*  B. bacteriovorus AspRS aspartylates tRNAAsn.Aminoacylat | Open-i
RNA, Transfer, Asn/chemistry*. Minor. *Biosynthetic Pathways. *Escherichia coli. *Genetic Complementation Test ... Reactions were carried out at 37°C with 1.0 µM 32P-labeled tRNAAsp or Asn, 11.0 µM tRNAAsp or Asn, 4.0 mM ATP, 4.0 mM relevant ... Reactions were carried out at 37°C with 1.0 µM 32P-labeled tRNAAsp or Asn, 11.0 µM tRNAAsp or Asn, 4.0 mM ATP, 4.0 mM relevant ... Analysis of bacterial genomes suggests a significant number of other bacteria may also code for both routes for Asn-tRNAAsn ...
  https://openi.nlm.nih.gov/detailedresult.php?img=PMC4206432_pone.0110842.g001&req=4
*  sll1866 protein (Synechocystis sp. PCC6803) - STRING database
Transfer RNA-guanine transglycosylase; Exchanges the guanine residue with 7-aminomethyl-7- deazaguanine in tRNAs with GU(N) ... Asn, -His and -Tyr). After this exchange, a cyclopentendiol moiety is attached to the 7-aminomethyl group of 7-deazaguanine, ... Transfer RNA-guanine transglycosylase; Exchanges the guanine residue with 7-aminomethyl-7- deazaguanine in tRNAs with GU(N) ... Is involved in the transfer of the threonylcarbamoyl moiety of threonylcarbamoyl-AMP (TC-AMP) to the N6 group of A37, together ...
  https://string-db.org/newstring_cgi/show_network_section.pl?identifier=1148.SYNGTS_1656
*  Asparaginyl-tRNA synthase (glutamine-hydrolysing) - Wikipedia
Min B, Pelaschier JT, Graham DE, Tumbula-Hansen D, Soll D (2002). "Transfer RNA-dependent amino acid biosynthesis: an essential ... Asn), and L-glutamine, whereas its 4 products are ADP, phosphate, asparaginyl-tRNA(Asn), and L-glutamate. This enzyme belongs ... and Asn-tRNAAsn:L-glutamine amido-ligase (ADP-forming). This enzyme participates in glutamate metabolism and alanine and ...
  https://en.wikipedia.org/wiki/Asparaginyl-tRNA_synthase_(glutamine-hydrolysing)
*  Gary Schoolnik | Stanford Medicine Profiles
Precursor RNAs are retained in the nucleus, while processed messenger RNA, transfer RNA and ribosomal subunits are transported ... An interresidue NOE between the alpha-carbon protons of Asn-12 and Gly-17 indicates that the molecule folds back on itself. The ... RNA levels for the ferritin homologue gene were significantly lower in culture sediments. The stable structural RNA, however, ... RNA blotting and cDNA cloning demonstrate that the L11 gene is expressed not only in the abdominal ganglion but in the head ...
  https://med.stanford.edu/profiles/gary-schoolnik
*  HRBL - Wikipedia
... which mediates the nucleocytoplasmic transfer of proteins and RNAs. Alternatively spliced variants which encode different ... and four asn-pro-phe (NPF) motifs. This protein interacts with Eps15 homology (EH) domains and plays a role in the Rev export ...
  https://en.wikipedia.org/wiki/HRBL
*  TRNAG-UCC transfer RNA glycine (anticodon UCC) [Phascolarctos cinereus (koala)] - Gene - NCBI
transfer RNA glycine (anticodon UCC). Gene type. tRNA. RefSeq status. MODEL. Organism. Phascolarctos cinereus Lineage. ... TRNAG-UCC transfer RNA glycine (anticodon UCC) [ Phascolarctos cinereus (koala) ] Gene ID: 110210044, updated on 12-May-2017 ... Model RNAs and proteins are also reported here.. Reference phaCin_unsw_v4.1 Primary Assembly. Genomic * NW_018343984.1 ...
  https://www.ncbi.nlm.nih.gov/gene/110210044
*  trnag-ucc transfer RNA glycine (anticodon UCC) [Lates calcarifer (barramundi perch)] - Gene - NCBI
transfer RNA glycine (anticodon UCC). Gene type. tRNA. RefSeq status. MODEL. Organism. Lates calcarifer Lineage. Eukaryota; ... trnag-ucc transfer RNA glycine (anticodon UCC) [ Lates calcarifer (barramundi perch) ] Gene ID: 108898418, updated on 5-Aug- ... Model RNAs and proteins are also reported here.. Reference ASM164080v1 Primary Assembly. Genomic * NW_017365952.1 Reference ...
  https://www.ncbi.nlm.nih.gov/gene/108898418
*  A complete mitochondrial genome sequence of the wild two-humped camel (Camelus bactrianus ferus): an evolutionary history of...
