Furin: A proprotein convertase with specificity for the proproteins of PROALBUMIN; COMPLEMENT 3C; and VON WILLEBRAND FACTOR. It has specificity for cleavage near paired ARGININE residues that are separated by two amino acids.Subtilisins: A family of SERINE ENDOPEPTIDASES isolated from Bacillus subtilis. EC 3.4.21.-Proprotein Convertases: Proteolytic enzymes that are involved in the conversion of protein precursors such as peptide prohormones into PEPTIDE HORMONES. Some are ENDOPEPTIDASES, some are EXOPEPTIDASES.Proprotein Convertase 5: A serine endopeptidase found primarily in the EXTRACELLULAR MATRIX. It has specificity for cleavage of a variety of substrates including PRORENIN, pro-membrane type-1 matrix metalloproteinase, and NEURAL CELL ADHESION MOLECULE L1.Protein Processing, Post-Translational: Any of various enzymatically catalyzed post-translational modifications of PEPTIDES or PROTEINS in the cell of origin. These modifications include carboxylation; HYDROXYLATION; ACETYLATION; PHOSPHORYLATION; METHYLATION; GLYCOSYLATION; ubiquitination; oxidation; proteolysis; and crosslinking and result in changes in molecular weight and electrophoretic motility.Protein PrecursorsProprotein Convertase 2: A serine endopeptidase that has specificity for cleavage at ARGININE. It cleaves a variety of prohormones including PRO-OPIOMELANOCORTIN, proluteinizing-hormone-releasing hormone, proenkephalins, prodynorphin, and PROINSULIN.Proprotein Convertase 1: A CALCIUM-dependent endopeptidase that has specificity for cleavage at ARGININE that is near paired basic residues. It cleaves a variety of prohormones including PRO-OPIOMELANOCORTIN; PRORENIN; proenkephalins; prodynorphin; prosomatostatin; and PROINSULIN.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.

