Flanking SNPs are Single nucleotide polymorphisms (SNP) that appear in the flanking region. Polymorphisms in this region can ... flanking region is a region of DNA that is adjacent to the 5′ end of the gene. The 5flanking region contains the promoter, ... flanking region of eukaryotic genomes. A specific transcription factor called CAAT-binding protein binds to this region and ... untranslated region, this region is not transcribed into RNA or translated into a functional protein. These regions primarily ...
Flanking Region. / Bleck, Gregory T.; Conroy, John C.; Wheeler, Matthew B. In: Journal of Dairy Science, Vol. 79, No. 3, 1996, ... Flanking Region. Journal of Dairy Science. 1996;79(3):347-349. doi: 10.3168/jds.S0022-0302(96)76370-1 ... Flanking Region. In: Journal of Dairy Science. 1996 ; Vol. 79, No. 3. pp. 347-349. ... keywords = "β-casein, Deoxyribonucleic acid regulatory region, Milk protein, Promoter",. author = "Bleck, {Gregory T.} and ...
... flanking region for the human topoisomerase III gene. / Kim, Jun Chul; Yoon, Jong Bok; Koo, Hyeon Sook et al. In: Journal of ... flanking region for the human topoisomerase III gene, Journal of Biological Chemistry, vol. 273, no. 40, pp. 26130-26137. ... flanking region for the human topoisomerase III gene. In: Journal of Biological Chemistry. 1998 ; Vol. 273, No. 40. pp. 26130- ... flanking region for the human topoisomerase III gene. Journal of Biological Chemistry. 1998 Oct 2;273(40):26130-26137. doi: ...
... flanking region of IL12RB2 were examined in subjects with several types of periodontal disease and in healthy controls. Serum ... flanking region of IL12RB2, whose variants are frequently detected in lepromatous leprosy patients, in which the very weak ... flanking region of IL12RB2 are associated with susceptibility to periodontal diseases in the Japanese population.. Takeuchi- ...
... flanking region of HLA-B and HLA-C.. AB - Two DNA probes isolated from the region 5′ to the HLA-B gene are described. One of ... flanking region of the HLA-B gene to examine polymorphism at the HLA-B locus, Human Immunology, vol. 16, no. 2, pp. 137-147. ... flanking region of the HLA-B gene to examine polymorphism at the HLA-B locus. In: Human Immunology. 1986 ; Vol. 16, No. 2. pp. ... flanking region of the HLA-B gene to examine polymorphism at the HLA-B locus. Human Immunology. 1986 Jun;16(2):137-147. doi: ...
... flanking region CTACTGCACATGATGCCAAGAACTCTATTACATTGTTACAAAAGAACCAA 3 flanking region ...
3 flanking region TCTTCTTYTTTTTTGCAGGTATAGGCAGC Indel CCTTTC Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589 ...
Total - Total depth of deletion variants (must have flanking states in read) ... 5. 21023. 0.000237834752414023. 0.000301575681676824. A_MP. 668. 1. CATCC-AGTTC. FALSE. 2. 21411. 9.34099294755033e-05. ...
... flanking region ATTTTGTTTCTTTTGATTCAATTTCAGTTTCTTCTTTTCTCCTTTTCACA 3 flanking region ...
... flanking region AGTTTGTATCATATGTTTAGTGTGGAATTTTGAGTGTTTTTTCTTTGGCC 3 flanking region ...
3 flanking region TAACAAAGGCGAAGTACTTCAAAGGCTTTTTCTCAACCGTAGGTGCAGGATTGATGTTCGCTCTTTACCTCCCTGTCATGGAGAAGATATACCAAANAGT SNP ...
... flanking region. Genomics. 1 December 1996. 38:155-165. [QxMD MEDLINE Link]. [Full Text]. ... A single-base deletion in the 3-coding region of glycogen-debranching enzyme is prevalent in glycogen storage disease type ... 5] Over 200 mutations-including missense, nonsense, splice site, small frame shift deletions and insertions, and large gene ... Human glycogen debranching enzyme gene (AGL): complete structural organization and characterization of the 5 ...
