácidos não compatíveis vão ...
  https://pt.wikipedia.org/wiki/Aminoacil-RNAt
*  Amantes da Biologia Com Prof. Alan Calvet: BIOQUÍMICA: 10 Questões,avalie-se!!
c) o DNA origina fosfato, glicídio e bases nitrogenadas quando é dissociado.. d) o segmento com informação para a síntese de ... Durante a replicação, a fita -A-C-G-T-T-A-C-C-G- sofreu uma mutação a qual gerou a produção da fita complementar -T-G-C-G-A-T-G ... UFU- 2008) A mutação gênica é uma alteração que ocorre na molécula de DNA ao atingir a sequencia de bases. Essa mutação é ... UDU- 2007)A análise de um segmento do DNA de um procarioto revelou a seguinte seqüência de nucleotídeos: AGG GAC TTC CTT GCT ...
  http://alancalvet.blogspot.com/2016/03/bioquimica-10-questoesavalie-se.html
*  Mutação - Wikipedia
Como o DNA pode ser danificado ou mutado de diversas maneiras, o processo de reparação do DNA é uma maneira importante do corpo ... uma mutação complementar em outro local que resulta no retorno do gene à função anterior). Mutações pontuais que ocorrem dentro ... Agentes intercalantes de DNA (por exemplo, Brometo de etídio) DNA crosslinker (e.g. platina) Dano oxidativo causado por ... Estes agentes podem causar a mutação tanto de DNA em replicação como em DNA não-replicante. Entretanto, um análogo de base ...
  https://pt.wikipedia.org/wiki/Muta%C3%A7%C3%A3o
*  TEORIA] Evidência da replicação semiconservativa
Evidência da replicação semiconservativa Acompanhem este vídeo com o conteúdo escrito Já tínha-se as evidências de que o DNA ... 1) DNA da E. coli todo marcado com 15N após 14 gerações. DNA com alta densidade no fundo do tubo de ensaio.. (2) Primeiro ciclo ... cores sem preenchimento - Nova hélice complementar antiparalela que é sintetizada a partir da molécula original que atua como ... esse mecanismo de reprodução do DNA foi chamado de replicação semiconservativa.. Veja algumas sugestões:. cores sólidas - DNA ...
  http://bioquimica.forumeiros.com/t830-teoria-evidencia-da-replicacao-semiconservativa
*  Evidência da replicação semiconservativa - Biologia Molecular
... para a confecção de uma nova cadeia complementar. Dessa forma, uma molécula de DNA, ao se replicar, produziria duas moléculas ... 1) DNA da E. coli todo marcado com 15N após 14 gerações. DNA com alta densidade no fundo do tubo de ensaio.. (2) Primeiro ciclo ... cada nova molácula de DNA conteria 50% de 15N e 50% de 14N; e, após dois ciclos de replicação, metade das moléculas de DNA ... O 15N é mais denso que o 14N, portanto teremos as moléculas de DNA distribuídas da seguinte maneira no tubo:. 100% 15N: mais ...
  http://www.biomol.org/historia/replisemicon.shtml
*  Computação natural - Wikipedia
Computadores de DNA tem sua arquitetura baseada no processamento e armazenagem de informações em cadeias genéticas de um DNA, ... A computação natural tenta impor novos paradigmas que visam suplementar e/ou complementar os computadores atuais baseados em ... Utilizar mecanismos naturais, como cadeias de DNA e técnicas de engenharia genética, como novos paradigmas de computação. Tendo ... Computador quântico Fractais Computador de DNA Inteligência artificial IBM avança no conceito de computador quântico (em ...
  https://pt.wikipedia.org/wiki/Computa%C3%A7%C3%A3o_natural
*  Desafiando a Nomenklatura Científica: Setembro 2006
A danificação em DNA não é incomum, e por isso a capacidade da célula consertar DNA é importante. Uma variedade de mecanismos e ... Surpreendentemente, um par complementar de nucleotídeo consiste de um nucleotídeo grande e um pequeno. A adenina não se ... Em vez de 26 letras, a linguagem do DNA consiste quatro letras. E em vez de tinta sobre o papel, as letras do DNA são ... A Estrutura da Informação do DNA. Cornelius Hunter. Muito se fala sobre a informação no DNA. Esta famosa macromolécula de dupla ...
  http://pos-darwinista.blogspot.com/2006_09_01_archive.html
*  Outros métodos de diagnóstico directo: detecção de toxinas; pesquisa de antigénios
ex: RNA-RNA, RNA-ssDNA, DsDNA-ds-DNA. "Probe" - Sonda ou Primer - Curta sequência de ácidos nucleicos complementar de regiões ... que RNAm e há mais cópias que de DNA; excepto nos vírus que não têm RNAr. DNA plasmídico, DNA extracromossómico também pode ser ... Seja DNA ou RNA, o melhor alvo é a sequência de nucleotídeos só presente em células alvo - especificidade. Especificidade - o ... Alvos de DNA são os mais específicos porque contêm regiões únicas Alvos de RNA também são usados porque há mais cópias de RNA ...