*  Abstract 4907: Upregulation of furin is associated with the invasiveness of cumulatively irradiated cancer cells | Cancer...
Furin, a subtilisin/kesin-like proprotein convertase (PC), activates membrane-bound MT1-MMP, which facilitates pro-gelatinase A ... AMC-HN3R cells were increased furin expression with upregulation of MT1-MMP/MMP2 and their invasiveness by two fold (p , 0.05) ... Upregulation of furin is associated with the invasiveness of cumulatively irradiated cancer cells. [abstract]. In: Proceedings ... Abstract 4907: Upregulation of furin is associated with the invasiveness of cumulatively irradiated cancer cells. Myungjin Lee ...
  http://cancerres.aacrjournals.org/content/74/19_Supplement/4907
*  Non-Selective
These outcomes indicate furin portrayed by cancers cells can action on the furin cleavage sites of chimeric Meso-scFv-ROR-Fc. ... and control Meso-scFv-O-Fc proteins without furin cleavage sites. As demonstrated in Physique 1b, just the furin-expressing ... In addition, furin-deficient FD11 Rabbit polyclonal to TdT cells had been transfected with numerous Meso-scFv-Fc chimeric ... The decreased fluorescence shows buy a-Apo-oxytetracycline that furin-mediated proteolysis of the chimeric Meso-scFv-ROR-Fc ...
  http://www.techtasys.com/category/non-selective/
*  Plus it
Toxin uptake into cells is dependent on proteolytic activation of PA by ubiquitously expressed furin or furin-like proteases ... modified LeTx by changing the furin cleavage sequence of PA, 164RKKR167, to a gelatinase (MMP-2/9) selective cleavage sequence ... Uptake of the toxin into cells is dependent on proteolytic activation of protective antigen by the ubiquitously expressed furin ... Although our studies indicated that modification of the furin cleavage site did slightly reduce PA potency, we have ...
  http://mct.aacrjournals.org/content/7/5/1218
*  Furin cleavage assays of fluorogenic peptides. A) Synth | Open-i
Furin cleavage assays of fluorogenic peptides. A) Synthetic fluorogenic peptides were generated with sequences matching ... We used human furin for these experiments. Human and feline furin are very similar (96% identical) and are expected to cleave ... We used human furin for these experiments. Human and feline furin are very similar (96% identical) and are expected to cleave ... We examined a furin cleavage site in the region between receptor-binding (S1) and fusion (S2) domains of the spike of serotype ...
  https://openi.nlm.nih.gov/detailedresult.php?img=PMC3713968_12-1094-F4&req=4
*  The potency of immunotherapies targeting endogenous tumor antigens is impeded by
These outcomes indicate furin portrayed by cancers cells can action on the furin cleavage sites of chimeric Meso-scFv-ROR-Fc. ... and control Meso-scFv-O-Fc proteins without furin cleavage sites. As demonstrated in Physique 1b, just the furin-expressing ... In addition, furin-deficient FD11 Rabbit polyclonal to TdT cells had been transfected with numerous Meso-scFv-Fc chimeric ... The decreased fluorescence shows buy a-Apo-oxytetracycline that furin-mediated proteolysis of the chimeric Meso-scFv-ROR-Fc ...
  http://www.techtasys.com/2017/11/the-potency-of-immunotherapies-targeting-endogenous-tumor-antigens-is-impeded-by/
*  ActoFactor™ Recombinant Human Furin (paired basic amino acid cleaving enzyme) | Creative Bioarray
Recombinant human Furin is a 61.7 kDa protein, corresponding to residues 124 through 715 of the Furin precursor plus a C- ... Furin is a calcium dependent serine endoprotease that processes numerous proproteins of different secretory pathways into their ... ActoFactor™ Recombinant Human Furin (paired basic amino acid cleaving enzyme) (CSC-CTK0634). ...
  https://www.creative-bioarray.com/ActoFactor-Recombinant-Human-Furin-paired-basic-amino-acid-cleaving-enzyme-CSC-CTK0634-item-3960.htm
*  Furin Antibody (NB100-1903): Novus Biologicals
Rabbit Polyclonal Anti-Furin Antibody. TGN Marker. Validated: WB, B/N, Flow, ICC/IF, IHC-P, IP. Tested Reactivity: Human, Mouse ... Detects Furin convertase from canine and mouse cells as well as transfected human Furin. This does not detect endogenous Furin ... Blogs on Furin. There are no specific blogs for Furin, but you can read our latest blog posts. ... Flow Cytometry: Furin Antibody [NB100-1903] - Flow cytometry analysis of Furin Convertase was done on HeLa cells. Cells were ...
  https://www.novusbio.com/products/furin-antibody_nb100-1903
*  The proprotein convertase furin is required to maintain viability of alveolar rhabdomyosarcoma cells - Zurich Open Repository...
Furin expression was confirmed in over 86% RMS biopsies in a tissue microarray (n=89). Inducible furin silencing in vitro led ... Furin expression was confirmed in over 86% RMS biopsies in a tissue microarray (n=89). Inducible furin silencing in vitro led ... Taken together, these findings identify furin as an important factor for aRMS progression and survival. Thus, we propose furin ... Taken together, these findings identify furin as an important factor for aRMS progression and survival. Thus, we propose furin ...
  http://www.zora.uzh.ch/id/eprint/128820/
*  Furin cleavage of the SARS coronavirus spike glycoprotein enhances cell-cell fusion but does not affect virion entry (Journal...
... we introduced a furin recognition site at single basic residues within the putative S1-S2 junctional region. We show that furin ... Title: Furin cleavage of the SARS coronavirus spike glycoprotein enhances cell-cell fusion but does not affect virion entry ... Journal Article: Furin cleavage of the SARS coronavirus spike glycoprotein enhances cell-cell fusion but does not affect virion ... The lack of effect of furin cleavage on virion infectivity mirrors that observed in the normally cleaved S glycoprotein of the ...
  https://www.osti.gov/scitech/biblio/20850527
*  Cutting Edge: ERK1 Mediates the Autocrine Positive Feedback Loop of TGF-β and Furin in Glioma-Initiating Cells | The Journal of...