... flanking sequence. This study demonstrates the utility of the human beta-PDE promoter for directing the expression of foreign ... Photoreceptor-specific reporter gene expression is driven in vivo by a 350-bp segment of the beta-PDE 5 ... genes to photoreceptors and suggests that the -297 to +53 beta-PDE 5 … ... flanking region (-297 to +53) was used to generate transgenic mice. Gene expression was analyzed by measuring beta- ...
... flanking promoter region of mammalian WNT8B orthologs. Int. J. Oncol. 2007, 30, 1273-1277. [Google Scholar] [CrossRef][Green ... Ther. 2020, 5, 8. [Google Scholar] [CrossRef][Green Version]. *Gao, W.; Wu, D.; Wang, Y.; Wang, Z.; Zou, C.; Dai, Y.; Ng, C.F ... Figure 5. BMP4 signaling promotes TICs and stem cell traits. (A) Immunoblot analysis showing the protein level of ... Figure 5. BMP4 signaling promotes TICs and stem cell traits. (A) Immunoblot analysis showing the protein level of ...
We find 116 887 and 137 557 nucleosome-depleted regions (NDRs) in human and mouse FGCs, covering a large set of germline- ... D) Endogenous DNA methylation distribution along the gene body regions and their flanking regions in mouse PGCs and somatic ... This allows the open chromatin regions, closed chromatin regions and undetected chromatin regions to be discriminated. Moreover ... Endogenous DNA methylation distribution along the gene body regions and their flanking regions in human fetal germ cells and ...
... flanking region of var genes nucleate histone modification patterns linked to phenotypic inheritance of virulence traits in ... Chromosomal landmark regions such as centromeres or telomeres are also characterized by specific chromatin landscapes. In many ... Intriguingly, these long ncRNAs originate from regions containing abundant SPE2 motifs [60]. These cis-acting DNA elements are ... 2010) H2A.Z demarcates intergenic regions of the Plasmodium falciparum epigenome that are dynamically marked by H3K9ac and ...
... flanking region, to identify any new SNPs.. As shown in Table 5, 11 of the 16 samples analyzed had the same SNP profile, which ... flanking region to exon 5 was carried out using primers 5′-F1 and Exon 5R (Zhang et al., 2003), generating a 4592-bp fragment. ... flanking region (Table 5). However, the sequences of these new *1 haplotypes (i.e., the linkages between the contributing SNPs ... flanking region of human CYP1A2 gene: effect on the CYP1A2 inducibility in humans. J Biochem 125: 803-808. ...
... flanking region of the lactase-phlorizin hydrolase gene was determined in two hypolactasic subjects and two controls. No ... Since the human TSH beta gene contains at least one high-affinity binding site for Pit-1/GHF-1 in a region necessary for cAMP ... The latter region contains three DNA sequences homologous to a pituitary-specific transcription factor, Pit-1/GHF-1, DNA- ... Our data indicate that the regions adjacent to Thr123 and Thr347 of LCAT may play an important role in HDL cholesterol ...
... flanking region of the human DNA helicase B (. HELB. ) gene and its response to trans. -resveratrol. Scientific Reports. 2016; ... flanking region of the human TP53. gene and its response to the natural compound, resveratrol. Journal of Biochemistry. 2016;. ... The bHLH proteins contain a basic region and HLH motif, which is comprised of two α-helices separated by a loop [9]. The bHLH ... Hot spot somatic mutations are observed in the promoter regions of the human cancer genomes [35]. Binding of the TFs on the ...
... flanking region common to both CYP2D6Ch genes were found. To evaluate the origin of the detrimental mutation in the genes, ... flanking regions were introduced into a Hep G2/simian virus 40 expression system with chloramphenicol acetyltransferase as a ... A part of the upstream region of base pairs -1407 to -1068 was found to constitute an enhancer element, but the CYP2D6Ch- ... The ability of the upstream regions to bind nuclear factors was also evaluated using gel-shift analysis. Furthermore, several ...
