Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Base Pairing: Pairing of purine and pyrimidine bases by HYDROGEN BONDING in double-stranded DNA or RNA.Nucleic Acid Conformation: The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.DNA: A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).Base Composition: The relative amounts of the PURINES and PYRIMIDINES in a nucleic acid.Nucleic Acid Denaturation: Disruption of the secondary structure of nucleic acids by heat, extreme pH or chemical treatment. Double strand DNA is "melted" by dissociation of the non-covalent hydrogen bonds and hydrophobic interactions. Denatured DNA appears to be a single-stranded flexible structure. The effects of denaturation on RNA are similar though less pronounced and largely reversible.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Nucleic Acid Renaturation: The reformation of all, or part of, the native conformation of a nucleic acid molecule after the molecule has undergone denaturation.Oligonucleotides: Polymers made up of a few (2-20) nucleotides. In molecular genetics, they refer to a short sequence synthesized to match a region where a mutation is known to occur, and then used as a probe (OLIGONUCLEOTIDE PROBES). (Dorland, 28th ed)Nucleic Acid Hybridization: Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)Oligodeoxyribonucleotides: A group of deoxyribonucleotides (up to 12) in which the phosphate residues of each deoxyribonucleotide act as bridges in forming diester linkages between the deoxyribose moieties.Polydeoxyribonucleotides: A group of 13 or more deoxyribonucleotides in which the phosphate residues of each deoxyribonucleotide act as bridges in forming diester linkages between the deoxyribose moieties.Aminacrine: A highly fluorescent anti-infective dye used clinically as a topical antiseptic and experimentally as a mutagen, due to its interaction with DNA. It is also used as an intracellular pH indicator.DNA, Viral: Deoxyribonucleic acid that makes up the genetic material of viruses.DNA, Bacterial: Deoxyribonucleic acid that makes up the genetic material of bacteria.RNA, Ribosomal, 18S: Constituent of the 40S subunit of eukaryotic ribosomes. 18S rRNA is involved in the initiation of polypeptide synthesis in eukaryotes.Escherichia coli: A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.Poly dA-dT: Polydeoxyribonucleotides made up of deoxyadenine nucleotides and thymine nucleotides. Present in DNA preparations isolated from crab species. Synthetic preparations have been used extensively in the study of DNA.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.RNA, Ribosomal: The most abundant form of RNA. Together with proteins, it forms the ribosomes, playing a structural role and also a role in ribosomal binding of mRNA and tRNAs. Individual chains are conventionally designated by their sedimentation coefficients. In eukaryotes, four large chains exist, synthesized in the nucleolus and constituting about 50% of the ribosome. (Dorland, 28th ed)Skull Base: The inferior region of the skull consisting of an internal (cerebral), and an external (basilar) surface.GuanineSequence Homology, Nucleic Acid: The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.DNA, Circular: Any of the covalently closed DNA molecules found in bacteria, many viruses, mitochondria, plastids, and plasmids. Small, polydisperse circular DNA's have also been observed in a number of eukaryotic organisms and are suggested to have homology with chromosomal DNA and the capacity to be inserted into, and excised from, chromosomal DNA. It is a fragment of DNA formed by a process of looping out and deletion, containing a constant region of the mu heavy chain and the 3'-part of the mu switch region. Circular DNA is a normal product of rearrangement among gene segments encoding the variable regions of immunoglobulin light and heavy chains, as well as the T-cell receptor. (Riger et al., Glossary of Genetics, 5th ed & Segen, Dictionary of Modern Medicine, 1992)Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Genes: A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.Saccharomyces: A genus of ascomycetous fungi of the family Saccharomycetaceae, order SACCHAROMYCETALES.Schiff Bases: Condensation products of aromatic amines and aldehydes forming azomethines substituted on the N atom, containing the general formula R-N:CHR. (From Grant & Hackh's Chemical Dictionary, 5th ed)Intercalating Agents: Agents that are capable of inserting themselves between the successive bases in DNA, thus kinking, uncoiling or otherwise deforming it and therefore preventing its proper functioning. They are used in the study of DNA.Plasmids: Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.Models, Molecular: Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.RNA: A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)Adenine: A purine base and a fundamental unit of ADENINE NUCLEOTIDES.Saccharomycetales: An order of fungi in the phylum Ascomycota that multiply by budding. They include the telomorphic ascomycetous yeasts which are found in a very wide range of habitats.DNA Restriction Enzymes: Enzymes that are part of the restriction-modification systems. They catalyze the endonucleolytic cleavage of DNA sequences which lack the species-specific methylation pattern in the host cell's DNA. Cleavage yields random or specific double-stranded fragments with terminal 5'-phosphates. The function of restriction enzymes is to destroy any foreign DNA that invades the host cell. Most have been studied in bacterial systems, but a few have been found in eukaryotic organisms. They are also used as tools for the systematic dissection and mapping of chromosomes, in the determination of base sequences of DNAs, and have made it possible to splice and recombine genes from one organism into the genome of another. EC 3.21.1.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Repetitive Sequences, Nucleic Acid: Sequences of DNA or RNA that occur in multiple copies. There are several types: INTERSPERSED REPETITIVE SEQUENCES are copies of transposable elements (DNA TRANSPOSABLE ELEMENTS or RETROELEMENTS) dispersed throughout the genome. TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. Variations may be direct repeats, those occurring in the same direction, or inverted repeats, those opposite to each other in direction. TANDEM REPEAT SEQUENCES are copies which lie adjacent to each other, direct or inverted (INVERTED REPEAT SEQUENCES).RNA, Viral: Ribonucleic acid that makes up the genetic material of viruses.Transcription, Genetic: The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.DNA, Single-Stranded: A single chain of deoxyribonucleotides that occurs in some bacteria and viruses. It usually exists as a covalently closed circle.Deoxyribonucleotides: A purine or pyrimidine base bonded to a DEOXYRIBOSE containing a bond to a phosphate group.Species Specificity: The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.Thermodynamics: A rigorously mathematical analysis of energy relationships (heat, work, temperature, and equilibrium). It describes systems whose states are determined by thermal parameters, such as temperature, in addition to mechanical and electromagnetic parameters. (From Hawley's Condensed Chemical Dictionary, 12th ed)Poly A: A group of adenine ribonucleotides in which the phosphate residues of each adenine ribonucleotide act as bridges in forming diester linkages between the ribose moieties.TritiumColiphages: Viruses whose host is Escherichia coli.RNA, Messenger: RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.Kinetics: The rate dynamics in chemical or physical systems.Oligoribonucleotides: A group of ribonucleotides (up to 12) in which the phosphate residues of each ribonucleotide act as bridges in forming diester linkages between the ribose moieties.Hybridization, Genetic: The genetic process of crossbreeding between genetically dissimilar parents to produce a hybrid.Temperature: The property of objects that determines the direction of heat flow when they are placed in direct thermal contact. The temperature is the energy of microscopic motions (vibrational and translational) of the particles of atoms.Chemistry: A basic science concerned with the composition, structure, and properties of matter; and the reactions that occur between substances and the associated energy exchange.Genes, Bacterial: The functional hereditary units of BACTERIA.RNA, Bacterial: Ribonucleic acid in bacteria having regulatory and catalytic roles as well as involvement in protein synthesis.Chemical Phenomena: The composition, conformation, and properties of atoms and molecules, and their reaction and interaction processes.Nucleotides: The monomeric units from which DNA or RNA polymers are constructed. They consist of a purine or pyrimidine base, a pentose sugar, and a phosphate group. (From King & Stansfield, A Dictionary of Genetics, 4th ed)RNA, Fungal: Ribonucleic acid in fungi having regulatory and catalytic roles as well as involvement in protein synthesis.Binding Sites: The parts of a macromolecule that directly participate in its specific combination with another molecule.Genes, Viral: The functional hereditary units of VIRUSES.Restriction Mapping: Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.Hot Temperature: Presence of warmth or heat or a temperature notably higher than an accustomed norm.Transformation, Genetic: Change brought about to an organisms genetic composition by unidirectional transfer (TRANSFECTION; TRANSDUCTION, GENETIC; CONJUGATION, GENETIC, etc.) and incorporation of foreign DNA into prokaryotic or eukaryotic cells by recombination of part or all of that DNA into the cell's genome.Magnetic Resonance Spectroscopy: Spectroscopic method of measuring the magnetic moment of elementary particles such as atomic nuclei, protons or electrons. It is employed in clinical applications such as NMR Tomography (MAGNETIC RESONANCE IMAGING).Templates, Genetic: Macromolecular molds for the synthesis of complementary macromolecules, as in DNA REPLICATION; GENETIC TRANSCRIPTION of DNA to RNA, and GENETIC TRANSLATION of RNA into POLYPEPTIDES.Molecular Weight: The sum of the weight of all the atoms in a molecule.Centrifugation, Density Gradient: Separation of particles according to density by employing a gradient of varying densities. At equilibrium each particle settles in the gradient at a point equal to its density. