Zonula Occludens-1 Protein | Palmetto Profiles
A 195-kDa zonula occludens protein with similarity to MEMBRANE-ASSOCIATED GUANYLATE KINASES. It is distinguished by the ... Targeting the tight junction protein, zonula occludens-1, with the connexin43 mimetic peptide, aCT1, reduces VEGF-dependent RPE ... Zonula occludens-1/NF-?B/CXCL8: a new regulatory axis for tumor angiogenesis. FASEB J. 2017 04; 31(4):1678-1688. ... "Zonula Occludens-1 Protein" is a descriptor in the National Library of Medicines controlled vocabulary thesaurus, MeSH ( ...
RCSB PDB - 2JWE: Solution structure of the second PDZ domain from human zonula occludens-1: A dimeric form with 3D domain...
Solution structure of the second PDZ domain from human zonula occludens-1: A dimeric form with 3D domain swapping ... Tight junction protein ZO-1. A, B. 88. Homo sapiens. Mutation(s): 0 Gene Names: TJP1, ZO1. ... Solution structure of the second PDZ domain of Zonula Occludens 1. Ji, P., Yang, G., Zhang, J.H., Wu, J.W., Chen, Z., Gong, Q. ... Solution structure of the second PDZ domain from human zonula occludens-1: A dimeric form with 3D domain swapping. *PDB DOI: ...
The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1
... beta or to ectopic expression of the protein tyrosine phosphatase Pez. Enforced expression of the miR-200 family alone was ... Zonula Occludens-1 Protein ... Nerve Tissue Proteins / genetics * Nerve Tissue Proteins / ... Philip A Gregory 1 , Andrew G Bert, Emily L Paterson, Simon C Barry, Anna Tsykin, Gelareh Farshid, Mathew A Vadas, Yeesim Khew- ... 1 Hanson Institute and Division of Human Immunology, Institute of Medical and Veterinary Science, Adelaide, SA 5000, Australia. ...
Complete polarization of single intestinal epithelial cells upon activation of LKB1 by STRAD
We have previously reported the identification and characterization of an LKB1-specific adaptor protein, STRAD, whic … ... Protein Serine-Threonine Kinases / genetics * Protein Serine-Threonine Kinases / metabolism* * Zonula Occludens-1 Protein ... The junctional proteins ZO-1 and p120 redistribute in a dotted circle peripheral to the brush border, in the absence of cell- ... We have previously reported the identification and characterization of an LKB1-specific adaptor protein, STRAD, which activates ...
Tight junction protein 1 - Wikipedia
It belongs to the family of zonula occludens proteins (ZO-1, ZO-2, and ZO-3), which are tight junction-associated proteins and ... "The carboxyl terminus of Neph family members binds to the PDZ domain protein zonula occludens-1". The Journal of Biological ... "Lens connexins alpha3Cx46 and alpha8Cx50 interact with zonula occludens protein-1 (ZO-1)". Molecular Biology of the Cell. 14 (6 ... Zonula occludens-1 ZO-1, also known as Tight junction protein-1 is a 220-kD peripheral membrane protein that is encoded by the ...
Table - Microevolution of Highly Pathogenic Avian Influenza A(H5N1) Viruses Isolated from Humans, Egypt, 2007-2011 - Volume 19,...
... postsynaptic density protein, Drosophila disk large tumor suppressor, and zonula occludens-1 protein; HPAI, highly pathogenic ... Protein, amino acid position. Virus group† Functional relevance (reference#). 2.2.1-C. 9174‡. 2009 variants§. 2007-2008 ... Structure and function of the NS1 protein of influenza A virus. Acta Biochim Biophys Sin (Shanghai). 2007;39:155-62. DOIPubMed ... In vitro dissection of the membrane and RNP binding activities of influenza virus M1 protein. Virology. 2001;281:102-8. DOI ...
Changes in Gut Microbiota Control Metabolic Endotoxemia-Induced Inflammation in High-Fat Diet-Induced Obesity and Diabetes in...
... forward zonula occludens-1 (ZO-1), ACCCGAAACTGATGCTGTGGATAG; reverse ZO-1, AAATGGCCGGGCAGAACTTGTGTA; forward occludin, ... D and F: Epithelial tight junction proteins markers (ZO-1 and occludin mRNA concentrations). E and G: Correlations between ... D and F: Epithelial tight junction proteins markers (ZO-1 and occludin mRNA concentrations). E and G: Correlations between ... 1C) by a mechanism associated with a reduced expression of epithelial tight junction proteins such as ZO-1 and Occludin (Fig. ...
