... or mobility shift electrophoresis, also referred as a gel shift assay, gel mobility shift assay, band shift assay, or gel ... A mobility shift assay is electrophoretic separation of a protein-DNA or protein-RNA mixture on a polyacrylamide or agarose gel ... Hellman, Lance M; Fried, Michael G (2007). "Electrophoretic mobility shift assay (EMSA) for detecting protein-nucleic acid ... Fried MG (1989). "Measurement of protein-DNA interaction parameters by electrophoresis mobility shift assay". Electrophoresis. ...

Gel shift assays or electrophoretic mobility shift assay (EMSA) protocols usually require labelling DNA by radioisotope, ... Gel shift assays or electrophoretic mobility shift assay (EMSA) protocols usually require labelling DNA by radioisotope, ... Application Note: Electrophoretic Mobility Shift Assay (EMSA) Using IRDye® Oligonucleotides. 14 June 2011 ...

"Electrophoretic Mobility Shift Assay" by people in UAMS Profiles by year, and whether "Electrophoretic Mobility Shift Assay" ... "Electrophoretic Mobility Shift Assay" is a descriptor in the National Library of Medicines controlled vocabulary thesaurus, ... Below are the most recent publications written about "Electrophoretic Mobility Shift Assay" by people in Profiles over the past ... Below are MeSH descriptors whose meaning is more general than "Electrophoretic Mobility Shift Assay". ...

EMSA and dual-luciferase reporter assays further confirmed that STM3 could directly bind the promoter region to activate FUL1 ... Electrophoretic mobility shift assay. The full-length coding regions of STM3 were amplified by PCR using the primer pair in ... To determine whether STM3 can directly bind the motif, we performed electrophoretic mobility shift assays (EMSAs) using a 49 bp ... DNA gel shift assays were performed using the LightShift Chemiluminescent EMSA kit (Thermo Fisher Scientific, 20148). Each EMSA ...

Electrophoretic mobility shift assay (EMSA). In vitro transcribed RNAs were 5 radiolabeled with ATP, [γ-32P] (PerkinElmer) ... a-c FP binding assay for various tail lengths of 5 FAM-labeled RocRSL3 with RocC14-126 (n = 3). a With FinO45-186 (b), or with ... b EMSA binding assay for RocC1-126, RocC14-126, and RocC24-126 vs 5 radiolabeled RocRSL3 (n = 3). Binding affinity of RocRSL3 ... Fluorescence polarization assay (FP). 5 FAM-labeled RocRSL3 was purchased from IDT and 5 FAM-labeled RocR3nt, RocR8nt were ...

... and luciferase reporter assays. CYP39A1 was upregulated by RORα overexpression in HEK293 cells, while RORα knockdown by siRNA ... RORα binding and responses of these ROREs were assessed using electrophoretic mobility shift, chromatin immunoprecipitation, ... Electrophoretic mobility shift assays (EMSAs) were used to assess RORα binding to DNA of two putative ROREs of the promoter and ... B) Electrophoretic mobility shift assays (EMSAs) showing in vitro binding results of RORα interacting with ROREs of the CYP39A1 ...

The interactions between AmtR and the promoter regions of the three operons were confirmed by electrophoretic mobility shift ... assays (EMSAs). The RS_01910, RS_01915, RS_15995, and RS_16000 are not present in the type strain C. glutamicum ATCC 13032. ... The interactions between AmtR and the promoter regions of the three operons were confirmed by electrophoretic mobility shift ... assays (EMSAs). The RS_01910, RS_01915, RS_15995, and RS_16000 are not present in the type strain C. glutamicum ATCC 13032. ...

Electrophoretic Mobility Shift Assay. PC12 cells were harvested 1 h after microwave exposure or sham-exposure. After that, ... Dual-Luciferase Reporter Assay. Transcription of the rat 5-HT1A receptor gene is initiated from a major site located between ... After the binding assay, the reaction solutions were loaded onto a 4% non-denaturing polyacrylamide gel that had been prerun at ... In the competition assays, 200× non-biotin-labeled probes were preincubated with nucleoprotein for 20 min at room temperature ...

Electrophoretic mobility shift assay. Cells grown on 75 cm2 flasks were stimulated with 10 μg·mL-1 lipopolysaccharide (LPS) for ... Electrophoretic mobility shift assays were performed in order to examine nuclear factor (NF)-κB and activator protein (AP)-1 ... a, b) Electrophoretic mobility shift assay (EMSA) detection of nuclear factor (NF)-κB and activator protein (AP)-1 binding ... and electrophoretic mobility shift assays (EMSAs) for nuclear factor (NF)-κB and activator protein (AP)-1, as well as the ...