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)DNA, Recombinant: Biologically active DNA which has been formed by the in vitro joining of segments of DNA from different sources. It includes the recombination joint or edge of a heteroduplex region where two recombining DNA molecules are connected.Ribonucleases: Enzymes that catalyze the hydrolysis of ester bonds within RNA. EC 3.1.-.Endonucleases: Enzymes that catalyze the hydrolysis of the internal bonds and thereby the formation of polynucleotides or oligonucleotides from ribo- or deoxyribonucleotide chains. EC 3.1.-.Phylogeny: The relationships of groups of organisms as reflected by their genetic makeup.Substrate Specificity: A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.DNA Probes: Species- or subspecies-specific DNA (including COMPLEMENTARY DNA; conserved genes, whole chromosomes, or whole genomes) used in hybridization studies in order to identify microorganisms, to measure DNA-DNA homologies, to group subspecies, etc. The DNA probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the DNA probe include the radioisotope labels 32P and 125I and the chemical label biotin. The use of DNA probes provides a specific, sensitive, rapid, and inexpensive replacement for cell culture techniques for diagnosing infections.Cell Line: Established cell cultures that have the potential to propagate indefinitely.Structure-Activity Relationship: The relationship between the chemical structure of a compound and its biological or pharmacological activity. Compounds are often classed together because they have structural characteristics in common including shape, size, stereochemical arrangement, and distribution of functional groups.DNA Replication: The process by which a DNA molecule is duplicated.Polymerase Chain Reaction: In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.Skull Base Neoplasms: Neoplasms of the base of the skull specifically, differentiated from neoplasms of unspecified sites or bones of the skull (SKULL NEOPLASMS).Promoter Regions, Genetic: DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.DNA Primers: Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.Models, Chemical: Theoretical representations that simulate the behavior or activity of chemical processes or phenomena; includes the use of mathematical equations, computers, and other electronic equipment.Biological Evolution: The process of cumulative change over successive generations through which organisms acquire their distinguishing morphological and physiological characteristics.Base Pair Mismatch: The presence of an uncomplimentary base in double-stranded DNA caused by spontaneous deamination of cytosine or adenine, mismatching during homologous recombination, or errors in DNA replication. Multiple, sequential base pair mismatches lead to formation of heteroduplex DNA; (NUCLEIC ACID HETERODUPLEXES).Circular Dichroism: A change from planar to elliptic polarization when an initially plane-polarized light wave traverses an optically active medium. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)Sequence Analysis, DNA: A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.DNA-Directed RNA Polymerases: Enzymes that catalyze DNA template-directed extension of the 3'-end of an RNA strand one nucleotide at a time. They can initiate a chain de novo. In eukaryotes, three forms of the enzyme have been distinguished on the basis of sensitivity to alpha-amanitin, and the type of RNA synthesized. (From Enzyme Nomenclature, 1992).Sequence Alignment: The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.Microscopy, Electron: Microscopy using an electron beam, instead of light, to visualize the sample, thereby allowing much greater magnification. The interactions of ELECTRONS with specimens are used to provide information about the fine structure of that specimen. In TRANSMISSION ELECTRON MICROSCOPY the reactions of the electrons that are transmitted through the specimen are imaged. In SCANNING ELECTRON MICROSCOPY an electron beam falls at a non-normal angle on the specimen and the image is derived from the reactions occurring above the plane of the specimen.Protein Biosynthesis: The biosynthesis of PEPTIDES and PROTEINS on RIBOSOMES, directed by MESSENGER RNA, via TRANSFER RNA that is charged with standard proteinogenic AMINO ACIDS.Electrophoresis, Polyacrylamide Gel: Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.Denture Bases: The part of a denture that overlies the soft tissue and supports the supplied teeth and is supported in turn by abutment teeth or the residual alveolar ridge. It is usually made of resins or metal or their combination.Bacterial Proteins: Proteins found in any species of bacterium.Computer Simulation: Computer-based representation of physical systems and phenomena such as chemical processes.Viral Proteins: Proteins found in any species of virus.DNA, Ribosomal: DNA sequences encoding RIBOSOMAL RNA and the segments of DNA separating the individual ribosomal RNA genes, referred to as RIBOSOMAL SPACER DNA.DNA-Binding Proteins: Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.Protein Binding: The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.DNA Damage: Injuries to DNA that introduce deviations from its normal, intact structure and which may, if left unrepaired, result in a MUTATION or a block of DNA REPLICATION. These deviations may be caused by physical or chemical agents and occur by natural or unnatural, introduced circumstances. They include the introduction of illegitimate bases during replication or by deamination or other modification of bases; the loss of a base from the DNA backbone leaving an abasic site; single-strand breaks; double strand breaks; and intrastrand (PYRIMIDINE DIMERS) or interstrand crosslinking. Damage can often be repaired (DNA REPAIR). If the damage is extensive, it can induce APOPTOSIS.Knowledge Bases: Collections of facts, assumptions, beliefs, and heuristics that are used in combination with databases to achieve desired results, such as a diagnosis, an interpretation, or a solution to a problem (From McGraw Hill Dictionary of Scientific and Technical Terms, 6th ed).Mannich Bases: Ketonic amines prepared from the condensation of a ketone with formaldehyde and ammonia or a primary or secondary amine. A Mannich base can act as the equivalent of an alpha,beta unsaturated ketone in synthesis or can be reduced to form physiologically active amino alcohols.DNA Glycosylases: A family of DNA repair enzymes that recognize damaged nucleotide bases and remove them by hydrolyzing the N-glycosidic bond that attaches them to the sugar backbone of the DNA molecule. The process called BASE EXCISION REPAIR can be completed by a DNA-(APURINIC OR APYRIMIDINIC SITE) LYASE which excises the remaining RIBOSE sugar from the DNA.DNA Repair: The reconstruction of a continuous two-stranded DNA molecule without mismatch from a molecule which contained damaged regions. The major repair mechanisms are excision repair, in which defective regions in one strand are excised and resynthesized using the complementary base pairing information in the intact strand; photoreactivation repair, in which the lethal and mutagenic effects of ultraviolet light are eliminated; and post-replication repair, in which the primary lesions are not repaired, but the gaps in one daughter duplex are filled in by incorporation of portions of the other (undamaged) daughter duplex. Excision repair and post-replication repair are sometimes referred to as "dark repair" because they do not require light.ThymineHydrogen Bonding: A low-energy attractive force between hydrogen and another element. It plays a major role in determining the properties of water, proteins, and other compounds.Uracil

