Sequencing transcripts proteins expressed sequence tags. Medical search. Frequent questions

The genomic organization of the human genes that encode protein prenyltransferases is shown in Figure 1 . (biomedcentral.com)
After Blast analysis within GenBank, 64% could be identified, 21% were homologous to unannotated expressed sequence tag (EST) or genomic sequences, and 15% were novel. (appliedbioinfo.com)
He thanked CDC and KTL for their support in providing accurate genomic sequencing results of polioviruses in a timely manner, as this greatly facilitated planning and targeting the polio eradication activities. (who.int)

In 2013, the genome sequences of O. ulmi and O. novo-ulmi were publicly released. (sisef.it)
5 ]. For Genomes , it collects genome sequences and also supports Blast, querying by using a chr ID in publication and databases such as Sc0000024 (only for lancelet), chr1 , chr22 and so on. (bucm.edu.cn)
As whole genome sequences became available, again with the pioneering work of Frederick Sanger, the term bioinformatics was re-discovered to refer to the creation of databases such as GenBank in 1982. (ind.in)

Eleven candidate effector genes were identified based on features common to characterized fungal effectors, i.e. they encode small, soluble (lack of transmembrane domain), cysteine-rich proteins with a putative SP. (biomedcentral.com)
The localization of the HKE2 gene to the class II region, its cytoplasmic expression and putative protein-binding domain suggest that HKE2 may function in adaptive immunity and cancer. (genscript.com)
In vitro analysis revealed that a putative switch-protein kinase regulator, RsbW, is capable of interacting directly with σ 66 , as well as phosphorylating its own antagonist, RsbV1, rendering it inactive. (plos.org)

Quantitative PCR and high-throughput methods, such as expressed sequence tag analysis, have been used for measuring gene expression and identifying subsets of elm genes that are differentially expressed in the presence of O. novo-ulmi . (sisef.it)
These analyses have also helped identify genes that were differentially expressed in DED fungi grown under defined experimental conditions. (sisef.it)
In this study, a suppression subtractive hybridization cDNA library approach was used for the identification of pathogen and plant genes that were differentially expressed during infection of the susceptible cultivar BRS Pérola of Phaseolus vulgaris L. A total of 979 unigenes (430 contigs and 549 singletons) were obtained and classified according to their functional categories. (frontiersin.org)
One of the most striking results from the expression analysis was that the drought sensitive plants were characterised by having approximately twice the number of differentially expressed transcript tags than the tolerant plants after drought. (biomedcentral.com)

RS_01910 may encode a protein related to creatine transport. (frontiersin.org)
Nearly 39% of the ESTs were predicted to encode proteins of fungal origin and among these, 162 ESTs were predicted to contain N-terminal signal peptides (SPs) in their deduced open reading frames (ORFs). (biomedcentral.com)

Sequences of DNA in the genes that are located between the EXONS. (lookformedical.com)
The chromosomal locations and number of exons from protein prenyltransferase genes in the major eukaryotic model organisms are shown in Table 2 . (biomedcentral.com)
PCR analysis of exon utilization reveals massive alternative mRNA splicing of Sec31B, with just 16 exons being constitutively utilized in all transcripts. (biologists.com)
The authors undertook systematic sequencing of U2AF1 exons in 150 MDS cases, and found that 8.7% had mutations at Ser34. (massgenomics.org)

UPF0762 shows high homology in primates and orthologous proteins can be traced back as far as trichoplax adhaerens. (wikipedia.org)

First, Tim Graubert and colleagues describe the whole-genome sequencing of an MDS-derived secondary AML tumor and a matched normal (skin) sample. (massgenomics.org)

A total of 35 microsatellites were identified from the ESTs, with 18 having sufficient flanking sequences for primer design. (nih.gov)
A total of 5,542 ESTs were generated representing 4,688 unique sequences. (nih.gov)
Automatic comparisons of data from expressed sequence tags (ESTs) with genes (for example using the program Acembly, for which the results are available from the NCBI AceView server [ 2 ]) shows that all the human protein prenyltransferase genes have multiple alternative splice variants. (biomedcentral.com)
4 ]. For ESTs , it stores Expressed sequence tags to supports Blast, but also provides obtaining sequences by EST-ID in databases, For example est_xb_1526 . (bucm.edu.cn)