Electrophoretic mobility shift assay. The oligonucleotide for HBS1 of the CXCL12 promoter (5′-gggacagggacgtgtccccaggg-3′) was ... electrophoretic mobility shift assays and chromatin immunoprecipitation. The contribution of CXCL12 to hypoxia-induced ... To examine the binding of HIF-2 to the CXCL12 promoter in LP-1 cells, electromobility shift assays were performed. These ... conditions for 48 h and DNA binding activity to HBS1 examined by electromobility shift assay. To determine the contribution of ...

The electrophoretic mobility shift assays (EMSAs) of nuclear extracts harvested from unstimulated-CF bronchial epithelial cells ... Nuclear protein extraction and electrophoretic mobility shift assay. Nuclear extracts were prepared and analysed after the CF ... The consensus κB DNA sequence used for the electophoretic mobility shift assay (EMSA) was 5′AGTTGAGGGGACTTTCCCAGGC3′ (Promega ... Enzyme-linked immunoabsorbent assay for interleukin-6 and intereukin-8 and regulated on activation, T-cell expressed and ...

We used electrophoretic mobility shift assays to determine if the DNA sequence spanning both polymorphisms interacts with ... Electrophoretic mobility shift assays. Cytoplasmic and nuclear extracts from lymphocyte (healthy subject) microglia cell line ( ... Using a semi-quantitative RT-PCR assay, we estimated the ratio between the amount of the OLR1 and β-actin mRNA from lymphocytes ... Semi-quantitative RT-PCR assays. Purified lymphocytes from fresh blood of 20 AD cases (81.8 (SD 5.8) years, 25% of men) and 39 ...

Electrophoretic mobility shift assays (EMSAs). The activity of NF-κB was tested by EMSAs, which was performed according to the ... Rac1 GST-p21-activated kinase (GST-PAK) pull-down assay. The activated Rac1 was detected by GST-PAK pull-down assay, which was ... Enzyme-linked immunosorbent assay (ELISA). Total protein was extracted from tissues and the mixed solution was centrifuged at ... A-C) Expression of NADPH, PDGF, Rac1 and NF-κB in human RAAs analyzed by Colorimetric quantitative detection assay, ELISA, RT- ...

... we performed electrophoretic mobility shift assays. Consistent with deadenylation assays, target RNA binding is complete and ... D) Electrophoretic mobility shift assay showing the binding of Puf3 to a mixture of fluorescein-labelled ScPuf3-target RNA ( ... Electrophoretic mobility shift assays. Request a detailed protocol Binding reactions (10 μl) were prepared by adding protein at ... Electrophoretic mobility shift assays confirmed that Puf3 and Zfs1 bind stably to their respective target RNAs (Figure 1-figure ...

Electrophoretic mobility shift assay. Electrophoretic mobility shift assays (EMSAs) were performed as described previously (34 ... Ab assay. The level of anti-OVA or anti-mBSA Ab in sera was measured by ELISA as described previously (29). ... Mice were bled 30 days after priming with OVA and assayed for the anti-OVA Ab level by ELISA. The mean Ab titers (± SD) of each ... Lymphocyte proliferation assay. Single cell suspension from splenocytes or lymph nodes was cultured at 105 cells/well with ...

Electrophoretic Mobility Shift Assay * Embryoid Bodies / metabolism * Genome * Mice * Protein Binding * Receptors, Retinoic ... In functional assays, DR8 and IR0 elements act as independent RAREs, whereas DR0 does not. Our results reveal an unexpected ...

Electrophoretic mobility shift assay.. Electrophoretic mobility shift assay (EMSA) was performed using double-stranded ... This antibody does not shift the complex, but prevents its binding to the PPRE. E: Autoradiograph of EMSA performed with a 32P- ... This antibody does not shift the complex, but prevents its binding to the PPRE. E: Autoradiograph of EMSA performed with a 32P- ...

Fluorescent electrophoretic mobility shift assay. Nuclear extracts were prepared as described previously (Ruscher et al., 2000 ... Using a fluorescent-based electrophoretic mobility shift assay (fEMSA; Ruscher et al., 2000), we observed marked HIF-1 DNA ... 2000) A fluorescence-based nonradioactive electrophoretic mobility shift assay. J Biotechnol 78:163-170. ... For gel shift assays 1 pmol of Cy5-labeled specific probe was incubated with 25 μg of protein of nuclear extracts in binding ...