Transfer RNA genes. We identified 22 tRNA genes in mtDNA of the wild camel; 21 of them were predicted capable of folding into ... The secondary structure of tRNAAsn was shown (bold) as an example for the cloverleaf structure that usually has 7 bp in the ... Lowe TM, Eddy SR: tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. ... Ojala D, Montoya J, Attardi G: tRNA punctuation model of RNA processing in human mitochondria. Nature. 1981, 290 (5806): 470- ...
  https://bmcgenomics.biomedcentral.com/articles/10.1186/1471-2164-8-241
*  Sequencing of the complete mitochondrial genome of a fish-parasitic flatworm Paratetraonchoides inermis (Platyhelminthes:...
Transfer RNA genes. All 22 standard tRNAs were found (Table 1), and most of them exhibited the conventional cloverleaf ... Leu2 and Asn in Fig. 3), whereas three codons mainly composed of G + C (CGC, GCG and CUG) were not found at all. This all ... The only molecular marker used so far to study the phylogenetics of DTCG was 18S ribosomal RNA [11]. This marker produced a ... 18S ribosomal RNA sequences produced a topology in which capsalids were phylogenetically closer to gyrodactylids than ...
  https://parasitesandvectors.biomedcentral.com/articles/10.1186/s13071-017-2404-1
*  Plus it
Glu-transfer RNA reductase, Protochlorophyllide oxidoreductase, Chlorophyllide b reductase) was altered in the rice Cga1 ... Asn synthetase, indole-3-glycerol phosphate synthase, and D3 phosphoglycerate dehydrogenase, involved in the synthesis of N- ... RNA interference. Fd. ferredoxin-dependent. GS. Gln synthetase. qRT. quantitative reverse transcription. IKI. Lugol's iodine. ... Labeled copy RNA, synthesized from the cDNA, was hybridized to the Affymetrix rice whole-genome array. Data analysis was ...
  http://www.plantphysiol.org/content/162/1/132
*  Asparagine-tRNA ligase - Wikipedia
... asparaginyl transfer RNA synthetase, asparaginyl transfer ribonucleic acid synthetase, asparagyl-transfer RNA synthetase, and ... Asn), whereas its 3 products are AMP, diphosphate, and L-asparaginyl-tRNA(Asn). This enzyme belongs to the family of ligases, ...
  https://en.wikipedia.org/wiki/Asparagine%E2%80%94tRNA_ligase
*  An Evolutionarily Conserved Signaling Mechanism Mediates Far-Red Light Responses in Land Plants | Plant Cell
... the cultures were harvested and RNA was extracted using the RNeasy Plant Mini Kit (Qiagen). Total RNA (0.5 to 1 µg) was treated ... At the end of the light period on the 7th day, the samples were transferred to darkness for 5 d. After incubation in R or FR ... The expression levels of FNR, ASN, and COL2 were normalized to the levels of 26S rRNA. Expression levels in darkness were set ... RNA Extraction and RT-PCR Analyses. P. patens protonemata liquid cultures were inoculated onto cellophane sheets placed on ...
  http://www.plantcell.org/content/25/1/102?keytype=ref&ijkey=ucnf57YoL8DiLME
*  CYCLIC AMP PHOSPHODIESTERASE 4D7 ISOFORMS AND METHODS OF USE - Memory Pharmaceuticals Corporation
RNA) encoding such polypeptides, are disclosed. Also disclosed are methods for ... transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination. ... residue 4 can be Asp or Asn, residue 8 can be Val or Leu, residue 23 can be Cys or Ser, residue 25 could be Glu or Asp, residue ... polyadenylated RNA, total RNA, single strand or double strand RNA, or the like. DNA/RNA duplexes are also encompassed by the ...
  http://www.freepatentsonline.com/y2005/0289660.html
*  DEFERRED APPENDIX, volume 3 of 5, on behalf of Appellant Australian Society Of Authors Limited, Australian Society Of Authors...