In differential gene and miRNA expression studies, we identified a number of key developmental genes and miRNA-mRNA target modules previously described in relation to their developmental regulatory role in the cereal panicle, notably the miR156/529/535-SQUAMOSA PROMOTER-BINDING PROTEIN-LIKE (SPL) gene regulatory module. (bvsalud.org)
Homo sapiens prefoldin subunit 6 (PFDN6), transcript variant 3, mRNA. (genscript.com)
After mRNA processing, most transcripts are exported to the cytoplasm for translation into protein. (berkeley.edu)
Each mRNA transcript can serve as template for repeated translation into protein by ribosomes. (berkeley.edu)
The number of protein products produced by any single mRNA can vary widely. (berkeley.edu)
The presence of a stop codon in exon 13 generates two families of Sec31B gene products (each displaying additional patterns of mRNA splicing): a group of full-length proteins (hereafter referred to as Sec31B-F) and also a group of truncated proteins (hereafter referred to as Sec31B-T), distinguished by their utilization of exon 13. (biologists.com)
Both technologies have been primarily focused on measurement of protein epitopes, but have been used to measure nucleic acids such as targeted mRNA 11 , 12 . (nature.com)

Another early contributor to bioinformatics was Elvin A. Kabat , who pioneered biological sequence analysis in 1970 with his comprehensive volumes of antibody sequences released with Tai Te Wu between 1980 and 1991. (ind.in)
This goal is accomplished by tagging an antibody with a uniquely identifiable agent that is a surrogate for the level of expression of a given cellular constituent. (nature.com)
Fluorescence and isotope tagging are the principal means for measuring antibody binding to cells in flow cytometry. (nature.com)

The following PFDN6 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). (genscript.com)
These sequences represent the protein coding region of the PFDN6 cDNA ORF which is encoded by the open reading frame (ORF) sequence. (genscript.com)
Deep cDNA sequencing demonstrated that both wild-type and mutant alleles were expressed . (massgenomics.org)

Extensive analyses of transcriptome have been carried out in chickpea, which is the third most important legume valued as a source of dietary protein and micronutrients. (intechopen.com)
Gene expression analyses using NGS platforms were carried out in the vegetative and reproductive tissues such as shoot, root, mature leaf, ﬂower bud, young pod, seed and nodule by various groups which resulted in identification of several tissue-specific transcripts. (intechopen.com)
Sequence analyses of unigenes revealed four potential groups: hydrolases, cell envelope associated proteins (CEAPs), candidate effectors and other proteins. (biomedcentral.com)
We demonstrate that this method can be applied to multi-modal protein and RNA analyses. (nature.com)
2003. Comparative analyses of potato expressed sequence tag libraries . (berkeley.edu)

Genes specifically expressed in fruit tissues were selected and their isolated promoter regions were fused with the GUSPlus reporter gene for evaluation in transgenic plants. (biomedcentral.com)
Identification of intrahepatic cholangiocarcinoma related genes by comparison with normal liver tissues using expressed sequence tags. (genscript.com)
Based on oil accumulation dynamics of V. galamensis seeds, we harvested seed samples from three stages (17, 38, and 45 days after pollination, DAP) representing the initial, fast and final EFA accumulation phases, and one mixed sample from different tissues for RNA-sequencing, with three biological replicates at each sample. (researchsquare.com)

Cluster analysis indicated the presence of 635 contigs and 4,053 singletons, generating a total of 4,688 unique sequences. (nih.gov)
The 162 sequences could be assembled into 122 tentative unigenes comprising 32 contigs and 90 singletons. (biomedcentral.com)

C6orf58 is a human gene located at locus 6q22.33 of chromosome 6 and encodes for UPF0762, a protein which is subsequently secreted after cleavage of a signal peptide. (wikipedia.org)
B-cell translocation gene 4, cullin 1, MCF.2 transforming sequence, a locus similar to snail soma ferritin, and three unidentified genes were, indeed, preferentially expressed in the oocyte, even though most were also highly expressed in testis. (appliedbioinfo.com)

