*  Piromyces - Wikipedia
Piromyces is a genus of fungi in the family Neocallimastigaceae. Piromyces sp. E2 is an eukaryotic species belonging to the ... "Piromyces sp. E2 JGI Genome Project". genome.jgi.doe.gov. Retrieved 2017-06-24. Piromyces in Index Fungorum. ...
*  Mannan endo-1,4-beta-mannosidase C (P55298) | InterPro | EMBL-EBI
InterPro provides functional analysis of proteins by classifying them into families and predicting domains and important sites. We combine protein signatures from a number of member databases into a single searchable resource, capitalising on their individual strengths to produce a powerful integrated database and diagnostic tool.
*  RCSB PDB - 1GWL: Carbohydrate binding module family29 complexed with mannohexaose Literature Report Page
The Three-Dimensional Structure of a Piromyces Carbohydrate-Binding Module,Cbm29-2,in Complex with Cello- and Mannohexaose ... Piromyces equi Fragment: CARBOHYDRATE BINDING MODULE FAMILY 29 RESIDUES 335-478 Gene Name(s): ncp1 ...
*  Screening and evolution of a novel protist xylose isomerase from the termite Reticulitermes speratus for efficient xylose...
... to the Piromyces XI. The Clostridium XI was reported to be less inhibited by xylitol compared to the Piromyces XI [12]. ... strain E2, isolated from the feces of an Indian elephant [13, 28]. The Piromyces XI gene was overexpressed in a S. cerevisiae ... RsXI-C1, novel XI cloned from the cDNA library of symbiotic protists of R. speratus; PiXI, XI of Piromyces sp. E2; CpXI, XI of ... The XIs from the Fungi family, including those from Piromyces sp. E2, were close to this phylum. However, RsXI-C1, RsXI-C2, ...
*  Functional characterization of cellulases identified from the cow rumen fungus Neocallimastix patriciarum W5 by transcriptomic...
The mass data showed that the protein sequences of the Cel48A, Cel9A and BGLU precursors as well as BGLU Cel1C from Piromyces ... The major component of the cellulosomes of anaerobic fungi from the genus Piromyces is a family 48 glycoside hydrolase. DNA Seq ...
*  Orpinomyces - Wikipedia
Barr DJ, Kudo H, Jakober KD, Cheng KJ (1989). "Morphology and development of rumen fungi: Neocallimastix sp., Piromyces ...
*  BigEasy v2.0 Linear Cloning System (pJAZZ Vectors)
Figure 6. Piromyces genomic DNA (85% AT) cloned in the pJAZZ vector. This DNA was unclonable in all other vectors. ... Figure 2. Sequence trace of a Piromyces clone, showing extremely high (96%) AT content (see figure 3d). ...
*  Frontiers | Microbial trophic interactions and mcrA gene expression in monitoring of anaerobic digesters | Microbiology
Neocallimastix sp., is one the most studied anaerobic fungi in rumen, which also include Orpimomyces, Anaeromyces, Piromyces, ...
*  Serpin - Wikipedia
A single fungal serpin has been characterized to date: celpin from Piromyces spp. strain E2. Piromyces is a genus of anaerobic ... "A serpin in the cellulosome of the anaerobic fungus Piromyces sp. strain E2". Mycological Research. 112 (Pt 8): 999-1006. doi: ...
*  Carbohydrate-binding module - Wikipedia
More recently, anaerobic fungi, typified by Piromyces equi, have been suggested to also synthesise a cellulosome complex, ... "Characterization of a cellulosome dockerin domain from the anaerobic fungus Piromyces equi". Nat. Struct. Biol. 8 (9): 775-8. ...
*  Mapping the membrane proteome of anaerobic gut fungi identifies a wealth of carbohydrate binding proteins and transporters |...
12934_2016_611_MOESM6_ESM.txt Additional file 6: Table S3. Annotation of the Piromyces finnis transcriptome. ... 12934_2016_611_MOESM5_ESM.fa Additional file 5: Database 3. The assembled transcriptome for Piromyces finnis. ... Three novel gut fungal species from distinct genera of Neocallimastigomycota (Piromyces finnis, Anaeromyces robustus, and ... and Piromyces finnis (P. finnis) from horse [26]. To assemble a complete transcriptome, RNA was collected from each strain ...
*  Fungi facts, information, pictures | Encyclopedia.com articles about Fungi
Other chytrids are host-specific "rumen fungi" (such as Piromyces communis ) that thrive in anaerobic conditions in the guts of ...
*  Taxonomy Table for Fungal Genomes - Fungal Genomics
Piromyces rhizinflata YM600 -,Mucoromycotina subphylum (was Zygomycota) -,Incertae sedis -,Mucorales Phycomyces blakesleeanus ...
*  Taxonomy Table for Fungal Genomes - Fungal Genomics
NOTE: This tree is based on information from the NCBI Taxonomy Browser, MycoBank and Index Fungorum. For the species shown in bold, the genome sequence is already publicly available (or will be soon). ...
... isomerase Piromyces sp. E2 mRNA for xylose isomerase (xylA gene)(5-1318) GTAAATGGCTAAGGAATATTTCCCACAAATTCAAA ...
*  Jindřich Procházka - Ústav technologie vody a prostředí
and Piromyces sp.) were chosen. These strains showed the best abilities to degrade organic matter and to grow on plant matter ... a Piromyces sp.). Tyto houby ukázaly nejlepší schopnost rozkládat organickou hmotu a růst na rostlinných substrátech v ...
*  Taxonomy Table for Fungal Genomes - Fungal Genomics
Piromyces rhizinflata YM600 -,Zygomycota -,Incertae sedis -,Mucorales Phycomyces blakesleeanus NRRL1555 Rhizomucor miehei CBS ...
*  Detergent Compositions Containing Bacillus Agaradhaerens Mannanase and Methods of Use Thereof - Patent application
118: 17-34), Piromyces sp. mannanase (See, Fanutti et al.,. [1995] J. Biol. Chem. 270(49): 29314-29322), Pomacea insulars ...
*  The [FeFe] hydrogenase of Nyctotherus ovalis has a chimeric origin | Springer for Research & Development
Block 2 marks the long-type hydrogenases from the anaerobic chytridiomycetes Neocallimastix and Piromyces and the (short) ... The anaerobic chytridiomycete fungus Piromyces sp. E2 produces ethanol via pyruvate:formate lyase and an alcohol dehydrogenase ...
*  Xylose metabolism - Wikipedia
... but a xylose isomerase from the anaerobic fungus Piromyces Sp. has proven effective. One advantage claimed for S. cerevisiae ...
*  List of sequenced fungi genomes - Wikipedia
Piromyces sp. E2 (Neocallimastigomycota) (2011) Anaeromyces sp. S4 Neocallimastix sp. G1 Orpinomyces sp. C1A Encephalitozoon ... Origins of Multicellularity Database Catenaria anguillulae at JGI Piromyces sp. at JGI Katinka MD, Duprat S, Cornillot E, ...