Smalheiser, N. R. (2007) Exosomal transfer of proteins and RNAs at synapses in the nervous system. Biology Direct 2:35. 77. ... ASN Neuro 2(1):art:e00028. 87. Cohen, A.M., Adams, C.E., Davis, J.M., Yu, C., Yu, P.S., Meng, W., Duggan, L., McDonagh, M., and ... Chicago Biomedical Consortium, RNA Symposium, June 2007. Chicagoland RNA Club, Feburary 2008. Merck Serono (Research Knowledge ... RNA; Trends in Genetics; Wiley Interdisciplinary Reviews: RNA.  Informatics Journals: Annual Review of Information Science and ...
  https://docs.justia.com/cases/federal/appellate-courts/ca2/12-4547/222
*  Patent US6391637 - Use of CD40 ligand, a cytokine that binds CD40, to stimulate hybridoma cells - Google Patents
125 Ala Asn Ser Asn Ala Ala Ser Val Leu Gln Trp Ala Lys Lys Gly Tyr 130 135 140 Tyr Thr Met Lys Ser Asn Leu Val Met Leu Glu Asn ... The RNA-cDNA hybrids were then converted into double-stranded cDNA fragments using RNAase H in combination with DNA polymerase ... The supernatants are then subjected to dot blot or gel electrophoresis followed by transfer of the electrophoresed proteins for ... 80 Leu Leu Asn Cys Glu Glu Met Arg Arg Gln Phe Glu Asp Leu Val Lys 85 90 95 Asp Ile Thr Leu Asn Lys Glu Glu Lys Lys Glu Asn Ser ...
  http://www.google.com.au/patents/US6391637
*  List of MeSH codes (D13) - Wikipedia
... rna, transfer, ala MeSH D13.444.735.757.700.075 --- rna, transfer, arg MeSH D13.444.735.757.700.085 --- rna, transfer, asn MeSH ... rna, transfer, cys MeSH D13.444.735.757.700.400 --- rna, transfer, gln MeSH D13.444.735.757.700.410 --- rna, transfer, glu MeSH ... rna, transfer, his MeSH D13.444.735.757.700.480 --- rna, transfer, ile MeSH D13.444.735.757.700.500 --- rna, transfer, leu MeSH ... rna, transfer, met MeSH D13.444.735.757.700.650 --- rna, transfer, phe MeSH D13.444.735.757.700.660 --- rna, transfer, pro MeSH ...
  https://en.wikipedia.org/wiki/List_of_MeSH_codes_(D13)
*  Plus it
... the transfer of a high mannose oligosaccharide from a lipid-linked oligosaccharide donor to an asparagine residue within an Asn ... RNA-mediated gene silencing.. MOV101,3,4 is required for RNA-mediated gene silencing by the RNA-induced silencing complex (RISC ... RNA editing.. ADAR1 catalyzes the hydrolytic deamination of adenosine to inosine in double-stranded RNA, referred to as A-to-I ... RNA helicases.. DDX182 encodes an RNA helicase that is activated by Myc protein. ...
  http://physiolgenomics.physiology.org/content/48/4/290
*  From Gene to Protein How Genes Work - ppt video online download
40 Transfer RNA structure. "Clover leaf" structure anticodon on "clover leaf" end amino acid attached on 3 end ... TACGCACATTTACGTACGCGG DNA 4 ATCG AUGCGUGUAAAUGCAUGCGCC mRNA 4 AUCG ? Met Arg Val Asn Ala Cys Ala protein 20 How can you code ... 17 RNA polymerases 3 RNA polymerase enzymes RNA polymerase 1. only transcribes rRNA genes makes ribosomes RNA polymerase 2 ... Match RNA bases to DNA bases on one of the DNA strands C U G A G U G U C U G C A A C U A A G C RNA polymerase U 5' A 3' G A C C ...
  http://slideplayer.com/slide/273626/
*  IGF1R (insulin-like growth factor 1 receptor)
Precursor chains include a 30-amino acid leader peptide rich in hydrophobic residues, which is involved in the transfer of the ... Asn-X-Ser/Thr motifs). The cysteine-rich domain of the IGF1R is important for high-affinity IGF1 binding. The ® subunit ... DNA/RNA. Description. The IGF1R gene contains 21 exons spanning approximately 100-kb of genomic DNA. ... Inside this catalytic region there is a glycine-rich conserved element that participates in the transfer of the phosphate ...