*  RACE for 5' and 3' cDNA ends, even for GC-rich transcripts

As such, it is important to have 5'- and 3'-sequence information in order to learn more about the different transcripts that ... SD Base * Yeast Media-One Hybrid * Yeast Media Two-Hybrid * YPDA & YPD Rich Media ... Researchers often rely on Rapid Amplification of cDNA Ends (RACE) to acquire full-length sequence of RNA transcripts. If you ...
clontech.com/US/Products/cDNA_Synthesis_and_Library_Construction/RACE_Rapid_Amplification_of_cDNA_Ends/RACE_Overview?sitex=10020:22372:US&PEBCL1=VL7Ukb9SozfnQSshw3k1MN97DG&PEBCL1_pses=ZG8C3038E824F845C970873F30B3A0077DC5A32C0A5D62B6F5632C3A5231A5E6904D5F42C186A6E27658D9C3631826AC676CABECEE3AE516B6

*  At least 1400 base pairs of 5'-flanking DNA is required for the correct expression of the HO gene in yeast. - Oxford...

Base Sequence, Cell Cycle, Chromosome Deletion, DNA, Fungal, Endodeoxyribonucleases, Gene Expression Regulation, Genes, Fungal ... At least 1400 base pairs of 5'-flanking DNA is required for the correct expression of the HO gene in yeast. ... At least 1400 base pairs of 5'-flanking DNA is required for the correct expression of the HO gene in yeast. ...
https://neuroscience.ox.ac.uk/publications/98379

*  Transcriptome Profiling Using Single-Molecule Direct RNA Sequencing | SpringerLink

Highly integrated single-base resolution maps of the epigenome in Arabidopsis, Cell 133, 523- 536.PubMedCrossRefGoogle Scholar ... elegans reveals a lack of universal sequence-dictated positioning, Genome Res 18, 1051-1063.Google Scholar ...
https://link.springer.com/protocol/10.1007/978-1-61779-089-8_4

*  DNA Sequencing - Revision Notes in A Level and IB Biology

... a computer takes them up and notes down the sequence of bases. As the fragments get larger, one base is added each time, so ... eventually the computer has built up the entire sequence of the whole DNA strand ...
https://getrevising.co.uk/revision-notes/dna_sequencing

*  DNA Sequences

If a user wants to insert a long DNA sequence with a dial-up modem connection, it would be advisable to use only 200 letter ... Homo sapiens have 23 chromosome pairs with a total of 3 x 10 to the power 9 pairs of DNA molecules (base pairs) [this is how ... Users can input any DNA sequence of A's, T's G's and C's. Some DNA sequences have N's, which must be removed. Users can search ... Some triplet base pairs of nucleotides are called codons. Codons along with other nucleotides and enzymes generate amino acids ...
musicalgorithms.ewu.edu/learnmore/DNAseq.html

*  Mouse TCR Profiling

The SMART-Seq v4 Oligonucleotide contains a sequence that is complementary to the non-templated nucleotides added by the RT, ... MS-102-3003) with paired-end, 2 x 300 base pair reads. ... sequence variation in the CDR3 region serves as a useful proxy ... The mouse-specific kit uses a similar method with mouse sequence-specific primers; although the target species differs from the ... while still yielding sequence information for the beta chain. The TCR sequences identified were attributed to CD4+ T cells, ...
clontech.com/US/Products/cDNA_Synthesis_and_Library_Construction/NGS_Learning_Resources/Technical_Notes/Mouse_TCR_Profiling?sitex=10020:22372:US&PEBCL1=VL7Ukb9SozfnQSshw3k1MN97DG&PEBCL1_pses=ZG8C3038E824F845C970873F30B3A0077DC5A32C0A5D62B6F5632C3A5231A5E6904D5F42C186A6E27658D9C3631826AC676CABECEE3AE516B6

*  Patente US5851805 - Method for producing DNA from mRNA - Google Patentes

Displacement begins at the 5'-end of a base-paired nucleic acid sequence and proceeds in consequence of nucleic acid synthesis ... Both the newly synthesized and displaced nucleic acids have the same base sequence which is complementary to the template ... SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 2(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE ... SEQUENCE DESCRIPTION: SEQ ID NO:1:GTCTTATGTATGTATCTCGAATGCT25(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) ...
google.es/patents/US5851805?dq=flatulence

*  Patent US5187263 - Expression of biologically active PDGE analogs in eucaryotic cells - Google Patents

The DNA sequence may encode a protein substantially homologous to the A-chain or the B-chain of PDGF, or a portion thereof, or ... In addition, a portion of the DNA sequence may encode at least a portion of the A-chain, while another portion encodes at least ... The DNA construct contains a transcriptional promoter followed downstream by a suitable DNA sequence. ... the B-chain coding sequence (base 551 through 877 of FIG. 1B) of the v-sis gene, which is widely available, and the TPI ...
google.com.au/patents/US5187263

*  Base sequence specificity of counterion binding to DNA : what can MD simulations tell us?