  http://ensaio.org/outros-mtodos-de-diagnstico-directo-detecco-de-toxinas-pesquis.html
*  SciCast #196: Epigenética - Deviante
Material Complementar:. Sugestão de literatura:. Eva Jablonka e Marion J. Lamb. 2010. EVOLUÇÃO EM QUATRO DIMENSÕES - DNA, ... na replicação do DNA para a divisão celular, essa enzima corre a nova fita de DNA 'copiando' as marcas que tem na original), ... O DNA contem os códigos de todos os genes que serão usados em todos os tipos de célula. A partir de alterações químicas que ... O DNA é organizado de tal forma que a cada alteração nas proporções de produtos e substâncias presentes na célula, os genes ...
  http://www.deviante.com.br/podcasts/scicast/scicast-196-epigenetica/
*  Genética e Evolução: Profa. Gilcele - PDF
MUTAÇÃO E REPARO DO DNA MUTAÇÃO E REPARO DO DNA MUTAÇÃO E REPARO DO DNA Danos ao DNA (tipos, locais e frequência) Dano ao DNA ... 18 RNA Ácido Ribonucleico RNA: fita simples - estrutura por pareamento complementar RNA de transferência ou transportador-trna ... ÁCIDOS NUCLEICOS DNA E RNA DNA E RNA DNA E RNA BREVE HISTÓRICO DA DESCOBERTA DO DNA BREVE HISTÓRICO DA DESCOBERTA DO DNA ÁCIDOS ... DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, ...
  http://docplayer.com.br/6744784-Genetica-e-evolucao-profa-gilcele.html
*  Haplogrupo I-M253 - Wikipedia
link) «Founding Father DNA». isogg.org Bancos de dados haplogrupo I Haplogroup I1 Project at FTDNA Danish Demes Regional DNA ... complementar 5'→ 3'): CAGCTCCACCTCTATGCAGTTT YCC HG: I1 Alteração nucleotídeos alelos (mutação): C a T Nome: M307 Tipo: SNP ... doi:10.1111/j.1469-1809.2008.00487.x Eupedia, "Distribution of European Y-chromosome DNA (Y-DNA) haplogroups by country in ... Passageiros do Mayflower William Brewster, Edward Winslow e George Soule através de testes de DNA As seguintes são as ...
  https://pt.wikipedia.org/wiki/Haplogrupo_I-M253
*  PartnerSales - MOBILIDADE
Assim, mobilidade est no nosso DNA desde o dia da funda o da empresa. Dentro dos nossos pilares estrat gicos, IoT tem uma ... Ela pode agir desde como uma agente viabilizadora e essencial do neg cio at como uma for a complementar no aumento da ... Outra fabricante que tem em seu DNA a inova o a Lenovo. As linhas de notebooks da marca atendem uma variedade de necessidades ... Dessa forma, os canais podem complementar a oferta por meio de integra es com outros sistemas e fabricantes resultando em um ...
  http://partnersales.com.br/noticia/16185/mobilidade
*  Detecção de Intrusão em Redes de Computadores: Algoritmo Imunoinspirado Baseado na Teoria do Perigo e Células Dendríticas - PDF
DNA - Ácido desoxirribonucleico (Deoxyribonucleic acid) DoS - Negação de serviço (Denial of Service) DP - Desvio Padrão xiii ... A implantação de estruturas de dados que podem complementar ou substituir os computadores atuais é estudada em Computação com ... mecanismos naturais, essas estruturas podem ser as cadeias de DNA ou os bits quânticos, que permitem o desenvolvimento de ' ...
  http://docplayer.com.br/2139293-Deteccao-de-intrusao-em-redes-de-computadores-algoritmo-imunoinspirado-baseado-na-teoria-do-perigo-e-celulas-dendriticas.html
*  Artigos Cient ficos e Monografias - Humana Alimentar - A nossa marca a vida.
... protege contra danos do DNA e reduz a inflama o do c lon em ratos com colite induzida, podendo vir a ser uma importante terapia ... complementar na colite ulcerativa, reduzindo o uso de anti-inflamat rios e prevenindo o c ncer de c lon. Para visualizar esse ...
  http://www.humanaalimentar.com.br/site/conteudo/profissional/artigos-cientificos-e-monografias
*  Natureza e funções do material genético | Resumo Escolar
... que a duplicação das hélices acontece por causa da formação de uma cadeia complementar devido a separação das duas fitas do DNA ... O DNA. O DNA foi descoberto por Johann Friedrich Miescher um cientista suíço no século XIX. Na época, Johann trabalhava no ... O RNA é um ácido ribonucleico que é produzido a partir do DNA, especificamente uma molécula de DNA, esse processo é chamado de ... a cadeia de DNA se separa por enzimas que são responsáveis por quebrar as pontes de hidrogênio contidas no DNA. Ao se separar ...
  https://www.resumoescolar.com.br/biologia/natureza-e-funcoes-do-material-genetico/