*  KEGG PATHWAY: Terpenoid backbone biosynthesis - Mobiluncus curtisii
Terpenoid backbone biosynthesis - Mobiluncus curtisii [ Pathway menu , Organism menu , Pathway entry , Download KGML , Show ...
  http://www.genome.jp/kegg-bin/show_pathway?mcu00900
*  UniProt: D6ZJW0 MOBCV
"Complete sequence of Mobiluncus curtisii ATCC 43063."; RL Submitted (MAR-2010) to the EMBL/GenBank/DDBJ databases. CC -!- ... Mobiluncus. OX NCBI_TaxID=548479 {ECO:0000313,EMBL:ADI67009.1, ECO:0000313,Proteomes:UP000006742}; RN [1] {ECO:0000313, ... Mobiluncus curtisii (strain ATCC 43063 / DSM 2711 / V125) (Falcivibrio OS vaginalis). OC Bacteria; Actinobacteria; ...
  http://www.genome.jp/dbget-bin/www_bget?uniprot:D6ZJW0_MOBCV
*  Mobiluncus - Wikipedia
Mobiluncus is a genus of Gram-negative, anaerobic, rod-shaped bacteria. While this species possesses a cell wall with ... Schwebke JR, Lawing LF (April 2001). "Prevalence of Mobiluncus spp among women with and without bacterial vaginosis as detected ...
  https://en.wikipedia.org/wiki/Mobiluncus
*  Mobiluncus mulieris Spiegel and Roberts ATCC ® 35240D-5™
Genomic DNA from Mobiluncus mulieris strain BV 64-5 TypeStrain=False Application: ... nov., Mobiluncus curtisii subsp. curtisii sp. nov., Mobiluncus curtisii subsp. holmesii subsp. nov., and Mobiluncus mulieris sp ... Mobiluncus mulieris Spiegel and Roberts (ATCC® 35240D-5™) Strain Designations: Genomic DNA from Mobiluncus mulieris strain BV ... Genomic DNA from Mobiluncus mulieris strain BV 64-5 [ATCC® 35240™] Biosafety Level 1 Biosafety classification is based on U.S. ...
  https://www.atcc.org/Products/All/35240D-5.aspx?p=1&rel=%7B0%7D&slp=1
*  Mobiluncus mulieris Spiegel and Roberts ATCC ® 35240D-5™
Genomic DNA from Mobiluncus mulieris strain BV 64-5 TypeStrain=False Application: ... nov., Mobiluncus curtisii subsp. curtisii sp. nov., Mobiluncus curtisii subsp. holmesii subsp. nov., and Mobiluncus mulieris sp ... Mobiluncus mulieris Spiegel and Roberts (ATCC® 35240D-5™) Strain Designations: Genomic DNA from Mobiluncus mulieris strain BV ... Mobiluncus mulieris Spiegel and Roberts ATCC® 35240D-5™ dried Total DNA: At least 5 µg in 1X TE buffer.. OD260/OD280: 1.6 to ...
  https://www.atcc.org/en/Global/Products/0/1/6/9/35240D-5.aspx
*  Recovery of Mobiluncus curtisii subspecies holmesii from mixed non-puerperal breast abscess | SpringerLink
nov.,Mobiluncus curtisii subsp.Curtisii sp. nov.,Mobiluncus curtisii subsp.holmesii subsp. nov., andMobiluncus mulieris sp. nov ... Recovery ofMobiluncus curtisii subspeciesholmesii from mixed non-puerperal breast abscess. ... Spiegel, C. A., Roberts, M. Mobiluncus gen. ...
  https://link.springer.com/article/10.1007/BF01963461
*  Mobiluncus mulieris - Wikipedia
nov., Mobiluncus curtisii subsp. curtisii sp. nov., Mobiluncus curtisii subsp. holmesii subsp. nov., and Mobiluncus mulieris sp ... LPSN Mobiluncus mulieris at the Encyclopedia of Life Type strain of Mobiluncus mulieris at BacDive - the Bacterial Diversity ... "Antigenic distinctiveness of Mobiluncus curtisii and Mobiluncus mulieris." Journal of Clinical Microbiology 21.6 (1985): 891- ... Transfer of members of the genus Falcivibrio to the genus Mobiluncus, and emended descriptions of the genus Mobiluncus. Syst. ...
  https://en.wikipedia.org/wiki/Mobiluncus_mulieris
*  Bacteria (Example) - MindMeister
Mobiluncus. 6.7. Eubacterium. 7. Aerobic Gram Positive Rod. 7.1. Mycobacterium. 7.1.1. M.tuberculosis. 7.1.2. M.leprae. 7.1.3. ...
  https://www.mindmeister.com/78755453/bacteria
*  SV 175 Strain Passport - StrainInfo
nov., Mobiluncus curtisii subsp. curtisii sp. nov., Mobiluncus curtisii subsp. holmesii subsp. nov., and Mobiluncus mulieris sp ... Mobiluncus mulieris ATCC 35243 contig00161, whole genome shotgun sequence. ATCC 35243 T ... Mobiluncus mulieris ATCC 35243 contig00159, whole genome shotgun sequence. ATCC 35243 T ... Mobiluncus mulieris ATCC 35243 contig00158, whole genome shotgun sequence. ATCC 35243 T ...
