*  Scientist Solutions - Gene Silencing
Antisense / Morpholinos. Small RNA triggers, oligos, activity, controls, quantitation . . . 190 48 78184 Longitudinal effect on ...
  http://scientistsolutions.azurewebsites.net/c585-gene+silencing+.html
*  References - Muscular Dystrophy - Fitness VIP
Wu, B., Li, Y., Morcos, P., Doran, T., Lu, P., Lu, Q. (2009). Octa-guanidine morpholino restores dystrophin expression in ... Gebski, B.L., Mann, C.J., Fletcher, S., and Wilton, S.D. (2003). Morpholino antisense oligonucleotide induced dystrophin exon ... Arora, V., Devi, G.R., and Iversen, P.L. (2004). Neutrally charged phosphorodiamidate mor-pholino antisense oligomers: uptake, ... 2006). Inhibition of coxsackievirus B3 in cell cultures and in mice by peptide-conjugated morpholino oligomers targeting the ...
  https://www.fitness-vip.com/muscular-dystrophy/references-atg.html
*  Sarepta's Ebola Drug Safe and Well Tolerated in Phase I Study
Safety and Pharmacokinetic Profiles of Phosphorodiamidate Morpholino Oligomers with Activity against Ebola Virus and Marburg ... Heald et al report on the safety and pharmacokinetic properties of combination phosphorodiamidate morpholino oligomers (PMOs) ...
  http://www.raredr.com/news/sarepta-ebola-drug-safe-phase-i
*  Antibiotic Resistance Just Became More Complex | Department of Microbiology | Oregon State University
The molecule is a PPMO, short for peptide-conjugated phosphorodiamidate morpholino oligomer. The enzyme it combats is known as ... The molecule is a PPMO, short for peptide-conjugated phosphorodiamidate morpholino oligomer. The enzyme it combats is known as ... The molecule is a PPMO, short for peptide-conjugated phosphorodiamidate morpholino oligomer. The enzyme it combats is known as ... More information: Erin K. Sully et al, Peptide-conjugated phosphorodiamidate morpholino oligomer (PPMO) restores carbapenem ...
  http://microbiology.science.oregonstate.edu/story/antibiotic-resistance-just-became-more-complex
*  Search Morpholino
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari. ...
  http://www.xenbase.org/reagents/searchMorpholino.do?beginIndex=51¤tPage=6&resultsPerPage=10&method=search&searchIn=4&searchType=starts%20with&searchValue=M
*  Xenbase Morpholino: map2k5 MO1
Morpholino Name: map2k5 MO1 Synonyms: MEK5 MO mRNA Target: map2k5 Morpholino Type: Sequence:. 5' CAGGCCGAAGCCAAATAACAGCATC 3' ...
  http://www.xenbase.org/reagents/displayMorpholino.do?featureId=17249869
*  Xenbase Morpholino: fbxl14 MO1
Morpholino Name: fbxl14 MO1 Synonyms: Ppa MO mRNA Target: fbxl14 Morpholino Type: Sequence:. 5' AGACACGAGATGTGGGTCTCCATAG 3' ...
  http://www.xenbase.org/reagents/displayMorpholino.do?featureId=17249485
*  Xenbase Morpholino: mga MO2
Morpholino Name: mga MO2 Synonyms: TEgg085b11, Xtnoveltbox.2 mRNA Target: mga Morpholino Type: Sequence:. 5' ... Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]. ...
  http://www.xenbase.org/reagents/displayMorpholino.do?featureId=17311441
*  Xenbase Morpholino: brwd3 MO1
XB-MORPHOLINO-17311432. Morpholino Name: brwd3 MO1 Synonyms: TEgg035m22, Xtnovel56 mRNA Target: brwd3 Morpholino Type: Sequence ... Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]. ...
  http://www.xenbase.org/reagents/displayMorpholino.do?featureId=17311432
*  Xenbase Morpholino: yap1 MO7
XB-MORPHOLINO-17326553. Morpholino Name: yap1 MO7 Synonyms: mRNA Target: yap1 Morpholino Type: Sequence:. 5' ...
  http://www.xenbase.org/reagents/displayMorpholino.do?featureId=17326553
*  Xenbase Morpholino: sall4 MO1
Morpholino Name: sall4 MO1 Synonyms: mRNA Target: sall4 Morpholino Type: Sequence:. 5' GCCAATTATTCCCTTTCTCCACCAC 3' Source: ...
  http://www.xenbase.org/reagents/displayMorpholino.do?featureId=17328744
*  Xenbase Morpholino: ift52 MO1
XB-MORPHOLINO-17249747. Morpholino Name: ift52 MO1 Synonyms: IFT52 mRNA Target: ift52 Morpholino Type: Sequence:. 5' ...
  http://www.xenbase.org/reagents/displayMorpholino.do?featureId=17249747
*  Xenbase Morpholino: ngfr MO1
Morpholino Name: ngfr MO1 Synonyms: Fullback, TGas034n12, XT NRH1 mRNA Target: ngfr Morpholino Type: Sequence:. 5' ... Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]. ...
  http://www.xenbase.org/reagents/displayMorpholino.do?featureId=17249978
*  Molecules | Free Full-Text | Gene Knockdowns in Adult Animals: PPMOs and Vivo-Morpholinos
Techniques developed with PPMOs, which are an arginine-rich cell-penetrating peptide linked to a Morpholino oligo, can also be ... which are eight guanidinium groups on a dendrimeric scaffold linked to a Morpholino oligo. Antisense-based techniques such as ... maturation and inhibiting viral replication can be conveniently applied in adult animals by injecting PPMOs or Vivo-Morpholinos ... Gene Knockdowns in Adult Animals: PPMOs and Vivo-Morpholinos. Jon D. Moulton * and Shan Jiang ...
  http://www.mdpi.com/1420-3049/14/3/1304
*  Alpha-morpholino ribonucleoside derivatives and polymers thereof - Anti-Gene Development Group
Alpha-morpholino subunits and polymer compositions composed of alpha-morpholino subunits are disclosed. These subunits can be ... 5'OH morpholino subunits of C, U, and G protected on the morpholino ring nitrogen are prepared as in Example 3. The U subunit ... Whether the morpholino subunit is linked to the support via its morpholino nitrogen or a group at the 5' position depends on ... 1 shows the morpholino ring structures on which the polymer subunits are based, where the morpholino carbon atoms are numbered ...
  http://www.freepatentsonline.com/5235033.html