Base sequence specificity of counterion binding to DNA: what can MD simulations tell us?. Atzori, Alessio ... Solvent molecules and ions are also believed to play an important role in mediating and directing both sequence recognition and ... DNA-counterion interactions, DNA sequence specificity, ion parameters, molecular dynamics National Category Chemical Sciences ... revealing a significant sequence dependence on the ion binding to both backbone and major groove. In the absence of ...
su.diva-portal.org/smash/record.jsf?pid=diva2:1074273

*  DOE'S GENE SEQUENCE DATA BASE SPINNING OFF FOR- PROFIT COMPANY | BioWorld

BioWorld Online is the news service of record for the biotechnology industry and is updated every business morning. BioWorld Online will keep you up to date on all of the industry's business, science and regulatory news -- mergers and collaborations, FDA hearings and results, breakthroughs in research and much more.
bioworld.com/content/does-gene-sequence-data-base-spinning-profit-company

*  SMITHKLINE ADDS UK'S MRC TO GROUPS ACCESSING GENE SEQUENCE DATA BASE | BioWorld

BioWorld Online is the news service of record for the biotechnology industry and is updated every business morning. BioWorld Online will keep you up to date on all of the industry's business, science and regulatory news -- mergers and collaborations, FDA hearings and results, breakthroughs in research and much more.
bioworld.com/content/smithkline-adds-uks-mrc-groups-accessing-gene-sequence-data-base

*  Sequence Similarity - 4JAB: U/G Wobble Base Pair in a RNA Duplex Sequence Similarity Report Page

2-Se Uridine enhanced U/G Wobble Base Pair Discrimination ... U/G Wobble Base Pair in a RNA Duplex. Display Files *FASTA ... Sequence Similarity Clusters for the Entities in PDB 4JAB Legend Entity #1 , Chains: A,B RNA (5'-R(*GP*UP*GP*UP*AP*UP*AP*C)-3 ... Blast this sequence against all of PDB Archive.. Rank. In each cluster, the chains are sorted (i.e. ranked) according to the ... The internal number of the sequence cluster used for unique identification.. Structural variation in clusters. The ...
rcsb.org/pdb/explore/sequenceCluster.do?structureId=4JAB&bionumber=1

*  Single Base Resolution DNA Methylation and Mutation Analysis in Long Sequence Runs - QIAGEN

Single Base Resolution DNA Methylation and Mutation Analysis in Long Sequence Runs. ... Our new technology, software, and chemistry overcome this bottleneck and give sequence reads that are typically twice as long ... Our new technology, software, and chemistry overcome this bottleneck and give sequence reads that are typically twice as long ... The real-time, high-resolution sequence output makes the technology highly suitable for applications including complex mutation ...
https://qiagen.com/it/resources/e-learning/webinars/genotyping/single-base-resolution-dna-methylation-and-mutation-analysis/

*  Sequence Similarity - 1D81: THE CONFORMATIONAL VARIABILITY OF AN ADENOSINE. INOSINE BASE-PAIR IN A SYNTHETIC DNA...

The conformational variability of an adenosine.inosine base-pair in a synthetic DNA dodecamer. ... Sequence Similarity Clusters for the Entities in PDB 1D81 Legend Entity #1 , Chains: A,B DNA (5'-D(*CP*GP*CP*AP*AP*AP*TP*TP*IP* ... Blast this sequence against all of PDB Archive.. Rank. In each cluster, the chains are sorted (i.e. ranked) according to the ... The internal number of the sequence cluster used for unique identification.. Structural variation in clusters. The ...
rcsb.org/pdb/explore/sequenceCluster.do?structureId=1D81

*  PUCCH format 2 demodulation reference signal - MATLAB ltePUCCH2DRS

PUCCH base sequence group number for each slot. two-column vector. PUCCH base sequence group number for each slot, returned as ... PUCCH base sequence number for each slot. two-column vector. PUCCH base sequence number for each slot, returned as two-column ... Orthogonal sequence for each slot. 4-by-2 numeric matrix. Orthogonal sequence for each slot, returned as a 4-by-2 numeric ...
mathworks.com/help/lte/ref/ltepucch2drs.html?requestedDomain=mathworks.com&nocookie=true

*  Order Sequence Number - Knowledge Base | Recurring Billing, Subscriptions for Ecommerce | ReCharge

Order Sequence Number. In some cases, you might need the order number your customer is set to receive in the next shipping ...
support.rechargepayments.com/article/349-order-number

*  Autoradiography

Base Sequence; Cytidine Triphosphate : .... Full article >>>. Encyclopedia article about Autoradiography. Information about ...
bio-medicine.org/biology-dictionary/Autoradiography/

*  Patent USRE36826 - Electrophoresis pattern reading system of fluorescence type - Google Patents

... pattern reading system of fluorescent type is comprised of a detachable migration unit comprising a gel functioning as a base ... Apparatus for determining base sequence. EP0294524A1 *. Jun 9, 1987. Dec 14, 1988. The Perkin-Elmer Corporation. Real time ... The sequence of the bases or the like determined by data processing is symbolized and then generated, thereby being displayed ... 13, so that, when the sequence of bases is given, the resolving ability for reading in the direction (the first scanning ...
google.com/patents/USRE36826?dq=645576

*  Effects of anti-nuclear factor kappa B reagents in blocking adhesion of human cancer cells to vascular endothelial cells.

Base Sequence. Cell Adhesion. Cell Adhesion Molecules / biosynthesis. Cells, Cultured. Endothelium, Vascular / cytology*, ... Molecular Sequence Data. NF-kappa B / antagonists & inhibitors, physiology*. Neoplasm Metastasis*. Reactive Oxygen Species. ...
biomedsearch.com/nih/Effects-anti-nuclear-factor-kappa/7545088.html

*  The sequence polymorphism of MnSOD gene in subjects with respiratory insufficiency in COPD.

Base Sequence. Female. Genotype. Health. Humans. Male. Middle Aged. Polymorphism, Single Nucleotide / genetics*. Pulmonary ... 11294545 - Clinical experience with infants with robin sequence: a prospective study.. 21725185 - Relationship between serum ...
biomedsearch.com/nih/sequence-polymorphism-MnSOD-gene-in/20802415.html

*  NF-kappaB p65 subunit mediates lipopolysaccharide-induced Na(+)/I(-) symporter gene expression by involving functional...

