GenesRecombinantBacterialConstitutiveSiRNALuciferaseLentiviral vector productionBackbonesSequenceCellsAntibiotic resistancePurificationEGFPTransductionRetroviralPolymeraseReagentProteinVitroEndogenousRegulationGeneticCommerciallyConstructsBacteriaTransgeneSerotypesAssayCloningSequencesInterferenceTranscriptionCcdBEnhancerShuttleUnderstandingReporter geneSiteControlGene expressionPresenceExperimentsSignificantlyMiceFoundGenerationStrainReactionSites
Genes7
- We concluded that the CMV enhancer or entire CMV promoter locating upstream of the U6-promoter could significantly improve inhibitory effect induced by the shRNA for both exogenous and endogenous genes compared with the CMV promoter or U6 promoter alone. (onacademic.com)
- This implies that FI are rapidly-moving accessory genes, possibly acting on evolutionary fights between plasmids for the colonization of specific hosts. (frontiersin.org)
- Among them, different plasmids (IncI1, IncFI, CloDF13-like, and IncX) inhibit the transfer of IncF plasmids, although the responsible genes were not characterized ( Gasson and Willetts, 1975 ). (frontiersin.org)
- Two genes of IncP-1α plasmids, fiwA and fiwB , block conjugation of IncW plasmids ( Fong and Stanisich, 1989 ). (frontiersin.org)
- Understanding the interaction network between transmissible plasmids is essential to know how the main carriers of antibiotic resistance genes disseminate in the environment. (frontiersin.org)
- To overcome the plasmid instability, many antibiotic resistance genes are used as selectable markers in fermentation processes. (igem.org)
- Viral vector systems are gutted viruses where the packaging signals (e.g., the genetic signals that target the wrapping into the viral particles) are fused to the genes of interest (the payload), and the remaining necessary elements are placed on separate genetic elements, often three or more, says Carsten Carstens, senior scientist, R&D, Agilent Technologies. (biopharminternational.com)
Recombinant7
- Antibiotics are used to select all types of plasmidic vectors in bacteria which is a significant concern in industrial cultures producing recombinant proteins or DNA. (igem.org)
- As plasmid-free cells grow faster than plasmid-carrying cells, the yield and the production reproducibility of recombinant molecules are significantly lowered in the absence of plasmid selection by the appropriate antibiotic. (igem.org)
- Based on this information, the corresponding recombinant plasmids will be commercially synthesized placing the selected ASFV proteins under the regulation of specific different promoters already tested in their efficacy in our laboratory. (usda.gov)
- Recombinant viruses will be then produced using racoon pox vectored virus (RPVV) as templated. (usda.gov)
- In this study, we constructed a recombinant Alphavirus Semliki Forest virus (SFV) replicon vector DREP to express EBOV GP and matrix viral protein (VP40). (frontiersin.org)
- Our study indicates that co-expression of GP and VP40 antigens based on the SFV replicon vector generates EBOV VLPs in vitro , and vaccination with recombinant DREP vectors containing GP and VP40 antigens induces Ebola antigen-specific humoral and cellular immune responses in mice. (frontiersin.org)
- Ultrafiltered recombinant AAV8 vector can be safely administered in vivo and efficiently transduces liver. (ohsu.edu)
Bacterial6
- It is the strongest of the bacterial promoters that we provide and this high level of expression can cause expression problems with some proteins with poor solubility. (sigmaaldrich.com)
- This plasmid contains a constitutive bacterial promoter that does not require induction. (sigmaaldrich.com)
- It is the strongest bacterial promoter we sell and this can cause solubility and expression problems with some proteins. (sigmaaldrich.com)
- We also offer a range of other bacterial promoters that are compatible with this plasmid and are available on request. (sigmaaldrich.com)
- There, he developed specialized promoter-probe cloning vectors to better understand the regulation of bacterial transcription. (wikipedia.org)
- Bacterial expression vector with a BamHI cloning site. (addgene.org)
Constitutive2
- The plasmid contains a constitutive promoter (OXB20) derived from the region upstream of the E. coli RecA gene. (sigmaaldrich.com)
- In theStaby TM system,the antidote gene (ccdA) is introduced in the plasmid DNA under the control of a weak constitutive promoter: the mob gene promoter, which originates from a broad host range plasmid (pBHR1). (igem.org)
SiRNA6
- Development of siRNA expression vector utilizing rock bream beta-actin promoter: a potential therapeutic tool against viral infection in fish [J]. APPLIED MICROBIOLOGY AND BIOTECHNOLOGY ,2010:679---690. (onacademic.com)
- Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. (scientistlive.com)
- Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. (scientistlive.com)
- Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. (scientistlive.com)
- Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. (scientistlive.com)
- The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo. (scientistlive.com)
Luciferase5
- Luciferase reporter assays demonstrated that the Adcy1 promoter is selectively activated by neuronal PAS-domain protein 2 (NPAS2)/BMAL1. (jneurosci.org)
- We examined the activities of cloned promoter DNA fragments with luciferase assay. (molvis.org)
- We also demonstrated that the −657 to +411 DCT promoter fragment efficiently directs RB cell-specific transcription of the luciferase reporter gene in cell lines. (molvis.org)
- The HepG2 cell line was transiently transfected with CYP2B6- and CYP3A4-luciferase promoter reporter plasmids along with human PXR (hPXR) or hCAR expression vectors. (cdc.gov)
- To understand how the B 1 and B 2 regions influenced the transcriptional functions of nuclear HER3, we performed cyclin D1 promoter-luciferase assays in which HER3 deleted of the B 1 and B 2 regions was severely hindered in regulating this promoter. (plos.org)
Lentiviral vector production1
- The core provides production of 2nd and 3rd generation lentiviral vector production providing either conditioned medium or concentrated virus preparations. (ohsu.edu)
Backbones1
- For example, all conjugative plasmids code for exclusion systems that act in recipient bacteria to prevent competition between identical plasmid backbones, block uneconomical excess of conjugative transfer, and protect recipients from lethal zygosis ( Garcillan-Barcia and de la Cruz, 2008 ). (frontiersin.org)
Sequence3
- Fusing the AOXI gene promoter with the DNA sequence encoding a fluorescent protein will allow the expression of the AOXI gene to be detected. (igem.org)
- The "Lysis Device" sequence (which was only tested in the pK112245 assembly vector) was similarly simplified. (igem.org)
- Subsequently, truncation and mutation of a vimentin promoter demonstrated that HDAC1‑induced vimentin expression was dependent on a nuclear factor κ‑light‑chain‑enhancer of activated B cells (NF‑κB) binding site in the vimentin promoter sequence. (spandidos-publications.com)
Cells11
- Among them, fertility inhibition (FI) systems prevent conjugation of co-resident plasmids within donor cells. (frontiersin.org)
- In both cases, the responsible gene was pifC , known also to be involved in FI of IncP plasmids and Agrobacterium T-DNA transfer to plant cells. (frontiersin.org)
- We first prepared competent TG1 cells (resistant to ccdB) with the given assembly vector. (igem.org)
- The assembly vector was transformed into competent TG1 cells and were grown in liquid LB media with Cam/Amp antibiotics (and 50mM Mg +2 if the lysis device is included) at 30°C overnight. (igem.org)
- Using these new competent cells, the given entry vector was tranformed into them. (igem.org)
- They were grown in liquid LB media with Cam/Amp/Spec antibiotics (and 50mM Mg +2 if the lysis device is included) at 37°C overnight to ensure the cells contain both plasmids and that the temperature sensitive promoter of the gateway device would turn on. (igem.org)
- EBOV VLPs were successfully generated and achieved budding from 293 cells after co-transfection with DREP-based GP and VP40 vectors (DREP-GP+DREP-VP40). (frontiersin.org)
- In both cases, cells may be treated either with a viral or non-viral vector carrying the corrected copy of the gene. (biopharminternational.com)
- Carstens points out that the greatest limitation of viral vector systems is their tropism, that is, the type of cells that a virus will naturally infect. (biopharminternational.com)
- I'm interested in using them in Jurkat cells after cloning the fusion protein into a retroviral vector, under the control of the retroviral promoter. (bio.net)
- We provide detailed protocols for the generation of lentiviral vectors, the transduction of hES-cells, and their differentia- tion into neurons. (lu.se)
Antibiotic resistance1
- Analysis of the mechanisms of inhibition between conjugative plasmids could provide new alternatives to fight antibiotic resistance dissemination. (frontiersin.org)
Purification1
- When there was no lysis device in the assembly vector, plasmid purification was achieved with the QIAprep Spin Miniprep Kit. (igem.org)
EGFP2
- When tested the exogenous gene, silencing of an enhanced green fluorescent protein (EGFP) target gene was 89.18 +/- 5.06% for CMVE-U6 promoter group and 88.26 +/- 6.46% for CMV-U6 promoter group. (onacademic.com)
- Hi, does anybody has a good or bad experience with any of these plasmids expressing fusion proteins between EGFP and Neo or Hyg resistance. (bio.net)
Transduction1