  http://www.straininfo.net/strains/15163
*  NHANES 2003-2004: Bacterial vaginosis (BV) & Trichomonas vaginalis Data Documentation, Codebook, and Frequencies
Finally, the amount of Mobiluncus morphotypes present was quantitated. They are often thin, wispy, eyelash-like faintly ...
  https://wwwn.cdc.gov/Nchs/Nhanes/2003-2004/L34_C.htm
*  Clindesse (Clindamycin Phosphate): Side Effects, Interactions, Warning, Dosage & Uses
Mobiluncus spp.. Mycoplasma hominis Peptostreptococcus spp. Standard methodology for the susceptibility testing of the ...
  https://www.rxlist.com/clindesse-drug.htm
*  Clindamax - FDA prescribing information, side effects and uses
Mobiluncus spp., or Mycoplasma hominis, has not been defined. Nonetheless, clindamycin is an antimicrobial agent active in ...
  https://www.drugs.com/pro/clindamax.html
*  Oral HPV type 31 killing my spirit - Human Papillomavirus (HPV) - MedHelp
Mobiluncus sp. Atopobium sp. Prevotella sp. Garderella vaginalis They have a standard way to tell if there is actually a STI. ... Mobiluncus sp. Atopobium sp. Prevotella sp. Garderella vaginalis They have a standard way to tell if there is actually a STI. ...
  https://www.medhelp.org/posts/Human-Papillomavirus-HPV/Oral-HPV-type-31-killing-my-spirit/show/1917393
*  Vandazole (Metronidazole Vaginal Gel): Side Effects, Interactions, Warning, Dosage & Uses
Mobiluncus spp.. Peptostreptococcus spp. Standard methodology for the susceptibility testing of the potential bacterial ... vaginosis pathogens, Gardnerella vaginalis and Mobiluncus spp., has not been defined. Culture and sensitivity testing of ...
  https://www.rxlist.com/vandazole-drug.htm
*  Frontiers | Vaginal biogenic amines: biomarkers of bacterial vaginosis or precursors to vaginal dysbiosis? | Physiology
Additionally, available Mobiluncus spp. genomes did not encode a homolog of the choline trimethylamine-lyase required for the ... and cadaverine and between both Mobiluncus spp. and Anaeroglobus spp. with putrescine. Macklaim et al. (2013) in their recent ... Cruden and Galask, 1988). To reconcile this discrepancy, we more intensively examined the genomes of the vaginal Mobiluncus ... Broader searches among all available sequences from the Mobiluncus genus also did not reveal any candidate homologs. ...
  https://www.frontiersin.org/articles/10.3389/fphys.2015.00253/full
*  Free Medical Flashcards about Micro 5-2
Why are mobiluncus and gardnerella gram positive? Gram positive cell wall, antibiotic susceptibility similar to Gram positive, ... How do mobiluncus and gardnerella appear on Gram stain? Gram negative or Gram variable ... How are mobiluncus and gardnerella classified (gram negative or positive)? gram positive ... Where do mobiluncus and garnerella colonize in large numbers? female genital tract ...
  https://www.studystack.com/flashcard-283913
*  Bacterial Vaginosis
Mobiluncus species. *Mycoplasma hominis. *Symptoms. *Often asymptomatic, or mild. *Musty or fishy odor to genitalia or Vaginal ...
  http://www.fpnotebook.com/legacy/Gyn/ID/BctrlVgns.htm
*  Utility of Amsel Criteria, Nugent Score, and Quantitative PCR for Gardnerella vaginalis, Mycoplasma hominis, and Lactobacillus...
previously reported on a multiplex PCR method of diagnosing BV via quantifying Mobiluncus mulieris, Mobiluncus curtisii, ... Mobiluncus spp. morphotypes; scored as 0 to 2) and can range from 0 to 10. A score of 7 to 10 is consistent with BV. ... Mobiluncus spp., Peptostreptococcus spp., or Ureaplasma urealyticum (4, 8). The addition of one or more of these bacteria to ... Mobiluncus species, and anaerobic gram-negative rods (14). BV has been associated with preterm delivery, chorioamnionitis, ...
  http://pubmedcentralcanada.ca/pmcc/articles/PMC1234056/?lang=en-ca
*  US Patent # 5,776,694. Diagnostic kits useful for selectively detecting microorganisms in samples - Patents.com
for Mobiluncus curtesii complex MSP003: 5'ACC-ATC-AAC-ACA-CCC-AAA-AGC-ATG-CCT-TT3' (SEQ ID NO:34) for Mobiluncus mulieris ... for Mobiluncus curtesii complex 5'ACCATCAACACAGCCAAAACTGTGCCTT3' for Mobiluncus mulieris 5'ACCATCAACACACCCAAAAGCATGCCTTT3' for ... The adherent cells include G. vaginalis, and other anaerobic species including, for example, Mobiluncus species. Another ... Additionally, Prevotella bivia, Ureaplasma urealyticum, Mobiluncus species, Mycoplasma species, Neisseria gonorrhea, ...
  http://patents.com/us-5776694.html