Base Sequence. Binding Sites. Enhancer Elements, Genetic / genetics. Gene Expression Regulation / drug effects*. Gene Silencing ... Molecular Sequence Data. Paired Box Transcription Factors / metabolism*. Protein Binding / drug effects. RNA, Messenger / ...
biomedsearch.com/nih/NF-kappaB-p65-Subunit-Mediates/20667985.html

*  Renal allograft rejection--in situ demonstration of cytotoxic intratubular cells.

Base Sequence. CD8-Positive T-Lymphocytes / immunology*. Cytotoxicity, Immunologic. DNA Primers / chemistry. Graft Rejection / ...
biomedsearch.com/nih/Renal-allograft-rejection-in-situ/8633386.html

*  Analysis of losses of heterozygosity of the candidate tumour suppressor gene DMBT1 in melanoma resection specimens.

Base Sequence. Chromosomes, Human, Pair 10*. DNA Primers. Genes, Tumor Suppressor*. Humans. Loss of Heterozygosity*. ...
biomedsearch.com/nih/Analysis-losses-heterozygosity-candidate-tumour/12239452.html

*  Characterization of the amino acid response element within the human sodium-coupled neutral amino acid transporter 2 (SNAT2)...

Base Sequence. CCAAT-Enhancer-Binding Proteins / genetics, metabolism. Cell Line. DNA / genetics, metabolism. Dimerization. ... Molecular Sequence Data. Promoter Regions, Genetic / genetics. Protein Binding. Protein Kinases / metabolism. Protein-Serine- ...
biomedsearch.com/nih/Characterization-amino-acid-response-element/16445384.html

*  The effects of a CD81 null mutation on retinal pigment epithelium in mice.

Base Sequence. DNA Primers. Mice. Mice, Inbred BALB C. Mutation*. Retinal Pigment Epithelium / metabolism*. ...
biomedsearch.com/nih/Effects-Cd81-Null-Mutation-Retinal/20882409.html

