Type II site-specific deoxyribonuclease (EC 3.1.21.4, type II restriction enzyme) is an enzyme. This enzyme catalyses the ... Type+II+site-specific+deoxyribonuclease at the U.S. National Library of Medicine Medical Subject Headings (MeSH) Portal: ... following chemical reaction Endonucleolytic cleavage of DNA to give specific double-stranded fragments with terminal 5- ...
DNA Restriction-Modification Enzymes - Deoxyribonucleases, Type II Site-Specific PubMed MeSh Term *Overview ... DNA Restriction-Modification Enzymes - Deoxyribonuclease BamHI PubMed MeSh Term * DNA Restriction-Modification Enzymes - ... DNA Restriction-Modification Enzymes - Deoxyribonuclease HindIII PubMed MeSh Term * DNA Restriction-Modification Enzymes - ...
CTGCAG-specific type II deoxyribonucleases * Deoxyribonucleases, Type II Site-Specific Grants and funding * AG036871/AG/NIA NIH ...
Deoxyribonucleases, Type II Site-Specific [D08.811.277.352.335.350.300.260]. *Deoxyribonuclease EcoRI [D08.811.277.352.335.350. ... Deoxyribonucleases, Type II Site-Specific [D08.811.277.352.355.325.300.260]. *Deoxyribonuclease EcoRI [D08.811.277.352.355.325. ... One of the Type II site-specific deoxyribonucleases (EC 3.1.21.4). It recognizes and cleaves the sequence G/AATTC at the slash ... This graph shows the total number of publications written about "Deoxyribonuclease EcoRI" by people in this website by year, ...
Deoxyribonucleases, Type II Site-Specific / genetics* * Diabetes Mellitus, Type 1 / drug therapy ... Background: Type 1 diabetes (T1D) is an autoimmune disease mediated by T-helper (Th) cells. Additionally, the immune system ... VDR FokI polymorphism is associated with a reduced T-helper cell population under vitamin D stimulation in type 1 diabetes ... 2 Department of Internal Medicine I, Division of Endocrinology, Diabetes and Metabolism, University Hospital Frankfurt, Germany ...
Deoxyribonucleases, Type II Site-Specific/metabolism * Electrophoresis, Gel, Pulsed-Field * Extracellular Matrix Proteins/ ...
Deoxyribonucleases, Type II Site-Specific. *Deoxyribonuclease EcoRI. *DNA Restriction Enzymes. Citation. APA ... Recently, two cloned segments of human X-chromosome DNA have been described which detect structural alterations within or near ... but is probably located between independent sites of mutation which yield DMD. The breakpoints of some deletions are delineated ...
Deoxyribonucleases, Type II Site-Specific * Directed Molecular Evolution * Endodeoxyribonucleases * Escherichia Coli * Gene ...
Type II site-specific deoxyribonuclease activity GO:0009036 * ribonuclease IX activity GO:0033896 ...
type Ii site-specific deoxyribonuclease subunit S 3553_sll6098-sacB ATGGCGATCGCCAGCCGAGCAGGTC… Fic family protein ... type II toxin-antitoxin system VapC family toxin 3418_ssl5095-sacB ATGACTAATTCAGCAACCCAAGGTC… type II toxin-antitoxin system ... two-component sensor histidine kinase 3497_slr6042-sacB ATGCAAAACCGGATCATTGTTCAGG… efflux RND transporter periplasmic adaptor ... two-component response regulator 3496_slr6041-sacB ATGCAGAACAATAGATTATTCAATC… ...
Deoxyribonucleases, Type II Site-Specific [D08.811.150.280.260] * Deoxyribonuclease BamHI [D08.811.150.280.260.240] ... Deoxyribonucleases, Type II Site-Specific [D08.811.277.352.335.350.300.260] * Deoxyribonuclease BamHI [D08.811.277.352.335.350. ... Deoxyribonucleases, Type II Site-Specific [D08.811.277.352.355.325.300.260] * Deoxyribonuclease BamHI [D08.811.277.352.355.325. ... One of the Type II site-specific deoxyribonucleases (EC 3.1.21.4). It recognizes and cleaves the sequence G/GATCC at the slash ...
