Methanospirillum. Medical search. Web

ISBN 978-0-387-98771-2. PubMed references for Methanospirillum PubMed Central references for Methanospirillum Google Scholar ... references for Methanospirillum NCBI taxonomy page for Methanospirillum Search Tree of Life taxonomy pages for Methanospirillum ... Search Species2000 page for Methanospirillum MicrobeWiki page for Methanospirillum LPSN page for Methanospirillum v t e ( ... In taxonomy, Methanospirillum is a genus of microbes within the family Methanospirillaceae. All its species are methanogenic ...

https://en.wikipedia.org/wiki/Methanospirillum

Methanospirillum hungatei JF1 as the outgroup. A total of 280 sequences were used to construct a neighbor-joining phylogenetic ...

https://www.nature.com/articles/ismej2009141?error=cookies_not_supported&code=57dc1c12-f0ce-47b2-834e-b6dd133228a7

Hydrogenotrophic Methanospirillum species were the dominant methanogens in all the SCG digestion tests. It is likely that NaOH ... Methanospirillum stamsii strain ps 16S. 98.2. NR_117705. Methanospirillum. Methanospirillum lacunae strain Ki8-1. 98.2. NR_ ... Methanospirillum hungatei strain JF-1. 97.8. CP000254. Methanospirillum. Methanospirillum lacunae strain Ki8-1. 97.8. NR_112981 ... Both bands were closely related (≥97% sequence similarity) to several Methanospirillum species (Table 6). Methanogens belonging ...

https://www.mdpi.com/1996-1073/11/4/865

We also identified, purified, and characterized the major flagella protein from archaeon Methanospirillum hungatei JF1. We ... Methanospirillum hungatei. For one of these, S. wolfei, the core pathways for carbon and electron flow is depicted in Figure 1A ... previously undescribed surface layer proteins in Methanospirillum hungatgei (Figure 2A and manuscripts in preparation), and ...

https://www.doe-mbi.ucla.edu/microbes/

Methanospirillum hungatei JF-1 Archaea normal 0.0326903 normal 0.301523 -. NC_007355 Mbar_A3575 putative surface layer protein ... Methanospirillum hungatei JF-1 Archaea hitchhiker 0.0000335997 normal 0.167692 -. NC_007355 Mbar_A3737 hypothetical protein ...

https://exploration.weizmann.ac.il/perl/pandatox1_0.mperl?submit=show_homologs&locus_tag=Mhun_0597&replicon_accession=NC_007796

Host Lineage: Methanospirillum hungatei; Methanospirillum; Methanospirillaceae; Methanomicrobiales; Euryarchaeota; Archaea. ... Query: NC_007796:1731500:1758673 Methanospirillum hungatei JF-1, complete genome. Start: 1758673, End: 1759422, Length: 750. ...

http://pregi.bi.up.ac.za/pre_gi_blast.php?blast_source_accession=NC_007796&blast_cds_query=NC_007796:1731500:1758673

Methanothrix and Methanospirillum). Correspondingly, the metabolic functions of membrane transport, substrate metabolism, ...

https://pesquisa.bvsalud.org/bolivia/?lang=es&q=au:Wang,+Feng

... and emended descriptions of the genus Methanospirillum and Methanospirillum hungatei. T Iino, K Mori, K Suzuki ... Methanospirillum lacunae sp. nov., a methane-producing archaeon isolated from a puddly soil, ...

https://scholar.google.is/citations?user=69kEKaEAAAAJ&hl=en&oe=ASCII

Methanospirillum hungatei JF-1 Archaea normal 0.579359 normal 0.139276 -. NC_009092 Shew_3744 peptidase M6, immune inhibitor A ... Methanospirillum hungatei JF-1 Archaea normal 0.217586 normal 1 -. NC_007954 Sden_2272 endonuclease/exonuclease/phosphatase ...

https://exploration.weizmann.ac.il/perl/pandatox1_0.mperl?submit=show_homologs&locus_tag=Swoo_3429&replicon_accession=NC_010506

Methanospirillum hungatei JF-1. Methanothermobacter thermautotrophicus str. Delta H. Methanothermus fervidus. Moloney murine ...

https://nrdr.ncrnadatabases.org/detailsorganism.php?database=147

Methanospirillum hungatei JF-1 Position: -182. Score: 5.01997. Sequence: TACACTAACTTCAAGTAAATACT Locus tag: Mhun_0129. Name: ...

https://regprecise.lbl.gov/ort_operons.jsp?project_id=5429&ort_id=1461387

Methanospirillum, Methanobrevibacter and unassigned Methanomassilococeae). Methanosaeta; the archetypal acetoclastic methanogen ...

https://nrl.northumbria.ac.uk/id/eprint/45000/

RL18_METPE Methanospirillaceae Methanospirillum Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100... ( ... RL18_METHJ Methanospirillum lacunae (UP000245657) A0A2V2MUE4_9EURY Methanophagales Methanophagales archaeon (UP000247916) ...

https://hamap.expasy.org/signature/taxonomic_distribution/MF_01337_A

The Archaellum of Methanospirillum hungatei Is Electrically Conductive.. mBio. 10(2)*PubMed ...

https://www.micro.umass.edu/faculty-and-research/publications?s=year&%3Bamp%3Bf%5Bag%5D=T&%3Bamp%3Bf%5Bauthor%5D=917&%3Bf%5Bauthor%5D=1474&f%5Bauthor%5D=251&o=desc