Symmetry element: A symmetry element is a point of reference about which symmetry operations can take place. In particular, symmetry elements can be centers of inversion, axes of rotation and mirror planes.Base pair: Base pairs (unit: bp), which form between specific nucleobases (also termed nitrogenous bases), are the building blocks of the DNA double helix and contribute to the folded structure of both DNA and RNA. Dictated by specific hydrogen bonding patterns, Watson-Crick base pairs (guanine-cytosine and adenine-thymine) allow the DNA helix to maintain a regular helical structure that is subtly dependent on its nucleotide sequence.Nucleic acid structure: Nucleic acid structure refers to the structure of nucleic acids such as DNA and RNA. Chemically speaking, DNA and RNA are very similar.DNA condensation: DNA condensation refers to the process of compacting DNA molecules in vitro or in vivo. Mechanistic details of DNA packing are essential for its functioning in the process of gene regulation in living systems.Hyperchromicity: Hyperchromicity is the increase of absorbance (optical density) of a material. The most famous example is the hyperchromicity of DNA that occurs when the DNA duplex is denatured.Coles PhillipsAbscription: During normal transcription, RNA polymerase transcribes a number of short nonproductive oligonucleotides, and this process is called abortive transcription. The trapped RNAPs have been named abscriptases and the synthesis of specific length oligonucleotides called abscription.CpG OligodeoxynucleotideList of strains of Escherichia coli: Escherichia coli is a well studied bacterium that was first identified by Theodor Escherich, after whom it was later named.Ligation-independent cloning: Ligation-independent cloning (LIC) is a form of molecular cloning that is able to be performed without the use of restriction endonucleases or DNA ligase. This allows genes that have restriction sites to be cloned without worry of chopping up the insert.MT-RNR2: Mitochondrially encoded 16S RNA (often abbreviated as 16S) is a mitochondrial ribosomal RNA (rRNA) that in humans is encoded by the MT-RNR2 gene. The MT-RNR2 gene also encodes the Humanin polypeptide that has been the target of Alzheimer's disease research.CccDNA: cccDNA (covalently closed circular DNA) is a special DNA structure that arises during the propagation of some viruses in the cell nucleus and may remain permanently there. It is a double-stranded DNA that originates in a linear form that is ligated by means of DNA ligase to a covalently closed ring.Protein primary structure: The primary structure of a peptide or protein is the linear sequence of its amino acid structural units, and partly comprises its overall biomolecular structure. By convention, the primary structure of a protein is reported starting from the amino-terminal (N) end to the carboxyl-terminal (C) end.Saccharomyces boulardii: Saccharomyces boulardii is a tropical strain of yeast first isolated from lychee and mangosteen fruit in 1923 by French scientist Henri Boulard. It is related to, but distinct from, Saccharomyces cerevisiae in several taxonomic, metabolic, and genetic properties.Schiff baseTriparental mating: Triparental mating is a form of Bacterial conjugation where a conjugative plasmid present in one bacterial strain assists the transfer of a mobilizable plasmid present in a second bacterial strain into a third bacterial strain. Plasmids are introduced into bacteria for such purposes as transformation, cloning, or transposon mutagenesis.Reaction coordinateYjdF RNA motifTRNA (adenine57-N1/adenine58-N1)-methyltransferase: TRNA (adenine57-N1/adenine58-N1)-methyltransferase (, TrmI, PabTrmI, AqTrmI, MtTrmI) is an enzyme with system name S-adenosyl-L-methionine:tRNA (adenine57/adenine58-N1)-methyltransferase. This enzyme catalyses the following chemical reactionRestriction fragment: A restriction fragment is a DNA fragment resulting from the cutting of a DNA strand by a restriction enzyme (restriction endonucleases), a process called restriction. Each restriction enzyme is highly specific, recognising a particular short DNA sequence, or restriction site, and cutting both DNA strands at specific points within this site.Silent mutation: Silent mutations are mutations in DNA that do not significantly alter the phenotype of the organism in which they occur. Silent mutations can occur in non-coding regions (outside of genes or within introns), or they may occur within exons.Direct repeat: Direct repeats are a type of genetic sequence that consists of two or more repeats of a specific sequence.Eukaryotic transcription: Eukaryotic transcription is the elaborate process that eukaryotic cells use to copy genetic information stored in DNA into units of RNA replica. Gene transcription occurs in both eukaryotic and prokaryotic cells.Sticky and blunt ends: DNA end or sticky end refers to the properties of the end of a molecule of DNA or a recombinant DNA molecule. The concept is important in molecular biology, especially in cloning or when subcloning inserts DNA into vector DNA.Standard enthalpy of formation: The standard enthalpy of formation or standard heat of formation of a compound is the change of enthalpy during the formation of 1 mole of the compound from its constituent elements, with all substances in their standard states at 1 atmosphere (1 atm or 101.3 kPa).Extension Poly(A) Test: The extension Poly(A) Test (ePAT) describes a method to determine the poly(A) tail lengths of mRNA molecules. It was developed and described by A.Tritium illumination: Tritium illumination is the use of gaseous tritium, a radioactive isotope of hydrogen, to create visible light. Tritium emits electrons through beta decay, and, when they interact with a phosphor material, fluorescent light is created, a process called radioluminescence.Enterobacteria phage G4: Enterobacteria phage G4 is a bacteriophage capable of infecting susceptible bacterial cells. The phage was originally isolated from samples of raw sewage and infects E.Mature messenger RNA: Mature messenger RNA, often abbreviated as mature mRNA is a eukaryotic RNA transcript that has been spliced and processed and is ready for translation in the course of protein synthesis. Unlike the eukaryotic RNA immediately after transcription known as precursor messenger RNA, it consists exclusively of exons, with all introns removed.Burst kinetics: Burst kinetics is a form of enzyme kinetics that refers to an initial high velocity of enzymatic turnover when adding enzyme to substrate. This initial period of high velocity product formation is referred to as the "Burst Phase".Hybrid inviability: Hybrid inviability is a post-zygotic barrier, which reduces a hybrid's capacity to mature into a healthy, fit adult.Hybrid inviability.Permissive temperature: The permissive temperature is the temperature at which a temperature sensitive mutant gene product takes on a normal, functional phenotype.http://www.C4H7N3O3Transfer-messenger RNA: Transfer-messenger RNA (abbreviated tmRNA, also known as 10Sa RNA and by its genetic name SsrA) is a bacterial RNA molecule with dual tRNA-like and messenger RNA-like properties. The tmRNA forms a ribonucleoprotein complex (tmRNP) together with Small Protein B (SmpB), Elongation Factor Tu (EF-Tu), and ribosomal protein S1.NTP binding site: An NTP binding site is a type of binding site found in nucleoside monophosphate (NMP) kinases, N can be adenosine or guanosine. A P-loop is one of the structural motifs common for nucleoside triphosphate (NTP) binding sites, it interacts with the bound nucleotide's phosphoryl groups.DNA binding site: DNA binding sites are a type of binding site found in DNA where other molecules may bind. DNA binding sites are distinct from other binding sites in that (1) they are part of a DNA sequence (e.Fishpaper: Fish paper or fishpaper is a strong, flexible, fibrous dielectric paper. It resists moderate heat and mechanical injury, and is often used for wrapping coils and insulating stove-top parts.Spin–lattice relaxation in the rotating frame: Spin–lattice relaxation in the rotating frame is the mechanism by which Mxy, the transverse component of the magnetization vector, exponentially decays towards its equilibrium value of zero, under the influence of a radio frequency (RF) field in nuclear magnetic resonance (NMR) and magnetic resonance imaging (MRI). It is characterized by the spin–lattice relaxation time constant in the rotating frame, T1ρ.Molar mass distribution: In linear polymers the individual polymer chains rarely have exactly the same degree of polymerization and molar mass, and there is always a distribution around an average value. The molar mass distribution (or molecular weight distribution) in a polymer describes the relationship between the number of moles of each polymer species (Ni) and the molar mass (Mi) of that species.Buoyant density ultracentrifugation: Buoyant density centrifugation uses the concept of buoyancy to separate molecules in solution. Usually a caesium chloride (CsCl) solution is used, but in the general case it's usually approximately the same density as the molecules that are to be centrifuged.Ribonuclease T2: Ribonuclease T2 (, ribonuclease II, base-non-specific ribonuclease, nonbase-specific RNase, RNase (non-base specific), non-base specific ribonuclease, nonspecific RNase, RNase Ms, RNase M, RNase II, Escherichia coli ribonuclease II, ribonucleate nucleotido-2'-transferase (cyclizing), acid ribonuclease, RNAase CL, Escherichia coli ribonuclease I' ribonuclease PP2, ribonuclease N2, ribonuclease M, acid RNase, ribonnuclease (non-base specific), ribonuclease (non-base specific), RNase T2, ribonuclease PP3, ribonucleate 3'-oligonucleotide hydrolase, ribonuclease U4) is an enzyme. This enzyme catalyses the following chemical reactionExcision repair cross-complementing: Excision repair cross-complementing (ERCC) is a set of proteins which are involved in DNA repair.Branching order of bacterial phyla (Gupta, 2001): There are several models of the Branching order of bacterial phyla, one of these was proposed in 2001 by Gupta based on conserved indels or protein, termed "protein signatures", an alternative approach to molecular phylogeny. Some problematic exceptions and conflicts are present to these conserved indels, however, they are in agreement with several groupings of classes and phyla.Specificity constant: In the field of biochemistry, the specificity constant (also called kinetic efficiency or k_{cat}/K_{M}), is a measure of how efficiently an enzyme converts substrates into products. A comparison of specificity constants can also be used as a measure of the preference of an enzyme for different substrates (i.Ethyl groupDNA re-replication: DNA re-replication (or simply rereplication) is an undesirable and possibly fatal occurrence in eukaryotic cells in which the genome is replicated more than once per cell cycle. Rereplication is believed to lead to genomic instability and has been implicated in the pathologies of a variety of human cancers.Thermal cyclerUniversity of Miami Division of Surgical Neurooncology: The Division of Surgical Neurooncology in the Department of Neurological Surgery and Sylvester Comprehensive Cancer Center at the University of Miami is one of the largest and most complete programs for brain tumor treatment in the United States. As the only academic medical center in the region, the University of Miami offers a unique and comprehensive approach to these conditions, with interdisciplinary discussion between neurosurgery, neurology, radiation oncology, and medical oncology.GC box: In molecular biology, a GC box is a distinct pattern of nucleotides found in the promoter region of some eukaryotic genes upstream of the TATA box and approximately 110 bases upstream from the transcription initiation site. It has a consensus sequence GGGCGG which is position dependent and orientation independent.X-ray magnetic circular dichroismDNA sequencer: A DNA sequencer is a scientific instrument used to automate the DNA sequencing process. Given a sample of DNA, a DNA sequencer is used to determine the order of the four bases: G (guanine), C (cytosine), A (adenine) and T (thymine).Core enzyme: A core enzyme consists of the subunits of an enzyme that are needed for catalytic activity, as in the core enzyme RNA polymerase.Genetics: Analysis & Principles, 3rd Edition.CS-BLASTLow-voltage electron microscope: Low-voltage electron microscope (LVEM) is an electron microscope which operates at accelerating voltages of a few kiloelectronvolts or less. While the low voltage electron microscopy technique will never replace conventional high voltage electron microscopes, it is quickly becoming appreciated for many different disciplines.Translational regulation: Translational regulation refers to the control of the levels of protein synthesized from its mRNA. The corresponding mechanisms are primarily targeted on the control of ribosome recruitment on the initiation codon, but can also involve modulation of the elongation or termination of protein synthesis.Margaret Jope: Margaret Jope (1913–2004) was a Scottish biochemist, born as Henrietta Margaret Halliday in Peterhead, Scotland.Ferric uptake regulator family: In molecular biology, the ferric uptake regulator (FUR) family of proteins includes metal ion uptake regulator proteins. These are responsible for controlling the intracellular concentration of iron in many bacteria.Interval boundary element method: Interval boundary element method is classical boundary element method with the interval parameters.
Amplified Ribosomal DNA Restriction Analysis: Amplified rDNA (Ribosomal DNA) Restriction Analysis is the extension of the technique of RFLP (restriction fragment length polymorphism) to the gene encoding the small (16s) ribosomal subunit of bacteria. The technique involves an enzymatic amplification using primers directed at the conserved regions at the ends of the 16s gene, followed by digestion using tetracutter Restriction enzymes.DNA-binding proteinProximity ligation assay: Proximity ligation assay (in situ PLA) is a technology that extends the capabilities of traditional immunoassays to include direct detection of proteins, protein interactions and modifications with high specificity and sensitivity. Protein targets can be readily detected and localized with single molecule resolution and objectively quantified in unmodified cells and tissues.G2-M DNA damage checkpoint: The G2-M DNA damage checkpoint is an important cell cycle checkpoint in eukaryotic organisms ranging from yeast to mammals. This checkpoint ensures that cells don't initiate mitosis before they have a chance to repair damaged DNA after replication.Log management knowledge base: The Log Management Knowledge Base is a free database of detailed descriptions on over 20,000 event logs generated by Windows systems, syslog devices and applications.http://www.Mannich base: A Mannich base is a beta-amino-ketone, which is formed in the reaction of an amine, formaldehyde (or an aldehyde) and a carbon acid. The Mannich base is an endproduct in the Mannich reaction, which is nucleophilic addition reaction of a non-enolizable aldehyde and any primary or secondary amine to produce resonance stabilized imine (iminium ion or imine salt).Oxoguanine glycosylase: 8-Oxoguanine glycosylase also known as OGG1 is a DNA glycosylase enzyme that, in humans, is encoded by the OGG1 gene. It is involved in base excision repair.