Furin cleaves and promotes activation of pro-TGF-β1 and pro-TGF-β2, and TGF-β2 in turn increases furin levels. Notably, TGF-β2 ... furin-specific activity. GIC. glioma-initiating cell. NBM. neurobasal medium. PCSK. proprotein convertases subtilisin/kexin. ... We thus uncover a role of ERK1 in the regulation of furin activity by supporting a self-sustaining loop for high TGF-β activity ... Cutting Edge: ERK1 Mediates the Autocrine Positive Feedback Loop of TGF-β and Furin in Glioma-Initiating Cells. Elisa Ventura, ...
  http://www.jimmunol.org/content/198/12/4569
*  FURIN knockout cell line
Fast delivery of FURIN knockout Human Cell Lines for the study of gene function. Created by CRISPR/Cas9 genome editing. ... Human FURIN knockout cell line 2bp deletion. Genotype: FURIN HAP1 knockout HGNC Symbol: FURIN Price: $1,450.00 ... FURIN HAP1 knockout Cell Culture. Biosafety Level. 1 Media Type. IMDM, 10% FCS Freeze Medium. IMDM, 20% FCS, 10% DMSO Revival. ... FURIN Expression Level. 31.39 TPM Guide RNA Sequence. GACTAAACGGGACGTGTACC Targeted Transcript. NM_002569 Targeted Region. Exon ...
  https://www.horizondiscovery.com/human-furin-knockout-cell-line-hzghc001302c010
*  Mag-fura-2-acetoxymethyl ester | C30H30N2O19 - PubChem
Mag-fura-2-acetoxymethyl ester , C30H30N2O19 , CID 131176 - structure, chemical names, physical and chemical properties, ...
  https://pubchem.ncbi.nlm.nih.gov/compound/131176
*  Fura appoints Dev Shetty as President and CEO | Business Standard News
Fura Emeralds Inc. is pleased to announce the appointment of Devidas ('Dev') Shetty as the President and Chief Executive ... Read more about Fura appoints Dev Shetty as President and CEO on Business Standard. ... Fura appoints Dev Shetty as President and CEO ANI , Toronto [Canada]. Last Updated at January 25, 2017 18:22 IST ... Shetty will initially set-up a base in Dubai which will be a strategic location for Fura and will also operate from London and ...
  http://www.business-standard.com/article/news-ani/fura-appoints-dev-shetty-as-president-and-ceo-117012500939_1.html
*  TSA: Mustela putorius furo Ferret c49334, complete sequence, mRNA sequ - Nucleotide - NCBI
TSA: Mustela putorius furo Ferret_c49334, complete sequence, mRNA sequence TSA: Mustela putorius furo Ferret_c49334, complete ... TSA: Mustela putorius furo Ferret_c49334, complete sequence, mRNA sequence. GenBank: EZ505773.1 ...
  https://www.ncbi.nlm.nih.gov/nucleotide/291146892
*  Mustela putorius furo breed Sable isolate ID#1420 contig000525, whole - Nucleotide - NCBI
Mustela putorius furo breed Sable isolate ID#1420 contig000525, whole genome shotgun sequence. GenBank: AEYP01000525.1 ...
  https://www.ncbi.nlm.nih.gov/nuccore/334682223?report=fasta
*  Mustela putorius furo breed Sable isolate ID#4666 contig061010, whole - Nucleotide - NCBI
Mustela putorius furo breed Sable isolate ID#4666 contig061010, whole genome sho... Mustela putorius furo breed Sable isolate ... Mustela putorius furo breed Sable isolate ID#4666 contig061010, whole genome shotgun sequence. GenBank: AGTQ01061010.1 ...
  https://www.ncbi.nlm.nih.gov/nucleotide/363919314
*  Mustela putorius furo breed Sable isolate ID#1420 contig000109, whole - Nucleotide - NCBI
Mustela putorius furo breed Sable isolate ID#1420 contig000109, whole genome shotgun sequence. GenBank: AEYP01000109.1 ...
  https://www.ncbi.nlm.nih.gov/nuccore/334682639?report=graph
*  Furin - Wikipedia
Furin is a protein that in humans is encoded by the FURIN gene. Some proteins are inactive when they are first synthesized, and ... Furin cleaves these sections and activates the proteins. It was named furin because it was in the upstream region of an ... Furin is enriched in the Golgi apparatus, where it functions to cleave other proteins into their mature/active forms. Furin ... Expression of furin in T-cells is required for maintenance of peripheral immune tolerance. Furin has been shown to interact ...
  https://en.wikipedia.org/wiki/Furin
*  Fura 2 magnesium-selective analog tetrapotassium salt ~90% (TLC) | Sigma-Aldrich
Fura 2 magnesium-selective analog tetrapotassium salt for your research needs. Find product specific information including CAS ...
  https://www.sigmaaldrich.com/catalog/product/sial/f5645?lang=en®ion=US
*  Squire Fura-Zone Ointment by Neogen Reviews @ Horse Tack Review
Product:Squire Fura-Zone Ointment. Make:Neogen. For Sale on eBay. For Sale on Amazon Number of reviews of the product found: 1 ...
  http://www.horsetackreview.com/product-display.php?ID=854
*  FURA Outdoor Titanium Alloy Waterproof Container - Blue
... Daily Deal 1. Made of TC4 titanimu alloy, acid and alkali resistant, ... FURA Outdoor Titanium Alloy Waterproof Container - Blue Discussion. There are no discussions for this deal. You can start a new ... FURA Outdoor Titanium Alloy Waterproof Container - Blue. ← Daily Deals Deal age: More than 24 hours DX.com offers this deal on ...
  https://www.dealsucker.com/deal/FURA-Outdoor-Titanium-Alloy-Waterproof-Container/600001/
*  Furo - Wikipedia
This type of furo was the precursor of the modern Western-style hot tub.[citation needed] Furo are part of the Japanese ritual ... Traditional pot shaped cast iron furo were heated by a wood-burning stove built-in below them. Furo (or yubune (湯船) that ... Furo (風呂), or the more common and polite form ofuro (お風呂), is a Japanese bath. Specifically it is a type of bath which ... A furo differs from a conventional Western bathtub by being of a deeper construction, typically in the region of 0.6 m (25 ...
  https://en.wikipedia.org/wiki/Furo
*  Furi - Wikipedia
"Furi for PlayStation 4 Reviews". Metacritic. Retrieved 4 July 2016. Devore, Jordan (5 July 2016). "Review: Furi". Destructoid. ... Rad, Chloi (13 July 2016). "Furi Review". IGN. Retrieved 13 July 2016. Davenport, James (6 July 2016). "Furi review". PC Gamer ... Blondeau, Elias (5 July 2016). "Furi Review". Game Revolution. Retrieved 5 July 2016. Brown, Peter (9 July 2016). "Furi Review ... Duck360Gaming2 (6 July 2016), Furi: All Endings (PS4/1080p), retrieved 4 December 2016 "Furi for PC Reviews". Metacritic. ...
  https://en.wikipedia.org/wiki/Furi
*  Furen - Wikipedia
Furen may refer to: Fūren, Hokkaido, town Hokkaido, Japan Lake Furen, lake in Hokkaido, Japan Furen Point, rocky point in ... Antarctica Furen University, or Fu Jen Catholic University, university in Taiwan Furen Literary Society, Hong Kong organization ...
  https://en.wikipedia.org/wiki/Furen