The subtracted library was characterized by sequencing 185 random clone inserts, representing 146 nonredundant genes. (appliedbioinfo.com)
The molecular sequence of this clone aligns with the gene accession number as a point of reference only. (origene.com)
This clone was engineered to express the complete ORF with an expression tag. (origene.com)
ORF sequences can be delivered in our standard vector, pcDNA3.1 + /C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. (genscript.com)

A selected set of homologous sequences are listed below, with sequence identity being calculated in comparison to the human reference sequence. (wikipedia.org)

In this study, chromatin immunoprecipitation and massively parallel DNA sequencing (ChIP-seq) was performed to identify the AmtR regulon in C. glutamicum ATCC 14067. (frontiersin.org)
Massively parallel sequencing was used to analyse the bulked RNA samples. (biomedcentral.com)

DUF781 is the singular domain of the protein and spans 318 of the protein's 330 amino acids. (wikipedia.org)
A signal peptide, which is predicted to direct the protein to the endoplasmic reticulum for secretion, is cleaved from the first 20 amino acids of the peptide sequence. (wikipedia.org)
Analysis of the mutated protein sequence for a signal peptide shows cleavability at the regular amino acid 20 is lost. (wikipedia.org)
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories. (lookformedical.com)

Transcriptome analysis has facilitated the development of molecular markers such as simple sequence repeats (SSRs), single-nucleotide polymorphisms (SNPs) and potential intron polymorphisms (PIPs) that are being used to expedite the chickpea breeding programmes. (intechopen.com)
This de novo assembly of a red clover transcriptome from leaf material of droughted and non-droughted plants provides a rich source for gene identification, single nucleotide polymorphisms (SNP) and short sequence repeats (SSR). (biomedcentral.com)

Sec31B is widely expressed and enriched in cerebellum and testis. (biologists.com)

S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. (cancerindex.org)

For a selected subset of CEAPs and candidate effectors, semiquantitative RT-PCR showed that these transcripts were either expressed constitutively in both in vitro and in planta or induced during plant infection. (biomedcentral.com)

It is also called nucleotide sequence. (lookformedical.com)

These transcript tags were annotated with gene ontology (GO) terms. (biomedcentral.com)

DNA sequence and analysis of human chromosome 9. (nih.gov)

With minimal instrumentation (four 96-well plates and a multichannel pipette), cell-specific codes are added to each tagged molecule within cells through sequential rounds of classical split-pool synthesis. (nature.com)

For example, there are methods to locate a gene within a sequence, to predict protein structure and/or function, and to cluster protein sequences into families of related sequences. (ind.in)

When expressed as a fusion protein with eYFP in cultured cells, Sec31B-F associates with the endoplasmic reticulum and with vesicular-tubular clusters, displays restricted intracellular movement characteristic of COPII vesicle dynamics, co-distributes on organelles with Sec13, Sec31A and Sec23 (markers of the COPII coat), and concentrates with ts045-VSV-G-CFP (VSV-G) when examined early in the secretory pathway or after temperature or nocodazole inhibition. (biologists.com)

Genome and exome sequencing were performed for five unrelated cases of IRD with no identified variant. (nature.com)
3 When no pathogenic variant is identified, exome sequencing or genome sequencing may help uncover the variants missed by panel-based screening. (nature.com)
Using exome sequencing and genome sequencing, we document four novel DYNC2H1 pathogenic variants, and one variant previously reported in five unrelated cases of nonsyndromic progressive IRD. (nature.com)

Scope includes mutations and abnormal protein expression. (cancerindex.org)
Cas9 activity, determined by insertion deletion mutations, was restored in Gal4P65-expressing cells, while no CRISPR enhancement was observed with UNC1999 treatment. (aip.org)

However, large-scale nucleotide sequencing directed at the human genome (3 billion nucleotides! (nationalacademies.org)

