... threo-Ds-isocitrate glyoxylate-lyase, and isocitrate glyoxylate-lyase. This enzyme participates in glyoxylate and dicarboxylate ... Isocitrate lyase (EC 4.1.3.1), or ICL, is an enzyme in the glyoxylate cycle that catalyzes the cleavage of isocitrate to ... Glyoxylate cycle Isocitrate lyase family Britton KL, Abeysinghe IS, Baker PJ, Barynin V, Diehl P, Langridge SJ, et al. ( ... Gould TA, van de Langemheen H, Muñoz-Elías EJ, McKinney JD, Sacchettini JC (August 2006). "Dual role of isocitrate lyase 1 in ...
CRYSTAL STRUCTURE OF THE ISOCITRATE LYASE FROM ASPERGILLUS NIDULANS ... Isocitrate Lyase from Aspergillus Nidulans: Crystallization and X-ray Analysis of a Glyoxylate Cycle Enzyme.. Langridge, S.J.,& ... Isocitrate lyase catalyses the first committed step of the carbon-conserving glyoxylate bypass, the Mg(2+)-dependent reversible ... Isocitrate lyase catalyses the first committed step of the carbon-conserving glyoxylate bypass, the Mg(2+)-dependent reversible ...
Apparent isocitrate lyase activity in Leishmania amazonensis. Concepción Hernández-Chinea, Laura Maimone, Yelitza Campos, ... However, these results have been underestimated because genes for the two key enzymes of the cycle, isocitrate lyase (ICL) and ...
... glyoxylate cycle.isocitrate lyase. 1 (1.37%). 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 0. 1. 0. 0. 0. 0. ...
7, and isocitrate lyase activity was found to be induced in ethanol- and acetate-grown cells (42). Further studies are ... Tahama H., Shinoyama H., and Fujii T. Reaction mechanisms of isocitrate lyase from Rhodopseudomonas sp. No. 7.Biosci. Biotech. ... PYK, pyruvate kinase; MDH, malate dehydrogenase; ICL, isocitrate lyase; Ac-CoA, acetyl-coenzyme A; ND, not detected. The open ... Possible candidates include pyruvate carboxylase (PC) and glyoxylate cycle enzymes, including isocitrate lyase and malate ...
Specifically, isocitrate lyase (aceA: K01637) and malate synthase (aceB: K01638), two key genes involved in the glyoxylate ...
Reversibility of isocitrate dehydrogenase and involvement of ATP-citrate lyase in gluconeogenesis. Des Rosiers C, Di Donato L, ... D-threo-Isocitrate. Metabolite. hmdb:HMDB0000193. The ChEBI ID with the correct charge is: 15562. ... The conversion of citrate into cis-aconitate and isocitrate in the presence of aconitase. KREBS HA, HOLZACH O. Biochem J. 1952 ... Reverse flux through cardiac NADP(+)-isocitrate dehydrogenase under normoxia and ischemia. Comte B, Vincent G, Bouchard B, ...
Oxalacetate acetylhydrolase (OAH), a member of the phosphoenolpyruvate mutase/isocitrate lyase superfamily, catalyzes the ... Oxalacetate is the main OAH substrate, but the enzyme also acts as a lyase of (2R,3S)-dimethyl malate with approximately 1000- ... Comparison between the OAH structure and that of the closely related enzyme, 2,3-dimethylmalate lyase, suggests potential ...
However, a finding that the persistence of M. tuberculosis in mice requires the glyoxylate shunt enzyme isocitrate lyase (ICL ... In our prior study on capreomycin, the upregulation of isocitrate lyase (ICL) suggests that capreomycin can affect the ... "Persistence of Mycobacterium tuberculosis in macrophages and mice requires the glyoxylate shunt enzyme isocitrate lyase," ...
In SeeSAR software, protein structure of isocitrate lyase was downloaded from Protein Data Bank. Then its binding site was ... Further, these molecules were covalently docked with isocitrate lyase using SeeSAR. The affinity of selected molecules towards ... Itaconate, a mammalian antimicrobial metabolite has shown excellent efficiency against isocitrate lyase that causes ...
Beever, R. E. 1975: Regulation of 2-phosphoenolpyruvate carboxykinase and isocitrate lyase syntheses in Neurospora crassa. ...
Aldolase activity, but not that of glyceraldehyde-3-phosphate dehydrogenase, isocitrate dehydrogenase or isocitrate lyase, was ...
ICL (ISOCITRATE LYASE). Encodes a glyoxylate cycle enzyme isocitrate lyase (ICL).. O.I.. C.G.. H.G.. Please select. TAIR ( ... lactoylglutathione lyase family protein / glyoxalase I family protein. F:lactoylglutathione lyase activity;P:carbohydrate ...