(1/678) Subtilisin-like proprotein convertases, PACE4 and PC8, as well as furin, are endogenous proalbumin convertases in HepG2 cells.

Serum albumin is synthesized as a larger precursor form, proalbumin, which undergoes proteolytic processing at a dibasic site by a hepatic proprotein convertase within the secretory pathway to generate the mature form. Although furin, a member of the subtilisin-like proprotein convertase (SPC) family, was thought to be the only candidate hepatic convertase for proalbumin, SPC family members other than furin were recently suggested to also be involved in proalbumin processing. This study was designed to identify the endogenous proprotein convertases involved in proalbumin processing. Since human hepatoma HepG2 cells are highly differentiated and produce major plasma proteins, this cell line was used as a model for hepatocytes. Northern blot analysis revealed that PACE4, furin and PC8 of the SPC family were expressed in HepG2 cells as well as in the liver. Ribonuclease protection assay showed that PACE4A-II mRNA is the major transcript in HepG2 cells among the PACE4 isoforms. The coexpression studies showed that furin, PACE4A-II and PC8 were all able to convert proalbumin to albumin correctly. To elucidate the roles of these endogenous SPC family members in proalbumin processing, the antisense RNA for PACE4, furin and PC8 was stably expressed in HepG2 cells, respectively. The expression of each antisense RNA resulted in approximately 30% inhibition of endogenous proalbumin processing. We therefore concluded that PACE4 and PC8, as well as furin, are involved in the processing of proalbumin in HepG2 cells, and that these SPC family members are functionally redundant in this processing.  (+info)