  http://atlasgeneticsoncology.org/Genes/IGF1RID40928ch15q26.html
*  Frontiers | Exosomes As Potential Biomarkers and Targeted Therapy in Colorectal Cancer: A Mini-Review | Pharmacology
2016). Circular RNAs are down-regulated in KRAS mutant colon cancer cells and can be transferred to exosomes. Sci. Rep. 6:37982 ... doi: 10.1681/ASN.2012101031. PubMed Abstract , CrossRef Full Text , Google Scholar. Chen, Y., Xie, Y., Xu, L., Zhan, S., Xiao, ... Circular RNAs (circRNAs) are a set of non-coding RNAs that are covalently closed from the 5′ end to the 3′ end (Abu and Jamal, ... 2015). Circular RNA is enriched and stable in exosomes: a promising biomarker for cancer diagnosis. Cell Res. 25, 981-984. doi ...
  https://www.frontiersin.org/articles/10.3389/fphar.2017.00583/full
*  Frontiers | mADP-RTs: versatile virulence factors from bacterial pathogens of plants and mammals | Plant Science
... and its subsequent transfer onto an amino acid of the target protein (often Cys, Arg, Asn, or Diphthamide - a modified form of ... HopU1: Targeting RNA-Binding Proteins. The effector HopU1 from Pseudomonas syringae strain DC3000 is delivered through the T3SS ... Transfer of an ADP-ribose moiety onto the GSα subunit of heteromeric G proteins by cholera toxin (CT) results in constitutive ... One of these RNA binding proteins, GRP7, regulates circadian mRNA oscillations and is also required for immunity towards P. ...
  https://www.frontiersin.org/articles/10.3389/fpls.2012.00142/full
*  Patent US6184020 - Polypeptides having aminopeptidase activity and nucleic acids encoding same - Google Patents
575 Met Ala Val Asn Gly Asp Ala Tyr Asp Ala Asp Lys Leu Lys Gly Ala 580 585 590 Ile Thr Asn Ala Lys Thr Gly Asn Pro Gly Ala Gly ... Both DNA and RNA probes can be used. The probes are typically labeled for detecting the corresponding gene (for example, with ... DNA from the libraries or the separated DNA may be transferred to and immobilized on nitrocellulose or other suitable carrier ... 255 Ala Asp Lys Pro Glu Leu Leu Ala Ile Lys Pro Glu Asn Leu Ala Ala 260 265 270 Tyr Arg Asn Leu Ala Asp Glu Ala Val Gly Ala Phe ...
  http://www.google.com/patents/US6184020?dq=6377161
*  Patent US5223482 - Recombinant Alzheimer's protease inhibitory amyloid protein and method of use - Google Patents
RNA was fractionated by oligo-dT cellulose chromatography, electrophoresed on a formaldehyde agarose gel, and blot-transferred ... 9D) utilizing E. coli preferred codon choice for highly expressed genes, and a hydroxylamine cleavage site (Asn-Gly) was ... cytoplasmic RNA from HeLa cells; (6) total RNA from HL-60 cells (ATCC #CCL240), a promyelocytic leukemia; (7) total RNA from HL ... total RNA from normal cerebellum samples; (9) total RNA from nornal from normal cerebellum samples; (10) total RNA from an ...
  http://www.google.com/patents/US5223482?dq=oakley+5,387,949
*  Publications | Reich Research Group - UC Santa Barbara
The modified nucleosides N-2-methylguanosine and N-2(2)-dimethylguanosine in transfer RNA occur at five positions in the D and ... Furthermore, the conserved residues (Arg(95), Asn(126), Asn(132), and Arg(116)) repress the modulation of the response of the ... scaffold RNA); the other without biotin as functional RNA (i.e., siRNA). Initially, flexible single-stranded RNA is used for ... Here, we describe two modes of RNA regulation of DNMT3A in vitro. We show a single-stranded RNA molecule that is antisense to ...
  http://www.chem.ucsb.edu/reichgroup/publications
*  The complete mitochondrial genome of Anoplocephala perfoliata, the first representative for the family Anoplocephalidae |...
Ribosomal RNA and transfer RNA genes. The two ribosomal RNA genes, rrnS and rrnL, were predicted from the mt genome of A. ... The complete mtDNA genome contains 36 genes, including 12 protein-coding genes, two ribosomal RNA genes and 22 transfer RNA ... 2 ribosomal and 22 transfer RNA genes [15], but lack the atp8 gene. In general, the mitochondrial gene order is rather stable ... Transfer RNA (tRNA) genes were annotated using tRNAscan-SE, combining with recognizing anticodon sequences and potential ...
  https://parasitesandvectors.biomedcentral.com/articles/10.1186/s13071-015-1172-z