The region of DNA which borders the 3' end of a transcription unit and where a variety of regulatory sequences are located. (lookformedical.com)
Nucleotide sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to various regulatory agents. (lookformedical.com)
The α subunits of protein prenyltransferases consist of tetratricopeptide repeats and are part of the tetratricopeptide repeat superfamily [ 5 ], which also includes functionally diverse proteins involved in transcription, co-chaperoning, protein transport, cell-cycle control and phosphorylation. (biomedcentral.com)
RNA polymerase promoter sequence (TAATACGACTCACTATAGGG) to facilitate in vitro transcription. (cdc.gov)
Real-time quantitative PCR (RT-qPCR) analysis and sfGFP (superfolder green fluorescent protein) analysis reveal that AmtR directly and negatively regulates the transcription and expression of crn A, cre T, csh A, and hyu B. A growth test shows that C. glutamicum ATCC 14067 can use creatine or creatinine as a sole nitrogen source. (frontiersin.org)
The transcripts were degraded throughout preimplantation development and were not compensated for by embryonic transcription after the morula stage. (appliedbioinfo.com)
In the vertebrate CNS, HB9/MNR2 transcription factors are specifically expressed in all somatic motoneurons and are necessary to distinguish motoneurons from interneurons, in part by repressing interneuron-specific gene expression. (jneurosci.org)
Together, vertebrate HB9/MNR2 transcription factors are expressed in all somatic motoneurons and excluded from interneurons. (jneurosci.org)
High-resolution mapping of the protein interaction network for the human transcription machinery and affinity purification of RNA polymerase II-associated complexes. (genscript.com)
This study provides evidence that a switch-protein kinase regulatory network controls availability of σ 66 , the main sigma subunit for transcription in Chlamydia . (plos.org)
One branch addresses a range of integrated biological systems, concentrating on the function of protein molecules in the processes of DNA replication and mutagenesis, transcription, and translation. (nationalacademies.org)

We also tested DNA-binding, transiently expressed activation-associated proteins (AAPs) that are known to support an open, transcriptionally active chromatin state. (aip.org)

While there are 3 splice variants of C6orf58, only one encodes a good protein. (wikipedia.org)
Using potato virus X (PVX) based transient expression assays, we showed that one of the candidate effectors, i. e. contig 8 that encodes a cerato-platanin (CP) domain containing protein, unlike CP proteins from other fungal pathogens was unable to elicit a hypersensitive response (HR). (biomedcentral.com)

Sequence homology is an indication of the genetic relatedness of different organisms and gene function. (lookformedical.com)

We present a method enabling simultaneous, ultra-high throughput single-cell barcoding of millions of cells for targeted analysis of proteins and RNAs. (nature.com)
1,2 However, recent work has shown that chromatin, the RNA-DNA-protein complex that controls chromosomal organization and gene expression in mammalian nuclei, 3-5 blocks access of Cas9 to certain DNA target sites in vitro 6-8 and in mammalian cells. (aip.org)

If the termination codon is downstream of or within about 50 nucleotides of the final exon-junction complex then the transcript is translated normally. (berkeley.edu)
However, if the termination codon is further than about 50 nucleotides upstream of any exon-junction complexes, then the transcript is down regulated by NMD. (berkeley.edu)

Until recently, however, functional analysis of the DED fungi was hampered by the lack of protocols for efficient gene knockout and by the unavailability of a full genome sequence. (sisef.it)
Over the last two decades, several laboratories have used a wide range of techniques encompassing expressed sequence tag (EST) analysis, serial analysis of gene expression (SAGE), microarray and next-generation sequencing (NGS) technologies for analysing the chickpea transcriptomes. (intechopen.com)
Analysis of retinal organoids showed that this new transcript expression increased with organoid differentiation. (nature.com)
EU COST Next generation sequencing data analysis network and training consortium. (mpg.de)
Single-gene knockout-coupled omics analysis identifies C9orf85 and CXorf38 as two uncharacterized human proteins associated with ZIP8 malfunction. (nih.gov)

Limb-girdle muscular dystrophy (LGMD) protein defects occur in several pathways involved in the biologic function of muscle and can be divided into groups based on cellular localization. (medscape.com)

During the transition, C. truncatum probably secretes a range of proteins to establish a compatible interaction with its host, including some that may exclusively be involved in switching the pathogen to the necrotrophic phase. (biomedcentral.com)

A total of 6,528 clones were sequenced from this library generating 5,542 high-quality EST sequences. (nih.gov)

TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. (lookformedical.com)