(2/678) Differential sorting of nerve growth factor and brain-derived neurotrophic factor in hippocampal neurons.

Nerve growth factor (NGF) is released through the constitutive secretory pathway from cells in peripheral tissues and nerves where it can act as a target-derived survival factor. In contrast, brain-derived neurotrophic factor (BDNF) appears to be processed in the regulated secretory pathway of brain neurons and secreted in an activity-dependent manner to play a role in synaptic plasticity. To determine whether sorting differences are intrinsic to the neurotrophins or reflect differences between cell types, we compared NGF and BDNF processing in cultured hippocampal neurons using a Vaccinia virus expression system. Three independent criteria (retention or release from cells after pulse-chase labeling, depolarization-dependent release, and immunocytochemical localization) suggest that the bulk of newly synthesized NGF is sorted into the constitutive pathway, whereas BDNF is primarily sorted into the regulated secretory pathway. Similar results occurred with AtT 20 cells, including those transfected with cDNAs encoding neurotrophin precursor-green fluorescent protein fusions. The NGF precursor, but not the BDNF precursor, is efficiently cleaved by the endoprotease furin in the trans-Golgi network (TGN). Blocking furin activity in AtT 20 cells with alpha1-PDX as well as increasing the expression of NGF precursor partially directed NGF into the regulated secretory pathway. Therefore, neurotrophins can be sorted into either the constitutive or regulated secretory pathways, and sorting may be regulated by the efficiency of furin cleavage in the TGN. This mechanism may explain how neuron-generated neurotrophins can act both as survival factors and as neuropeptides.  (+info)

(3/678) Sorting of furin at the trans-Golgi network. Interaction of the cytoplasmic tail sorting signals with AP-1 Golgi-specific assembly proteins.

The eukaryotic subtilisin-like endoprotease furin is found predominantly in the trans-Golgi network (TGN) and cycles between this compartment, the cell surface, and the endosomes. There is experimental evidence for endocytosis from the plasma membrane and transport from endosomes to the TGN, but direct exit from the TGN to endosomes via clathrin-coated vesicles has only been discussed but not directly shown so far. Here we present data showing that expression of furin promotes the first step of clathrin-coat assembly at the TGN, the recruitment of the Golgi-specific assembly protein AP-1 on Golgi membranes. Further, we report that furin indeed is present in isolated clathrin-coated vesicles. Packaging into clathrin-coated vesicles requires signal components in the furin cytoplasmic domain which can be recognized by AP-1 assembly proteins. We found that besides depending on the phosphorylation state of a casein kinase II site, interaction of the furin tail with AP-1 and its mu1subunit is mediated by a tyrosine motif and to less extent by a leucine-isoleucine signal, whereas a monophenylalanine motif is only involved in binding to the intact AP-1 complex. This study implies that high affinity interaction of AP-1 or mu1 with the cytoplasmic tail of furin needs a complex interplay of signal components rather than one distinct signal.  (+info)

(4/678) Basolateral sorting of furin in MDCK cells requires a phenylalanine-isoleucine motif together with an acidic amino acid cluster.