- Compared to adenovirus and AAV, retrovirus-based vectors show relatively low transduction efficiency in-vivo , but their advantage lies in their ability to integrate stably and confer long-term transgene expression in dividing tissues. (biopharminternational.com)
Retroviral1
- For instance, Agilent has retroviral and lentiviral vector systems that are pseudotyped to achieve a wide target range. (biopharminternational.com)
Polymerase1
- Short hairpin RNA (shRNA) directed by RNA polymerase III (Pol III) or Pol II promoter was shown to be capable of silencing gene expression, which should permit analyses of gene functions or as a potential therapeutic tool. (onacademic.com)
Reagent2
- For all practical purposes, a viral vector is a genetic element wrapped in its own transfection reagent, which makes transfection titrations possible (e.g., dosage responses) and highly effective. (biopharminternational.com)
- In an R&D setting, this becomes preferable if the same reagent is transfected (for example, CAS9 delivery vectors) since all the work is in the generation of the viral stock, not in the infection," Carstens says. (biopharminternational.com)
Protein3
- This plasmid contains an Outer Membrane Protein T (OmpT) secretory signal peptide (SP) to allow proteins to be exported from the cytosol. (sigmaaldrich.com)
- Conjugation experiments of different mobilizable plasmids, helped by either FI-susceptible or FI-resistant transfer systems, demonstrated that the conjugative component affected by both PifC and Osa was the type IV conjugative coupling protein. (frontiersin.org)
- Therefore, higher plasmid stability means higher protein of interest production. (igem.org)
Vitro1
Endogenous2
- To test the hybrid promoters driving shRNA efficiency against an endogenous gene, we used shRNA against no tail (NTL) gene. (onacademic.com)
- Here we describe how microRNA-regulated lentiviral vectors can be used to visualize specific cell populations by exploiting endogenous microRNA expression patterns. (lu.se)
Regulation1
- Next, we identified full-length nuclear HER3 association and regulation of a 122 bp region of the cyclin D1 promoter. (plos.org)
Genetic2
- Here, we present a suite of tools for genetic manipulation in the tomato pathogen C. michiganensis including a markerless deletion system, an integrative plasmid, and an R package for identification of permissive sites for plasmid integration. (biorxiv.org)
- The vector pSelAct-KO is a recombination based, markerless knockout system that uses dual selection to engineer seamless deletions of a region of interest, providing opportunities for repeated higher-order genetic knockouts. (biorxiv.org)
Commercially1
- Viral vectors show promise as a delivery mechanism for gene therapy, but which virus types are commercially viable? (biopharminternational.com)
Constructs1
- In contrast, the two hybrid promoter constructs had similar effects on driving shRNA. (onacademic.com)
Bacteria4
- Bacteria display a variety of mechanisms to control plasmid conjugation. (frontiersin.org)
- FI systems are best known as regulators of plasmid transfer in donor bacteria. (frontiersin.org)
- If a plasmid carrying the ccd module is lost at cell division, the plasmid-free bacteria contain poison and antidote proteins in their cytoplasm. (igem.org)
- Practically, 100 % of the bacteria will carry the vector. (igem.org)
Transgene1
- RESEARCH DESIGN AND METHODS -We established an insulin promoter-driven murine PD-L1 transgenic NOD mouse model to directly evaluate the protective effect of an organ-specific PD-L1 transgene against autoimmune diabetes. (diabetesjournals.org)
Serotypes1
- For example, we have made AAV vectors with serotypes like LK03 and PHP.B for users. (ohsu.edu)
Assay1
- Primers and copper responsive promoter design and data of real-time RT-PCR assay in filamentous fungus Trichoderma reesei. (redasoft.com)
Cloning6
- For reference most cloning programs will import a .gb (Genbank) file and will show all of the plasmids features automatically when downloaded and imported. (sigmaaldrich.com)
- Find out more at Oxford Genetics - Sigma's partner for cloning and expression vectors for molecular biology and synthetic biology applications. (sigmaaldrich.com)
- In Boyer's laboratory, Rodriguez collaborated with postdoctoral fellow, Francisco Bolivar Zapata (Paco), to construct more efficient and better characterized cloning vectors. (wikipedia.org)
- Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. (scientistlive.com)
- pSELECT-zeo contains a multiple cloning site (MCS) downstream of the composite promoter for convenient cloning of a gene of interest. (invivogen.com)
- Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. (microbiologyresearch.org)
Sequences1
- Bioinformatics Pipeline for Human Papillomavirus Short Read Genomic Sequences Classification Using Support Vector Machine. (cdc.gov)