Electrophoretic mobility shift assay for NF-κB activation. To evaluate the effect of CDF, curcumin, and gemcitabine on BxPC-3, ... and MIAPaCa-M cells as assessed by electrophoretic mobility shift assay. Cells were treated with 1 to 4 μmol/L CDF/curcumin, 10 ... and MIAPaCa-M cells as assessed by electrophoretic mobility shift assay. Cells were treated with 1 to 4 μmol/L CDF/curcumin, 10 ... The supernatant was assayed for vascular endothelial growth factor (VEGF) assay using AlphaLISA VEGF 500 data point kit from ...

electrophoretic mobility-shift assay. ER. estrogen receptor. ERE. ER element. FasL. Fas ligand. GD. gestational day. Mut. ... Electrophoretic mobility-shift assays were performed to verify the binding affinity of cis-regulatory motifs of Fas or FasL ... and the shift was specific to DES because these probes failed to shift their mobility in the presence of nuclear proteins from ... There was shift in mobility of probes (ERE or NF-κB2) of both Fas and FasL in the presence of nuclear proteins from DES-treated ...

Transient transfection and luciferase assays along with electrophoretic mobility shift assays were conducted to explore the ... The dual-luciferase reporter assay demonstrated that miR-193a-3p directly targeted NEAT1 at its 3-UTR. We then detected NEAT1 ... A luciferase activity reporter assay was performed to corroborate the interaction between NEAT1 and miR-193a-3p. Data from Gene ... The effect of COX-inhibitors on GEP-NET cell growth was determined by proliferation assays and colony growth assessment. ...

Electrophoretic Mobility Shift Assay / methods* * Electrophoretic Mobility Shift Assay / standards* * Enzyme-Linked ... Validation of the mobility shift IFX assay also showed high assay sensitivity, precision and accuracy. The HMSA method may also ... To overcome these limitations, we have developed a non-radiolabeled homogeneous mobility shift assay (HMSA) to measure the ... Development and validation of a homogeneous mobility shift assay for the measurement of infliximab and antibodies-to-infliximab ...

Viability and radiation response of macrophages after exposure to tea extracts was measured by MTT assays. Tea extracts ... Cell extracts and electrophoretic mobility shift assays. For preparation of total cytosolic extracts, cells were dislodged ... Supershift assays using an anti-p50 or anti-p65 antibody confirmed specificity of the shifted bands (Figure 5). The observed ... concentrations in the gel-shift assays. Further dilutions caused a decrease in NF-κB DNA-binding activity in experiments using ...

... electrophoretic mobility shift assay; functional genomics; gene regulation; genetic; histone; isocyanate; luciferase assay; ... Electrophoretic mobility shift assays detected allele-dependent nuclear protein binding in A549 cells for 8 of 21 variants. In ... and IMR-90 lung cell lines by using electrophoretic mobility shift assays. DNA constructs were cloned into a pGL3 promoter ... and functional assays. Methods: NGS was performed in 91 workers with DA. Fourteen loci with known DA-associated single ...

electrophoretic mobility shift assay. HA. hemagglutinin. IκBαM. S32/36A mutant inhibitory nuclear factor-κB protein α. VCT. ...

Electrophoretic gel mobility shift assay (EMSA). BMM osteoclast precursor cells were serum-deprived for 3 hours, pretreated ... In gel mobility shift assays with the AP-1 binding site or MITF binding (E-box) sequences, M-CSF induced DNA binding activities ... Nuclear extracts were prepared and gel mobility shift assays were performed as previously described (Lee et al., 2001). The ... Migration assay. Migration assay was performed using a 24-well Transwell plate (Corning) possessing 8 μm pores. BMMs were serum ...

... electrophoretic mobility shift assay; LDL, low-density lipoprotein; BACE, β-secretase; AD, Alzheimers disease; APP, amyloid ...

Activation of transcription factors was determined by electrophoretic mobility shift assay. The effects of SP600125 on the key ...

Purified AgrA showed high-affinity binding to the RNAIII-agr intergenic region by electrophoretic mobility shift assays (EMSAs ... Binding was localized by DNase I protection assays to a pair of direct repeats in the P2 and P3 promoter regions of the agr ...

DNA-protein interaction was observed at this motif by electrophoretic mobility shift assay. The proteins interacting with the ... In most of the assays to determine their antioxidative properties, the ABTS activity was strongly correlated with DPPH because ...