More than 60 percent of all National Institutes of Health grants-covering a wide range of problems in medicine and biology-propose use of the molecular methods of cloning, mapping, or sequencing to investigate problems. (nationalacademies.org)

The list of proteins below is not a comprehensive listing of UPF0762 orthologs. (wikipedia.org)
Drosophila HB9 differs from its vertebrate orthologs in several ways: it is not expressed in all somatic motoneurons, it is expressed in a subset of interneurons, and it is required for the proper development of both interneurons and motoneurons. (jneurosci.org)

7 IFT is an important bidirectional transport of multisubunit protein complexes (IFT particles) along the axonemal microtubules that is essential to normal cilia assembly, function, and maintenance. (nature.com)

Dayhoff compiled one of the first protein sequence databases, initially published as books and pioneered methods of sequence alignment and molecular evolution. (ind.in)

some of the predicted transcripts may be derived from missplicing rather than being real splice variants. (biomedcentral.com)

Highly repeated sequences, 6K-8K base pairs in length, which contain RNA polymerase II promoters. (lookformedical.com)
Highly repeated sequences, 100-300 bases long, which contain RNA polymerase III promoters. (lookformedical.com)

DNA transposable elements include bacterial IS (insertion sequence) elements, Tn elements, the maize controlling elements Ac and Ds, Drosophila P, gypsy, and pogo elements, the human Tigger elements and the Tc and mariner elements which are found throughout the animal kingdom. (lookformedical.com)
Drosophila genes expressed specifically in all motoneurons have not been described, although a growing number of genes are known to be expressed in subsets of motoneurons. (jneurosci.org)

Gene structures and chromosomal locations of human protein prenyltransferase subunit genes. (biomedcentral.com)

Our results demonstrate the use of DNA-binding, activator-associated fusion proteins as an effective method to enhance Cas9 editing within polycomb-repressed chromatin. (aip.org)

The "self"-protein albumin in mouse airway fluid was uniquely modified by GSH-MDI at position 414K, a preferred site of MDI reactivity on human albumin. (cdc.gov)

Some laboratories have utilized transcriptomics to explore the response of chickpea to abiotic and biotic stresses such as drought, salinity, heat, cold, Fusarium oxysporum and Ascochyta rabiei diﬀerentially expressed genes and also established crosstalk between biotic and abiotic stress responses. (intechopen.com)

Mouse HB9 maintains expression in somatic motoneurons, whereas chick HB9 is expressed only in postmitotic somatic motoneurons. (jneurosci.org)

C. truncatum likely secretes an arsenal of proteins that are implicated in maintaining a compatible interaction with its host. (biomedcentral.com)
Some of these proteins may have a role in establishing compatible interaction with the host plant. (biomedcentral.com)

The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. (lookformedical.com)

All identified variants affect either a retina-predominant transcript or are hypomorphic, suggesting a basis for a nonsyndromic retinal phenotype. (nature.com)

The transient assay of selected genes resulted in a synergistic increase of EFA-enriched TAG accumulation in tobacco leaves. (researchsquare.com)

Anatomy16

Organisms40

Chemicals and Drugs54

Analytical, Diagnostic and Therapeutic Techniques and Equipment36

Phenomena and Processes107

Disciplines and Occupations6

Technology, Industry, Agriculture8

Information Science15

Health Care4

Genomic3

Genome sequences3

Putative3

Differentially expressed4

Encode2

Exons4

Orthologous proteins1

Whole genome1

ESTs4

MRNA7

Antibody3

CDNA3

Analyses5

Tissues3

Contigs2

Locus2

Clone4

Homologous1

Massively2

Amino4

Transcriptome2

Testis1

Cytoplasm1

Constitutively1

Nucleotide sequence1

Gene Ontology1

Chromosome1

Molecule1

Cluster1

Secretory1

Variant3

Mutations2

Human genome1

Transcription11

Transiently1

Encodes2

Homology1

Cells2

Nucleotides2

Analysis5

Localization1

Pathogen1

Clones1

Repeats1

Cloning1

Orthologs2

Complexes1

Methods1

Splice variants1

Polymerase2

Drosophila2

Structures1

Chromatin1

Uniquely1

Laboratories1

Expression1

Interaction2

Nucleic1

Phenotype1

Accumulation1