Interference1
- RNA interference by small hairpin RNAs synthesised under control of the human 7S K RNA promoter [J]. BIOLOGICAL CHEMISTRY ,2004:791---794. (onacademic.com)
Transcription1
- pSELECT-zeo plasmids contain two transcription units, the first drives the expression of the gene of interest and the second drives the expression of a Zeocin™ selectable marker. (invivogen.com)
CcdB1
- Both an assembly vector (containing the ccdB gene flanked by attR1 and attR2 sites for negative selection) and an entry vector (containing the part(s) desired to be transferred, flanked by attL1 and attL2 sites) are used as the substrates to which the reactants are added. (igem.org)
Enhancer1
- We demonstrated that silencing efficiency by shRNA produced from the hybrid construct composed of the CMV enhancer or entire CMV promoter placed immediately upstream of a U6 promoter. (onacademic.com)
Shuttle1
- 2) pSET152, an Escherichia coli plasmid with ϕC31 attP site, and pHZ1358, a Streptomyces-Escherichia coli shuttle cosmid vector, both carrying oriT from RP4, can be mobilized from E. coli into NS3226 by conjugation. (microbiologyresearch.org)
Understanding1
- Understanding the presence of plasmid vectors requires an appreciation of the basics of gene-editing, which, confusingly, are considerably distinct from what the word 'editing' means in ordinary English. (greenmedinfo.com)
Reporter gene1
- pSELECT-zeo is also available with the LacZ reporter gene and can be used as control vector. (invivogen.com)
Site1
- Thus, apparently unbeknownst to Recombinetics, adjacent to its edited site were 4,000 base pairs of DNA that originated from the plasmid vector used to introduce the DNA required for the hornless trait. (greenmedinfo.com)
Control4
- Mechanisms to control conjugative transfer are also present in plasmids themselves. (frontiersin.org)
- Expression of the poison gene is under the control of a promoter strongly repressed in the presence of the plasmid. (igem.org)
- In the presence of hPXR, endosulfan-alpha exposure caused significant induction of CYP2B6 (16-fold) and CYP3A4 (11-fold) promoter activities over control at 10 microM. (cdc.gov)
- The metabolite endosulfan sulfate also induced CYP2B6 (12-fold) and CYP3A4 (6-fold) promoter activities over control at 10 microM. (cdc.gov)
Gene expression2
- The NTL gene expression reduced 82.17 +/- 2.96% for CMVE-U6 promoter group and 83.06 +/- 2.38% for CMV-U6 promoter group. (onacademic.com)
- The regulatory elements required for this cell-specific gene expression are likely located within its proximal promoter. (molvis.org)
Presence2
- In this work, inhibition of conjugation of broad host range IncW plasmids was analyzed in the presence of a set of co-resident plasmids. (frontiersin.org)
- In the presence of hCAR-3, endosulfan-alpha induced CYP2B6 (2-fold) promoter activity at 10 microM, but not at lower concentrations. (cdc.gov)
Experiments1
- Looking for more vector options to move your experiments forward faster? (sigmaaldrich.com)
Significantly1
- Notably, vaccination with DREP-GP and DREP-VP40, which produces both GP and VP40 antigens, induced a significantly higher level of anti-GP IgG2a antibody and increased IFN-γ secreting CD8 + T-cell responses relative to vaccination with DREP-GP or DREP-VP40 vector alone. (frontiersin.org)
Mice1
- Vaccination of BALB/c mice with DREP-GP, DREP-VP40, or DREP-GP+DREP-VP40 vectors, followed by immediate electroporation resulted in a mixed IgG subclass production, which recognized EBOV GP and/or VP40 proteins. (frontiersin.org)
Found2
- The main components of pBR322 can be found in many other plasmid vectors, particularly the pUC plasmids designed and constructed by professor Joachim Messing. (wikipedia.org)
- Poison-antidote modules are found in natural plasmid in which they serve to the plasmid maintenance. (igem.org)
Generation1
- Agilent vectors, for example, are suitable and compatible with generation-four packaging systems (i.e., the latest version of packaging systems). (biopharminternational.com)
Strain2
- This project research project seeks to develop an African swine fever virus (ASFV) sub unit vaccine, using raccoon pox virus as vector, which can protect against the epidemiologically relevant strain Georgia 2007. (usda.gov)
- 1) Streptomyces phage ϕC31 and its derived vectors can infect and lysogenize this strain. (microbiologyresearch.org)
Reaction1
Sites2
- We developed permissR, an R package to identify permissive sites for chromosomal integration, which can be used in conjunction with pSelAct-Express, a non-replicating integrative plasmid that enables recombination into a permissive genomic location. (biorxiv.org)
- The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. (scientistlive.com)