Furin is a subtilisin-related endoprotease which processes a wide range of bioactive proteins. Furin is concentrated in the trans-Golgi network (TGN), where proteolytic activation of many precursor proteins takes place. A significant fraction of furin, however, cycles among the TGN, the plasma membrane, and endosomes, indicating that the accumulation in the TGN reflects a dynamic localization process. The cytosolic domain of furin is necessary and sufficient for TGN localization, and two signals are responsible for retrieval of furin to the TGN. A tyrosine-based (YKGL) motif mediates internalization of furin from the cell surface into endosomes. An acidic cluster that is part of two casein kinase II phosphorylation sites (SDSEEDE) is then responsible for retrieval of furin from endosomes to the TGN. In addition, the acidic EEDE sequence also mediates endocytic activity. Here, we analyzed the sorting of furin in polarized epithelial cells. We show that furin is delivered to the basolateral surface of MDCK cells, from where a significant fraction of the protein can return to the TGN. A phenylalanine-isoleucine motif together with the acidic EEDE cluster is required for basolateral sorting and constitutes a novel signal regulating intracellular traffic of furin.  (+info)

(5/678) Processing of the fibrillin-1 carboxyl-terminal domain.

To investigate the processing and general properties of the fibrillin-1 carboxyl-terminal domain, three protein expression constructs have been developed as follows: one without the domain, one with the domain, and one with a mutation near the putative proteolytic processing site. The constructs have been expressed in two eukaryotic model systems, baculoviral and CHO-K1. Post-translational modifications that normally occur in fibrillin-1, including glycosylation, signal peptide cleavage, and carboxyl-terminal processing, occur in the three constructs in both cell systems. Amino-terminal sequencing of secreted protein revealed leader sequence processing at two sites, a primary site between Gly-24/Ala-25 and a secondary site of Ala-27/Asn-28. Processing of the carboxyl-terminal domain could be observed by migration differences in SDS-polyacrylamide gel electrophoresis and was evident in both mammalian and insect cells. Immunological identification by Western blotting confirmed the loss of the expected region. The failure of both cell systems to process the mutant construct shows that the multi-basic sequence is the site of proteolytic processing. Cleavage of the fibrillin-1 carboxyl-terminal domain occurred intracellularly in CHO-K1 cells in an early secretory pathway compartment as demonstrated by studies with secretion blocking agents. This finding, taken with the multi-basic nature of the cleavage site and observed calcium sensitivity of cleavage, suggests that the processing enzyme is a secretory pathway resident furin-like protease.  (+info)

(6/678) Carboxy-terminal conversion of profibrillin to fibrillin at a basic site by PACE/furin-like activity required for incorporation in the matrix.

Fibrillin-1, the main component of 10-12 nm microfibrils of the extracellular matrix, is synthesized as profibrillin and proteolytically processed to fibrillin. The putative cleavage site has been mapped to the carboxy-terminal domain of profibrillin-1, between amino acids arginine 2731 and serine 2732, by a spontaneous mutation in this recognition site that prevents profibrillin conversion. This site contains a basic amino acid recognition sequence (R-G-R-K-R-R) for proprotein convertases of the furin/PACE family. In this study, we use a mini-profibrillin protein to confirm the cleavage in the carboxy-terminal domain by both fibroblasts and recombinantly expressed furin/PACE, PACE4, PC1/3 and PC2. Site-directed mutagenesis of amino acids in the consensus recognition motif prevented conversion, thereby identifying the scissile bond and characterizing the basic amino acids required for cleavage. Using a PACE/furin inhibitor, we show that wild-type profibrillin is not incorporated into the extracellular matrix until it is converted to fibrillin. Therefore, profibrillin-1 is the first extracellular matrix protein to be shown to be a substrate for subtilisin-like proteases, and the conversion of profibrillin to fibrillin controls microfibrillogenesis through exclusion of uncleaved profibrillin.  (+info)

(7/678) Endoprotease PACE4 is Ca2+-dependent and temperature-sensitive and can partly rescue the phenotype of a furin-deficient cell strain.