LATS1 | Cancer Genetics Web
protein binding - protein kinase binding - protein phosphorylation - protein serine/threonine kinase activity - regulation of ... Zonula Occludens-1 Protein. *RTPCR. *Down-Regulation. *Research. *TGFB1. *p38 Mitogen-Activated Protein Kinases ... and its encoded protein has activities of both a protein phosphatase and a lipid phosphatase. However, the substitution effect ... regulation of protein complex assembly - sister chromatid segregation - spindle pole Data from Gene Ontology via CGAP [Hide] ...
Search - NeL.edu
Comparison of tibolone and 17beta-estradiol administration on the expression of zonula occludens-1, occludin, glial fibrillary ... glial fibrillary acidic protein and c-fos levels in the brain cortex and hippocampus of female rats. Neuro Endocrinol Lett. ... Comparison of tibolone and 17beta-estradiol administration on the expression of zonula occludens-1, occludin, ... Glial Fibrillary Acidic Protein:metabolism, Hippocampus:drug effects, Neurodegenerative Diseases:prevention & control. ...
Tight Junction Protein 2 Antibody (NBP1-86850): Novus Biologicals
View Rabbit Polyclonal anti-Tight Junction Protein 2 Antibody (NBP1-86850). Validated Applications: WB, ICC/IF, IHC, IP. ... Zonula Occludens (ZO) the Junction Scaffolding Proteins. The Zonula Occludens (ZO) proteins 1,2 and 3, also known as tight ... Downregulation of tight junction protein zonula occludens-2 and urothelium damage in a cyclophosphamide-induced mouse model of ... Home » Tight Junction Protein 2 » Tight Junction Protein 2 Antibodies » Tight Junction Protein 2 Antibody ...
Propofol attenuated the effect of TNF-α on occludin expression by inhibiting HIF-1α/VEGF/VEGFR-2/ERK signaling pathway in hCMEC...
The levels of tight junction proteins (TJs), especially occludin correlate with blood-brain barrier (BBB) disruption caused by ... The tight junction proteins include claudins, occludin and zonula occludens-1 (ZO-1) [ 18]. It has been reported that the ... Brain microvascular endothelial cells, one of the major components of BBB, are linked by intercellular tight junction protein ... Purpose: The levels of tight junction proteins (TJs), especially occludin correlate with blood-brain barrier (BBB) disruption ...
Fang Chen (Rosy)'s Profile | Stanford Profiles
The corneas were evaluated for the presence of beta-tubulin, cytokeratin 3, zonula occludens-1, and alpha smooth muscle actin ( ... and protein expression of CD44 and collagen VI were evaluated.RESULTS: Intraocular pressure, corneal thickness, and hysteresis ... and the secretome cytokine analysis indicated that the expression levels of 12 different proteins were not dysregulated by PBNP ... PTX-MB@PLGA NPs showed an IC50 of 78 μg mL-1 and 44.7±4.8 % decrease of tumor burden in an orthotopic model of colon cancer via ...
Descemet's Membrane Biomimetic Microtopography Differentiate... : Cornea
Gene expression of zonula occludens 1 (ZO-1), sodium/potassium (Na/K)-ATPase, collagen 8 (Col-8), and paired-like homeodomain ( ... Explicit protein expression is presented in Figure 4C. These data confirm the assumption that the genes are upregulated but ... Changes in morphology were imaged, and changes in gene expression of CEC typical genes such as zonula occludens (ZO-1), sodium/ ... Detection of rabbit Descemet microtopography and its ability to convert hMSCs into polygonal zonula occludens (ZO-1) and sodium ...
Frontiers | The Clinical Importance of Campylobacter concisus and Other Human Hosted Campylobacter Species
... concisus also induced movement of tight junction proteins zonula occludens-1 and occludin from cell membrane into cytosol ( ... To date, only two virulence factors of C. concisus have been characterized, one of which is the zonula occludens toxin (Zot). ... Liu, F., Lee, H., Lan, R., and Zhang, L. (2016). Zonula occludens toxins and their prophages in Campylobacter species. Gut ... The C. rectus GroEL-like protein is a 64 kDa protein with antigenic properties (Hinode et al., 1998). It was found to cross- ...