(1/178859) Evidence on the conformation of HeLa-cell 5.8S ribosomal ribonucleic acid from the reaction of specific cytidine residues with sodium bisulphite.

The reaction of HeLa-cell 5.8S rRNA with NaHSO3 under conditions in which exposed cytidine residues are deaminated to uridine was studied. It was possible to estimate the reactivities of most of the 46 cytidine residues in the nucleotide sequence by comparing 'fingerprints' of the bisulphite-treated RNA with those of untreated RNA. The findings were consistent with the main features of the secondary-structure model for mammalian 5.85S rRNA proposed by Nazar, Sitz, & Busch [J. Biol. Chem (1975) 250, 8591--8597]. Five out of six regions that are depicted in the model as single-stranded loops contain cytidine residues that are reactive towards bisulphite at 25 degrees C (the other loop contains no cytidine). The cytidine residue nearest to the 3'-terminus is also reactive. Several cytidines residues that are internally located within proposed double-helical regions show little or no reactivity towards bisulphite, but the cytidine residues of several C.G pairs at the ends of helical regions show some reactivity, and one of the proposed loops appears to contain six nucleotides, rather than the minimum of four suggested by the primary structure. Two cytidine residues that are thought to be 'looped out' by small helix imperfections also show some reactivity.  (+info)

(2/178859) Marker effects on reversion of T4rII mutants.

The frequencies of 2-aminopurine- and 5-bromouracil-induced A:T leads to G:C transitions were compared at nonsense sites throughout the rII region of bacteriophage T4. These frequencies are influenced both by adjacent base pairs within the nonsense codons and by extracodonic factors. Following 2AP treatment, they are high in amber (UAG) and lower in opal (UGA) codons than in allelic ochre (UAA) codons. In general, 5BU-induced transitions are more frequent in both amber and opal codons than in the allelic ochre codons. 2AP- and 5BU-induced transition frequencies in the first and third positions of opal codons are correlated with those in the corresponding positions of the allelic ochre codons. Similarly, the frequencies of 2AP-induced transition in the first and second positions of amber codons and their ochre alleles are correlated. However, there is little correlation between the frequencies of 5BU-induced transitions in the first and second positions of allelic amber and ochre codons.  (+info)

(3/178859) Characterization of an amphioxus paired box gene, AmphiPax2/5/8: developmental expression patterns in optic support cells, nephridium, thyroid-like structures and pharyngeal gill slits, but not in the midbrain-hindbrain boundary region.

On the basis of developmental gene expression, the vertebrate central nervous system comprises: a forebrain plus anterior midbrain, a midbrain-hindbrain boundary region (MHB) having organizer properties, and a rhombospinal domain. The vertebrate MHB is characterized by position, by organizer properties and by being the early site of action of Wnt1 and engrailed genes, and of genes of the Pax2/5/8 subfamily. Wada and others (Wada, H., Saiga, H., Satoh, N. and Holland, P. W. H. (1998) Development 125, 1113-1122) suggested that ascidian tunicates have a vertebrate-like MHB on the basis of ascidian Pax258 expression there. In another invertebrate chordate, amphioxus, comparable gene expression evidence for a vertebrate-like MHB is lacking. We, therefore, isolated and characterized AmphiPax2/5/8, the sole member of this subfamily in amphioxus. AmphiPax2/5/8 is initially expressed well back in the rhombospinal domain and not where a MHB would be expected. In contrast, most of the other expression domains of AmphiPax2/5/8 correspond to expression domains of vertebrate Pax2, Pax5 and Pax8 in structures that are probably homologous - support cells of the eye, nephridium, thyroid-like structures and pharyngeal gill slits; although AmphiPax2/5/8 is not transcribed in any structures that could be interpreted as homologues of vertebrate otic placodes or otic vesicles. In sum, the developmental expression of AmphiPax2/5/8 indicates that the amphioxus central nervous system lacks a MHB resembling the vertebrate isthmic region. Additional gene expression data for the developing ascidian and amphioxus nervous systems would help determine whether a MHB is a basal chordate character secondarily lost in amphioxus. The alternative is that the MHB is a vertebrate innovation.  (+info)

(4/178859) Regulation of body length and male tail ray pattern formation of Caenorhabditis elegans by a member of TGF-beta family.