... flanking region. The 5′-flanking sequence was analyzed online by PlantCare7 and PLACE8 at default settings. ... The basic region, helixes, loop and zip regions were marked. (D) Alignment of the BIF/ACT-like domain. The secondary structure ... The coding region of TcMYC2a was inserted into the pCAMBIA1303 vector with Nco I and BstE II restriction sites under control of ... TcMYC2a-pGADT7R2 and pGADT7 were digested by EcoR I and Xma I, the coding region of TcMYC2a were inserted into pGADT7 to ...
... flanking region". Genomics. 38 (2): 155-65. doi:10.1006/geno.1996.0611. PMID 8954797.. ... untranslated region. Exons 4-35 encode the remaining 1505 amino acids of the AGL gene.[3] Studies produced by the department of ... ISBN 0-7167-8724-5.. *↑ 6.0 6.1 6.2 Hondoh H, Saburi W, Mori H, et al. (May 2008). "Substrate recognition mechanism of alpha-1, ... 141 (5): 627-34. doi:10.1093/jb/mvm065. PMID 17317688.. *↑ Zhai, Liting; Feng, Lingling; Xia, Lin; Yin, Huiyong; Xiang, Song ( ...
Upstream and downstream flanking regions of gene nadA (AFUA_6G14470) were amplified by PCR using primer pairs 6G14470_5for ( ... end of the upstream flanking region and at the 5-end of the downstream flanking region of the nadA gene. The ptrA resistance ... The palm domain consists of a seven-stranded central β-sheet flanked by two short α-helices and two 310 helices. As described ... The residues are found in three distinct regions and are coloured according to their location in the sequence. C Comparison of ...
... flanking region of the rat oatp2 gene. One element (DR3-1) is located approximately −5000 bp with three more (DR3-2, DR3-3, and ... flanking region of the rat oatp2 gene were linked to the luciferase reporter gene and used in transient transfection assays in ... flanking region illustrated that both the proximal and distal clusters of PXREs are required for maximal induction of rat oatp2 ... MolPharm articles become freely available 12 months after publication, and remain freely available for 5 years. Non-open access ...
... size of loxP-flanked region is 5.0 kb).. *A polyadenylation signal (hGHpA: human Growth Hormone polyadenylation signal) has ... The remaining recombination sites are located in non-conserved regions of the genome. ... Cre mediated deletion of exons 2 to 5 should result in loss of function of the Nfe2l2 gene by deleting most of the gene. ... Exons 2 to 5 have been flanked by loxP sites ( ...
... flanking region of the CYP3A4 gene. Here, the chromatin status of three regions in the 5′-flanking region of the CYP3A4 gene ... A reporter plasmid containing the CYP3A4 proximal promoter region and distal enhancer region (Fig. 4B, pGL3/CYP3A4-362-7.7k; ... B) The structure of pGL3/CYP3A4-362-7.7k plasmid containing CYP3A4 proximal promoter region and distal enhancer region. siNEAT1 ... flanking region of the CYP3A4 gene is relaxed by treatment with PXR ligands (Kurosawa et al., 2023). We surmised the ...
... flanking region and expression in hepatic cells. Tanaka, T., Uchiumi, T., Hinoshita, E., Inokuchi, A., Toh, S., Wada, M., ... The human multidrug resistance protein 2 gene: functional characterization of the 5- ... bacteriophage DNA in which thymine is partly replaced by a phosphoglucuronate moiety covalently bound to 5-(4,5- ... 5,6-hexa)-ol substrate [myo-inositol (MI)] by four electrons to d-glucuronate [28]. ...
Top: Primers which bind to the flanking regions and span the deleted region. Middle: Gene specific primers for celA (indicates ... Grey shaded area signifies the amplified region using primers spanning the region of interest. A. Amplification of flanking ... Bottom: Primers which bind to the flanking regions and span the region deleted. Lanes are products from the reactions including ... For testing the system in C. michiganensis CASJ002, ~1.5 kB regions within two permissive regions, hit region 1 (HR1) and 3 ( ...