Astragaloside IV Attenuates Lipopolysaccharides-Induced Pulmonary Epithelial Cell Injury through Inhibiting Autophagy |...
The expression of tumour necrosis factor (TNF)-α, interleukin (IL)-6, zonula occludens (ZO)-1, Beclin-1 and autophagy-related ( ... The total proteins of cells were extracted as aforementioned. After the proteins extraction, and PierceTM BCA Protein Assay Kit ... a The protein band of LC3B at gradient concentration of LPS (ng/mL) by Western Blot. b The relative protein level of LC3B I and ... a The protein band of LC3B at gradient concentration of LPS (ng/mL) by Western Blot. b The relative protein level of LC3B I and ...
Overexpression of netrin‑1 increases the expression of tight junction‑associated proteins, claudin‑5, occludin, and ZO‑1,...
Anderson J, Fanning A, Lapierre L and Van Itallie CM: Zonula occludens (ZO)-1 and ZO-2: membrane-associated guanylate kinase ... associated proteins, the expression levels of proteins involved in maintaining the integrity of the BBB, including netrin‑1, ... The results demonstrated that the levels of mRNA transcription and protein expression of the TJ‑associated proteins, claudin‑5 ... Haskins J, Gu L, Wittchen ES, Hibbard J and Stevenson BR: ZO-3, a novel member of the MAGUK protein family found at the tight ...
Mar��a Javier Ram��rez Gil. Curriculum. Universidad de Navarra
For assessing the BBB integrity, we studied the protein expression of two tight junction (TJ) proteins: Zonula occludens-1 (ZO- ... the expression of key proteins involved in glucocorticoid activity and insulin signaling; microtubule-associated protein tau ... In summary, A beta increases GLUT12 protein expression in the brain pointing out a central role of the transporter in AD ... In this study, we measured RPH3A and its ligand Rab3A as well as several SNARE proteins in postmortem neocortex of patients ...
Rosmarinic acid downregulates the oxLDL‑induced interaction between monocytes and endothelial cells, in addition to monocyte...
... zonula occludens; ECs, endothelial cells; High Glu or HG, high glucose; TXNIP1, thioredoxin interacting protein; NAC, N-acetyl- ... The relative level of each protein was normalized to the level of β-actin as a loading control. Protein densities were ... cadherin and zonula occludens‑1 (ZO‑1) were measured by western blotting. In addition, adhesion assay and Transwell assays were ... interacts with the tight junction molecule zonula occludens-1 (ZO-1) to link together adjacent ECs to regulate diapedesis (2,13 ...
Fang Chen (Rosy)'s Profile | Stanford Profiles
The corneas were evaluated for the presence of beta-tubulin, cytokeratin 3, zonula occludens-1, and alpha smooth muscle actin ( ... and protein expression of CD44 and collagen VI were evaluated.RESULTS: Intraocular pressure, corneal thickness, and hysteresis ... and the secretome cytokine analysis indicated that the expression levels of 12 different proteins were not dysregulated by PBNP ... PTX-MB@PLGA NPs showed an IC50 of 78 μg mL-1 and 44.7±4.8 % decrease of tumor burden in an orthotopic model of colon cancer via ...
Plus it
... which are linked to cytoskeletal proteins and each other by scaffolding proteins, such as zonula occludens (ZO) proteins. The ... Evidence for a family of human glucose transporter-like proteins. Sequence and gene localization of a protein expressed in ... recently identified SGLT protein in type I and II alveolar cells of rat and sheep lung. However, SGLT1 protein could not be ... GLUT1 protein has also been detected in the alveolar epithelium of the fetal rat, although to date, GLUT1 protein has not been ...
EMSG8: Are Connexins, the Gap Junctional Integral Proteins, Involved in Male Reproductive Disorders Associated With Possible...
... intercellular communication by lindane is associated with aberrant localisation of connexion43 and zonula occludens-1 in 42GPA9 ... EMSG8: Are Connexins, the Gap Junctional Integral Proteins, Involved in Male Reproductive Disorders Associated With Possible ...
IJMS | Special Issue : Signalling Molecules and Signal Transduction in Cells
Additionally, RhoA shRNA interference inhibited the ethanol-induced expression of zonula occludens-1 (ZO-1). Finally, RhoA ... cyclin-dependent protein kinase, mitogen-activated protein kinase, Akt protein kinase). A number of studies have demonstrated ... The unfolded protein response (UPR) is a cell-signaling system that detects the accumulation of unfolded protein within the ... The unfolded protein response (UPR) is a cell-signaling system that detects the accumulation of unfolded protein within the ...