We have identified a new member of the TGF-beta superfamily, CET-1, from Caenorhabditis elegans, which is expressed in the ventral nerve cord and other neurons. cet-1 null mutants have shortened bodies and male tail abnormal phenotype resembling sma mutants, suggesting cet-1, sma-2, sma-3 and sma-4 share a common pathway. Overexpression experiments demonstrated that cet-1 function requires wild-type sma genes. Interestingly, CET-1 appears to affect body length in a dose-dependent manner. Heterozygotes for cet-1 displayed body lengths ranging between null mutant and wild type, and overexpression of CET-1 in wild-type worms elongated body length close to lon mutants. In male sensory ray patterning, lack of cet-1 function results in ray fusions. Epistasis analysis revealed that mab-21 lies downstream and is negatively regulated by the cet-1/sma pathway in the male tail. Our results show that cet-1 controls diverse biological processes during C. elegans development probably through different target genes.  (+info)

(5/178859) Activation of systemic acquired silencing by localised introduction of DNA.

BACKGROUND: In plants, post-transcriptional gene silencing results in RNA degradation after transcription. Among tobacco transformants carrying a nitrate reductase (Nia) construct under the control of the cauliflower mosaic virus 35S promoter (35S-Nia2), one class of transformants spontaneously triggers Nia post-transcriptional gene silencing (class II) whereas another class does not (class I). Non-silenced plants of both classes become silenced when grafted onto silenced stocks, indicating the existence of a systemic silencing signal. Graft-transmitted silencing is maintained in class II but not in class I plants when removed from silenced stocks, indicating similar requirements for spontaneous triggering and maintenance. RESULTS: Introduction of 35S-Nia2 DNA by the gene transfer method called biolistics led to localised acquired silencing (LAS) in bombarded leaves of wild-type, class I and class II plants, and to systemic acquired silencing (SAS) in class II plants. SAS occurred even if the targeted leaf was removed 2 days after bombardment, indicating that the systemic signal is produced, transmitted and amplified rapidly. SAS was activated by sense, antisense and promoterless Nia2 DNA constructs, indicating that transcription is not required although it does stimulate SAS. CONCLUSIONS: SAS was activated by biolistic introduction of promoterless constructs, indicating that the DNA itself is a potent activator of post-transcriptional gene silencing. The systemic silencing signal invaded the whole plant by cell-to-cell and long-distance propagation, and reamplification of the signal.  (+info)

(6/178859) Molecular cloning and epitope analysis of the peanut allergen Ara h 3.

Peanut allergy is a significant IgE-mediated health problem because of the increased prevalence, potential severity, and chronicity of the reaction. Following our characterization of the two peanut allergens Ara h 1 and Ara h 2, we have isolated a cDNA clone encoding a third peanut allergen, Ara h 3. The deduced amino acid sequence of Ara h 3 shows homology to 11S seed-storage proteins. The recombinant form of this protein was expressed in a bacterial system and was recognized by serum IgE from approximately 45% of our peanut-allergic patient population. Serum IgE from these patients and overlapping, synthetic peptides were used to map the linear, IgE-binding epitopes of Ara h 3. Four epitopes, between 10 and 15 amino acids in length, were found within the primary sequence, with no obvious sequence motif shared by the peptides. One epitope is recognized by all Ara h 3-allergic patients. Mutational analysis of the epitopes revealed that single amino acid changes within these peptides could lead to a reduction or loss of IgE binding. By determining which amino acids are critical for IgE binding, it might be possible to alter the Ara h 3 cDNA to encode a protein with a reduced IgE-binding capacity. These results will enable the design of improved diagnostic and therapeutic approaches for food-hypersensitivity reactions.  (+info)

(7/178859) TIF1gamma, a novel member of the transcriptional intermediary factor 1 family.

We report the cloning and characterization of a novel member of the Transcriptional Intermediary Factor 1 (TIF1) gene family, human TIF1gamma. Similar to TIF1alpha and TIF1beta, the structure of TIF1beta is characterized by multiple domains: RING finger, B boxes, Coiled coil, PHD/TTC, and bromodomain. Although structurally related to TIF1alpha and TIF1beta, TIF1gamma presents several functional differences. In contrast to TIF1alpha, but like TIF1beta, TIF1 does not interact with nuclear receptors in yeast two-hybrid or GST pull-down assays and does not interfere with retinoic acid response in transfected mammalian cells. Whereas TIF1alpha and TIF1beta were previously found to interact with the KRAB silencing domain of KOX1 and with the HP1alpha, MODI (HP1beta) and MOD2 (HP1gamma) heterochromatinic proteins, suggesting that they may participate in a complex involved in heterochromatin-induced gene repression, TIF1gamma does not interact with either the KRAB domain of KOX1 or the HP1 proteins. Nevertheless, TIF1gamma, like TIF1alpha and TIF1beta, exhibits a strong silencing activity when tethered to a promoter. Since deletion of a novel motif unique to the three TIF1 proteins, called TIF1 signature sequence (TSS), abrogates transcriptional repression by TIF1gamma, this motif likely participates in TIF1 dependent repression.  (+info)

(8/178859) Telomerase reverse transcriptase gene is a direct target of c-Myc but is not functionally equivalent in cellular transformation.

The telomerase reverse transcriptase component (TERT) is not expressed in most primary somatic human cells and tissues, but is upregulated in the majority of immortalized cell lines and tumors. Here, we identify the c-Myc transcription factor as a direct mediator of telomerase activation in primary human fibroblasts through its ability to specifically induce TERT gene expression. Through the use of a hormone inducible form of c-Myc (c-Myc-ER), we demonstrate that Myc-induced activation of the hTERT promoter requires an evolutionarily conserved E-box and that c-Myc-ER-induced accumulation of hTERT mRNA takes place in the absence of de novo protein synthesis. These findings demonstrate that the TERT gene is a direct transcriptional target of c-Myc. Since telomerase activation frequently correlates with immortalization and telomerase functions to stabilize telomers in cycling cells, we tested whether Myc-induced activation of TERT gene expression represents an important mechanism through which c-Myc acts to immortalize cells. Employing the rat embryo fibroblast cooperation assay, we show that TERT is unable to substitute for c-Myc in the transformation of primary rodent fibroblasts, suggesting that the transforming activities of Myc extend beyond its ability to activate TERT gene expression and hence telomerase activity.  (+info)



proteins


  • Solvent molecules and ions are also believed to play an important role in mediating and directing both sequence recognition and interactions with other molecules, such as proteins and a variety of ligands. (diva-portal.org)

relationship


  • In this work, we used molecular dynamics simulations to both investigate the interactions between the backbone and major groove of DNA and one of its physiological counterions (Na+) and evaluate the relationship between these interactions and the nucleotide sequence. (diva-portal.org)

length


  • The main bottleneck in Pyrosequencing has been limited sequence length, which is critical for some applications. (qiagen.com)

analysis


  • The real-time, high-resolution sequence output makes the technology highly suitable for applications including complex mutation analysis, microbial identification, and DNA methylation quantification. (qiagen.com)