The Archaellum of Methanospirillum hungatei Is Electrically Conductive.. mBio. 10(2)*PubMed ...

https://www.micro.umass.edu/faculty-and-research/publications?page=1&%3Bamp%3Bs=author&%3Bamp%3Bf%5Bag%5D=H&%3Bamp%3Bf%5Bauthor%5D=1627&%3Bf%5Bauthor%5D=1308&f%5Bauthor%5D=251&s=year&o=asc

The Archaellum of Methanospirillum hungatei Is Electrically Conductive.. mBio. 10(2)*PubMed ...

https://marlin.micro.umass.edu/faculty-and-research/publications?page=28&s=author&o=asc

Relating mRNA and protein biomarker levels in a Dehalococcoides and Methanospirillum-containing community Journal Article ...

https://experts.colorado.edu/display/meshid_G06.591.750

I decided to focus on C. botulinum B (the nasty food-poisoning organism) and the archeon Methanospirillum hungatei strain JF-1 ... Methanospirillum (a strict anaerobe found in sewage) produces colonies with characteristic striations spaced two cell-lengths ...

https://asserttrue.blogspot.com/2014/05/anaerobic-catalases-and-codon.html

Methanospirillum hungatei or Acetobacterium woodii as a partner, glycolic acid is converted to carbon dioxide and hydrogen [3]. ...

https://micrornasynthesis.com/2016/02

Methanospirillum, Methanothermobacter, Methanothermus, and Methanothermus metabolise hydrogen to produce methane biogas. ...

https://microbedetectives.com/anaerobic-digestion-dna-analysis/

Methanospirillum Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100... (UP000001941) Methanospirillum ...

https://hamap.expasy.org/signature/taxonomic_distribution/MF_04040

... for methanogenesis as suggested by the annotated sequences associated with genera fantofarone such as Methanospirillum ...

https://pkainhibitors.com/2019/12

Methanospirillum Respiratory mRNA Biomarkers Correlate with Hydrogenotrophic Methanogenesis Rate during Growth and Competition ...

https://vivo.colorado.edu/display/meshid_D13.444.735.473

Flap endonuclease 1 OS=Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1) GN=fen PE=3 SV=1. 1. ...

https://fungalgenomics.science.uu.nl/portal/hirsu2/protein/?proteinId=Hirsu2%7C198

A number of microbes, including Alcaligenes, Cellulosimicrobium, Microbacterium, Micrococcus, Methanospirillum, Aeromonas, ...

http://olmdiagnostics.com/2021/03/01/recent-advanced-technologies-for-the-characterization-of-xenobiotic-degrading-microorganisms-and-microbial-communities/

... the total population of microorganisms and is dominated by hydrogentrophic methanogens belonging to the genera Methanospirillum ... the total population of microorganisms and is dominated by hydrogentrophic methanogens belonging to the genera Methanospirillum ... población de microorganismos y está dominada por metanogénicos hidrogenotróficos pertenecientes a los géneros Methanospirillum ...

https://scholar.uprm.edu/entities/publication/1611f1a3-3463-40e5-9875-509a8a7d11b3

"The research group discovered that Methanospirillum hungatei, a microbe (methanogenic archaeon) which is thought to have ...

https://crev.info/2017/02/more-collapsed-darwinian-expectations/

011449470 394 EGCRTLINLINQWGS 408 Methanospirillum hungatei WP_010870355 398 EAFEELIGMINFFGM 412 Methanocaldococcus jannaschii ...

https://www.ncbi.nlm.nih.gov/Structure/cdd/TIGR03278

Methanococcus maripaludis and Methanospirillum hungatei, at different growth rates. Comparative whole-genome transcriptional ...

https://dnarnasynthesis-signal.com/2021/09

Organisms6

Chemicals and Drugs9

Analytical, Diagnostic and Therapeutic Techniques and Equipment5

Phenomena and Processes2

Technology, Industry, Agriculture1

Information Science1

Health Care2

Methanospirillum - Wikipedia

Comparative community genomics in the Dead Sea: an increasingly extreme environment | The ISME Journal

Energies | Free Full-Text | Effect of Mild-Temperature Thermo-Alkaline Pretreatment on the Solubilization and Anaerobic...

Microbes<...

Browse

Pre GI: BLASTP Hits

Búsqueda | BVS Bolivia

Koji Mori - Google Scholar

Browse

NRDR - The Non-coding RNA Databases Resource

Phr: Methanomicrobiales

Sewage treatment at 4 °C in anaerobic upflow reactors with and without a membrane - performance, function and microbial...

HAMAP

Publications | Department of Microbiology at UMass Amherst

Publications | Department of Microbiology at UMass Amherst

Publications | Department of Microbiology at UMass Amherst

Microbiological Phenomena - Microbial Consortia | CU Experts | CU Boulder

blogorrhea: Anaerobic Catalases and Codon Pseudodegeneracy

February | 2016 | Microrna Synthesis

Anaerobic Digestion DNA Analysis - Microbe Detectives

HAMAP

December | 2019 | PKA Inhibitors

RNA, Bacterial | CU Experts | CU Boulder

Ophiocordyceps subramaniannii

Recent Advanced Technologies for the Characterization of Xenobiotic-Degrading Microorganisms and Microbial Communities - Fungal...

Metabolic and molecular characterization of an acetate and lactate-degrading microbial consortium

More Collapsed Darwinian Expectations - CEH

CDD Conserved Protein Domain Family: methan mark 10

September | 2021 | DNA RNA synthesis Signal