ZO-1 Monoclonal Antibody (ZO1-1A12) (33-9100)
Invitrogen Anti-ZO-1 Monoclonal (ZO1-1A12), Catalog # 33-9100. Tested in Western Blot (WB), Immunocytochemistry (ICC/IF) and ... Phase Separation of Zonula Occludens Proteins Drives Formation of Tight Junctions.. Cell ... protein binding calmodulin binding protein domain specific binding cadherin binding involved in cell-cell adhesion protein C- ... Expression of zonula occludens-1 (ZO-1) and the transcription factor ZO-1-associated nucleic acid-binding protein (ZONAB)-MsY3 ...
Search | Global Index Medicus
In the colon, the C-SP group showed significantly reduced crypt depth and zonula occludens-1 expression. The mRNA expression ... Besides, the Shihu extract inhibited the PI3K/AKT/mTOR pathway and increased the level of Forkhead box protein in the lungs. ... proteins, lipid and carbohydrates, metabolites, toxins, etc) and the molecules produced by the host. The intestinal microbiome ... levels of pro-inflammatory cytokines, chemokines and tight junction proteins were significantly higher in the C-SP group. To ...
Feeder-free differentiation of cells exhibiting characteristics of corneal endothelium from human induced pluripotent stem...
B) Representative immunocytochemical labeling of frozen/thawed corneal endothelial cells labeled with zonula occludens-1 (upper ... the adherens junction protein, N-Cadherin (N-Cad), the water channel protein, Aquaporin-1 (AQP-1) and the enzyme pump, Na+/K+ ... B) Representative immunocytochemical labeling of frozen/thawed corneal endothelial cells labeled with zonula occludens-1 (upper ... zonula occludens-1 (D-F; ZO-1, green) and Aquaporin-1 (G-I; AQP-1, green). Cells were assessed for the presence of corneal ...
Reactome | WWTR1 (TAZ) binds ZO-2 (TJP2)
Search | Preprints.org
Cross sections of the multilayers were characterized by histological staining and immunocytochemistry of zonula occludens-1 ... Subject: Physical Sciences, Condensed Matter Physics Keywords: protein self-assembling; protein hydrogel; lysozyme; ultrasonic ... Probing Globular Proteins Self-Assembling Dynamics by Heterodyne Transient Grating Experiments. Sara Catalini, Andrea Taschin, ... The bone morphogenetic protein-2 (BMP-2) provided osteoinductive composition properties. It was impregnated directly into the ...
Cyclic strain-mediated regulation of vascular endothelial occludin and ZO-1: influence on intercellular tight junction assembly...
Zonula Occludens-1 Protein",. author = "Collins, {Nora T} and Cummins, {Philip M} and Colgan, {Olga C} and Gail Ferguson and ... Protein Kinase C/antagonists & inhibitors, Protein Tyrosine Phosphatases/antagonists & inhibitors, RNA, Messenger/metabolism, ... modifications that could be completely blocked with tyrosine phosphatase and protein kinase C inhibitors (dephostatin and ... modifications that could be completely blocked with tyrosine phosphatase and protein kinase C inhibitors (dephostatin and ...
Immundiagnostik AG / K 5601
br,Fasano and his co-workers found that the zonulin system is more activated in celiac disease and type 1 diabetes mellitus ... BR,,br,,b,Zonulin,/b, is a human protein analogue to the zonula occludens toxin derived from Vibrio cholerae which regulates ... Zonulin is a human protein analogue to the zonula occludens toxin derived from Vibrio cholerae which regulates tight junctions ... Fasano and his co-workers found that the zonulin system is more activated in celiac disease and type 1 diabetes mellitus ...
Richard Goodman - Publications - Oregon Health & Science University
Proto-Oncogene Proteins c-crk 25% * Datasets 20% * Zonula Occludens-1 Protein 18% ... C-terminal-binding protein corepresses epithelial and proapoptotic gene expression programs. Grooteclaes, M., Deveraux, Q., ... Homeodomain-interacting protein kinase-2 mediates CtBP phosphorylation and degradation in UV-triggered apoptosis. Zhang, Q., ... Exercise-induced enhancement of synaptic function triggered by the inverse BAR protein, Mtss1L. Chatzi, C., Zhang, Y., ...