Deoxyribonucleases, Type II Site-Specific. *Device Removal. *Diabetes Mellitus, Type 2. *Diagnosis, Differential ...
CONCLUSION: A novel StyI restriction enzyme can be used to confirm the commonest type of Hb G-Philadelphia. DNA sequencing ... RESULTS: Twenty-two cases (78.6%) of 28 cases amplified were tested positive for Hb G-Philadelphia by StyI restriction ... Sequencing of the six negative cases revealed two cases of Hb G-Philadelphia with C→A mutation in codon 68 in α2 globin gene, ... plus one case each of Hb G-Norfolk Hb Stanleyville-II, Hb Matsue-Oki and Hb Mizushi. ...
... indicated that recombination between transfecting DNAs occurred concomitantly with DNA replication but that the two processes ... conclude that the dramatic expansion of recombination activities in the cytoplasm of poxvirus-infected cells is virus specific ... Deoxyribonucleases, Type II Site-Specific, DNA, Viral, Densitometry, Transfection, Nucleic Acid Hybridization, Virus ... Cookies on this website We use cookies to ensure that we give you the best experience on our website. If you click Accept all ...
First, we typed 80 patients suffering from severe sepsis and 153 healthy individuals and found no association of the -308 ... Adult, Aged, Alleles, Animals, Cell Line, Deoxyribonucleases, Type II Site-Specific, Gene Deletion, Heterozygote, Homozygote, ... Cookies on this website We use cookies to ensure that we give you the best experience on our website. If you click Accept all ... First, we typed 80 patients suffering from severe sepsis and 153 healthy individuals and found no association of the -308 ...
Type II Site-Specific:genetics, Female, Fetal Growth Retardation:genetics, Fetus:anatomy & histology, Genotype, Gestational Age ... Journal Article 2008; 29(4): 493-499 PubMed PMID: 18766139 Citation Keywords: Adult, Blood Flow Velocity, Deoxyribonucleases, ... Factor II positive subjects (n=47) had a mean factor II activity of 127.96%+/-21.37. F-II activity among carriers (heterozygous ... F-V activity among wild type (n=41), F-V Leiden heterozygous (n=169) and F-V Leiden homozygous (n=8) were 92.93%+/-16.17, 87.02 ...
regulation of Type III site-specific deoxyribonuclease activity GO:0032086 * positive regulation of telomeric loop formation ... positive regulation of mating type switching by positive regulation of transcription from RNA polymerase II promoter ... positive regulation of mating type switching by regulation of transcription from RNA polymerase II promoter ... positive regulation of mating type switching by transcription from RNA polymerase II promoter ...
Deoxyribonucleases, Type II Site-Specific. * DNA Repair. * DNA Replication. * DNA, Kinetoplast. * Molecular Sequence Data ... Login to edit your profile (add a photo, awards, links to other websites, etc.) ...
Deoxyribonucleases - Deoxyribonuclease HindIII * Deoxyribonucleases - Deoxyribonucleases, Type II Site-Specific * Diagnostic ... DNA Restriction-Modification Enzymes - Deoxyribonuclease HindIII * DNA Restriction-Modification Enzymes - Deoxyribonucleases, ... Endonucleases - Deoxyribonuclease HindIII * Endonucleases - Deoxyribonucleases, Type II Site-Specific * Genetic Phenomena - ...
... and is probably related to Tris-dependent site-specific cleavage of the DNA (19). Nondegradative PFGE was only achieved by ... Six patients had received aerosolized deoxyribonuclease. Two patients had received oral corticosteroids, and four had received ... identical to the type-strain M. abscessus ATCC 19977T), -5a (differing from ATCC 19977T by 5 nt, and identical to the reference ... Three samples (3.2%) from two water supply points tested positive for rapidly growing mycobacteriua (M. mucogenicum, two ...
type I site-specific deoxyribonuclease complex type II site-specific deoxyribonuclease complex ... type III site-specific deoxyribonuclease complex type IV site-specific deoxyribonuclease complex ... BRENDA uses cookies to anonymously track site statistics, and to enhance the user expericence. By clicking the "Accept" button ...