In agreement, the isocitrate lyase specific activity (Icl or AceA, one of the glyoxylate shunt enzyme) was detected in JM101 ... Isocitrate lyase (Icl): 50 mM morpholipepropanesulfonic acid (MOPS; pH, 7.3), 1 mM EDTA, 5 mM MgCl2, 4 mM phenylhydrazine HCl ( ... Isocitrate dehydrogenase (Icdh): 50 mM phosphate buffer (pH 7.5), 5 mM MgCl2, 2 mM NADP+, 2.5 mM D,L isocitrate [81]. ... Aoshima M, Ishii M, Yamagishi A, Oshima T, Igarashi Y: Metabolic characteristics of an isocitrate dehydrogenase defective ...
Isocitrate Lyase 43% * Phosphoenolpyruvate Carboxykinase (GTP) 23% * Enzyme 16% * Carbon 16% * Host 16% ...
... the enzyme isocitrate dehydrogenase keeps it for the fat-metabolism and energy production cycle; the enzymes isocitrate lyase ... But if isocitrate goes the biosynthesis route, it must be replenished or else the energy-producing cycle will stop. Devastating ... The results showed that the mycobacterium decides where to direct isocitrate by using a mechanism that is not like a simple on- ... The molecule in question is called isocitrate, which, once produced, can go in two directions: continue the energy production ...
... isocitrate lyase will need to provide malate synthase with glyoxylate. The detected increase in isocitrate lyase activity is ... Isocitrate lyase (ICL) and isocitrate dehydrogenase (IDH) involved in regulating TCA and glyoxylate cycle were shown ... Enzymatic assay of isocitrate lyase, isocitrate dehydrogenase, and succinate dehydrogenase assay. The enzymatic activity of ... Bowyer P, De Lucas JR, Turner G. Regulation of the expression of the isocitrate lyase gene (acuD) of Aspergillus nidulans. MGG ...
Alcohol Dehydrogenase; Catalase; Esterases; Germination; Glutamate Dehydrogenase; Isocitrate lyase; Malate dehydrogenase; ...
AutoFact: Isocitrate lyase n=1 Tax=Pinus taeda RepID=Q41084_PINTA 9.0e-31 ... AutoFact: Isocitrate lyase n=1 Tax=Pinus taeda RepID=ACEA_PINTA 0.0 ... AutoFact: Isocitrate lyase n=1 Tax=Pinus taeda RepID=Q41084_PINTA 0.0 ... FL-Next: sp=Isocitrate lyase; Pinus taeda (Loblolly pine). 0.0 • Sma3: Isocitrate lyase 2.8026e-45 ...
isocitrate lyase. Position: -120. Score: 5.6. Sequence: ATTTAAACGCCCGTATGATT Locus tag: Sama_1934. Name: fadD1. Funciton: long- ...
isocitrate lyase YP_003635192 normal 1 normal 0.136709 Cellulomonas flavigena DSM 20109 Bacteria -. ...
Isocitrate lyase (ICL), a signature enzyme of the glyoxylate cycle, is required for metabolism of non-fermentable carbon ... Isocitrate lyase (ICL), a signature enzyme of the glyoxylate cycle, is required for metabolism of non-fermentable carbon ... Antagonism; Biocontrol; Glyoxylate cycle; Isocitrate lyase; Trichoderma atroviride Publicerad i. Fungal Genetics and Biology. ...
isocitrate lyase. Psest_2014. Psest_2321. agx1. alanine--glyoxylate aminotransferase. Psest_3653. Psest_2719. ... Comment: For biosynthesis from glyoyxlate (pathway III), assume that the glyoxylate is formed from isocitrate (an intermediate ...
EC 4.1.3 Oxo-Acid-Lyases. EC 4.1.99 Other Carbon-Carbon Lyases. EC 4.1.3 Oxo-Acid-Lyases. Contents. EC 4.1.3.1 isocitrate lyase ... Ds-isocitrate glyoxylate-lyase; isocitrate glyoxylate-lyase. Systematic name: isocitrate glyoxylate-lyase (succinate-forming). ... EC 4.1.3.46 (R)-citramalyl-CoA lyase Entries. EC 4.1.3.1. Accepted name: isocitrate lyase. Reaction: isocitrate = succinate + ... NANA lyase; acetylneuraminate pyruvate-lyase; N-acetylneuraminate pyruvate-lyase; NanA; N-acetylneuraminate pyruvate-lyase (N- ...
F:isocitrate lyase activity, catalytic activity;P:metabolic process;C:chloroplast, chloroplast stroma;OBFPAM. O.I.. C.G.. H.G. ... F:lyase activity, magnesium ion binding;P:metabolic process;C:unknown;PO. O.I.. C.G.. H.G.. Please select. TAIR (integral). ... F:lyase activity, magnesium ion binding;P:metabolic process;C:unknown;PO. O.I.. C.G.. H.G.. Please select. TAIR (integral). ...
The gene for isocitrate lyase was included in this set, as its regulation by CRE1-mediated carbon catabolite repression is ...
isocitrate lyase activity. IEP. Neighborhood. MF. GO:0004601. peroxidase activity. IEP. Neighborhood. ...