PACE4 is a member of the eukaryotic subtilisin-like endoprotease family. The expression of human PACE4 in RPE.40 cells (furin-null mutants derived from Chinese hamster ovary K1 cells) resulted in the rescue of a number of wild-type characteristics, including sensitivity to Sindbis virus and the ability to process the low-density-lipoprotein receptor-related protein. Expression of PACE4 in these cells failed to restore wild-type sensitivity to Pseudomonas exotoxin A. Co-expression of human PACE4 in these cells with either a secreted form of the human insulin pro-receptor or the precursor form of von Willebrand factor resulted in both proproteins being processed; RPE.40 cells were unable to process either precursor protein in the absence of co-expressed PACE4. Northern analysis demonstrated that untransfected RPE.40 cells express mRNA species for four PACE4 isoforms, suggesting that any endogenous PACE4 proteins produced by these cells are either non-functional or sequestered in a compartment outside of the secretory pathway. In experiments in vitro, PACE4 processed diphtheria toxin and anthrax toxin protective antigen, but not Pseudomonas exotoxin A. The activity of PACE4 in vitro was Ca2+-dependent and, unlike furin, was sensitive to temperature changes between 22 and 37 degrees C. RPE.40 cells stably expressing human PACE4 secreted an endoprotease with the same Ca2+ dependence and temperature sensitivity as that observed in membrane fractions of these cells assayed in vitro. These results, in conjunction with other published work, demonstrate that PACE4 is an endoprotease with more stringent substrate specificity and more limited operating parameters than furin.  (+info)

(8/678) The furin protease cleavage recognition sequence of Sindbis virus PE2 can mediate virion attachment to cell surface heparan sulfate.

Cell culture-adapted Sindbis virus strains attach to heparan sulfate (HS) receptors during infection of cultured cells (W. B. Klimstra, K. D. Ryman, and R. E. Johnston, J. Virol. 72:7357-7366, 1998). At least three E2 glycoprotein mutations (E2 Arg 1, E2 Lys 70, and E2 Arg 114) can independently confer HS attachment in the background of the consensus sequence Sindbis virus (TR339). In the studies reported here, we have investigated the mechanism by which the E2 Arg 1 mutation confers HS-dependent binding. Substitution of Arg for Ser at E2 1 resulted in a significant reduction in the efficiency of PE2 cleavage, yielding virus particles containing a mixture of PE2 and mature E2. Presence of PE2 was associated with an increase in HS-dependent attachment to cells and efficient attachment to heparin-agarose beads, presumably because the furin recognition site for PE2 cleavage also represents a candidate HS binding sequence. A comparison of mutants with partially or completely inhibited PE2 cleavage demonstrated that efficiency of cell binding was correlated with the amount of PE2 in virus particles. Viruses rendered cleavage defective due to deletions of portions or all of the furin cleavage sequence attached very poorly to cells, indicating that an intact furin cleavage sequence was specifically required for PE2-mediated attachment to cells. In contrast, a virus containing a partial deletion was capable of efficient binding to heparin-agarose beads, suggesting different requirements for heparin bead and cell surface HS binding. Furthermore, virus produced in C6/36 mosquito cells, which cleave PE2 more efficiently than BHK cells, exhibited a reduction in cell attachment efficiency correlated with reduced content of PE2 in particles. Taken together, these results strongly argue that the XBXBBX (B, basic; X, hydrophobic) furin protease recognition sequence of PE2 can mediate the binding of PE2-containing Sindbis viruses to HS. This sequence is very similar to an XBBXBX heparin-HS interaction consensus sequence. The attachment of furin protease cleavage sequences to HS may have relevance to other viruses whose attachment proteins are cleaved during maturation at positively charged recognition sequences.  (+info)