Type III site-specific deoxyribonuclease. 8e-08. 57.4. NC_018867:10238:60407. 60407. 63490. 3084. Dehalobacter sp. CF ... Type III site-specific deoxyribonuclease. 1e-10. 66.6. NC_004631:948054:970921. 970921. 973881. 2961. Salmonella enterica subsp ... Type III site-specific deoxyribonuclease. 9e-14. 77.4. NC_010170:4463000:4489211. 4489211. 4492216. 3006. Bordetella petrii, ... Type III site-specific deoxyribonuclease. 1e-10. 66.6. NC_013411:2191514:2205716. 2205716. 2208670. 2955. Geobacillus sp. ...
... where it causes site-specific recombination of the LoxP sites resulting in KO of the CXCR4 gene (Figure 1A). For animal ... these data indicate that the CXCL12/CXCR4 axis plays an important role in the shift from type 1 to type 2 immune response ... Cell viability (,70% cells alive) and concentration were assessed by the Countess II Cell Counter (Invitrogen) to ensure the ... and deoxyribonuclease I (0.1 mg/mL; Sigma-Aldrich) for 30 minutes at 37°C. Afterward, the cell suspension was filtered ...
Due to the specific chromatin landscapes in different tissue types, distinct ranges of OCF values were accordingly observed in ... two plasma samples collected in a 12-month interval showed decreased accessibility of AR binding sites, reflecting the androgen ... particularly of deoxyribonuclease 1-like 3 (DNASE1L3) [58,59]. DNASE1L3 and DNASE1 are the most abundant DNases in mammalian ... Zhong, S.; He, X.; Bar-Joseph, Z. Predicting tissue specific transcription factor binding sites. BMC Genom. 2013, 14, 796. [ ...
Details on mammalian cell type (if applicable):. Blood of two male donors.. Additional strain / cell type characteristics:. not ... Type of assay:. mammalian erythrocyte micronucleus test. Specific details on test material used for the study:. The test ... Welcome to the ECHA website. This site is not fully supported in Internet Explorer 7 (and earlier versions). Please upgrade ... in two separate experiments. A treat and plate procedure was used for all treatments in this study as deoxyribonuclease, ...
Type III Site Specific Deoxyribonucleases 59% * Horizontal Gene Transfer 39% * Endonucleases 35% ... Evidence for type III restriction and modification systems in Mycoplasma pulmonis. Dybvig, K., Cao, Z., French, C. T. & Yu, H. ... Type three secretion system-mediated escape of Burkholderia pseudomallei into the host cytosol is critical for the activation ... The Bordetella type III secretion system effector BteA contains a conserved N-terminal motif that guides bacterial virulence ...
By using this website, you agree to our Terms and Conditions, Your US state privacy rights, Privacy statement and Cookies ... By generating a two-dimensional map of the data using the dimensionality reduction algorithm t-SNE for each tumor sample, we ... C The population percentage of all immune cell types in tumor tissues and paratumor tissues. D Heatmap showing the population ... 20 µg/mL deoxyribonuclease I) to generate single-cell suspensions. An average of 1-3 × 106 cells were prepared and stained ...
Type I site-specific deoxyribonuclease. 90.33. 0.8105. 97. sll7001 Putative transposase [ISY391e(partial copy): 166 - 1298]. ... Photosystem II core light harvesting protein. 16.12. 0.8846. 15. slr1068 Hypothetical protein. 16.97. 0.9055. ...
B. subtilis YtpP and TrxA Wild-Type Gene Design and Site-Directed Mutagenesis. B. subtilis YtpP (B. subtilis subsp. subtilis ... Find support for a specific problem in the support section of our website. ... The first two criteria are based on analogy to the well-characterized glutaredoxin and mycoredoxin. Two potential candidates, ... 50 μg/mL deoxyribonuclease I (DNase I Bovine pancreas-Sigma) and 10 mM MgCl2). Following resuspension, the cells were sonicated ...
On the basis of whole-transcriptome analyses, we identify many genes that are expressed in a sex- or life stage-specific manner ... The functions of deoxyribonuclease II in immunity and development. DNA Cell Biol. 27, 223-228 (2008). ... This is because it is in intimate contact with host tissue and because it is home to two specialized cellular structures-the ... celiac disease and type 1 diabetes), as well as for two likely immune-unrelated complex traits (height and body mass index). ...