Heterotrimeric G proteiPlasma membraneGenesPutativeResiduesExtracellularMitochondrialMRNARecombinantMutationsGenome sequenceReceptorsOrthologousESTsOuterBasolateralCDNA librariesVariantsMass spectrometric analysisTranscriptComplete genomeTranscriptionGene SequencesDistinctSpeciesMoleculesSimilarityTissuesPlasmidsIntracellularMassivelyAntibodyLocalizationEndoplasmic reticulumMPSSReceptor tyrosiStructuralGeneticPathwaysEukaryoticBacterialCatabolicAnalysesCytosolicMutantContextRefSeqStrainRetinalAssaysLipidViralDegradationReference sequenceFunctionallyKinaseAnalysisAntigenChromosomalStabilityIntegrityCellTransmembraneLigaseEncodeAmino acidGlycosylationTranscriptionalAlterations
Heterotrimeric G protei3
- These proteins mediate signals to the interior of the cell via activation of heterotrimeric G proteins that in turn activate various effector proteins, ultimately resulting in a physiologic response. (wikipedia.org)
- Fujisawa Y, Kato H, Iwasaki Y (2001) Structure and function of heterotrimeric G proteins in plants. (springer.com)
- TA binding stabilizes breaks in the middle of transmembrane helices 6 and 7 that facilitate aGPCR coupling and activation of heterotrimeric G proteins. (stanford.edu)
Plasma membrane3
- and plasma membrane. (nih.gov)
- Among these RON variants, RONΔ160 is located at the plasma membrane, whereas RONΔ165 and RONΔ155 are retained in the cytoplasm. (spandidos-publications.com)
- The challenges of crystallizing membrane proteins-and how they're being overcome Computer artwork of a G protein-coupled receptor in the lipid bilayer of a plasma membrane Medi-Mation Ltd / Photo Researchers Membrane proteins represent only a handful of the total number of protein structures defined to date. (the-scientist.com)
Genes16
- HomB protein contributes to the colonization and persistence of H. pylori , and the presence of homB genes affects the number of bacteria adhering to the host cells. (nature.com)
- Previous studies have identified four putative DGAT2-encoding genes in H. lacustris , and only HpDGAT2D allowed the recovery of TAG biosynthesis, but the engineering potential of HpDGAT2s in TAG biosynthesis remains ambiguous. (researchsquare.com)
- Transcription analysis showed that the expression levels of the HpDGAT2A , HpDGAT2D , and HpDGAT2E genes markedly increased under high light and nitrogen deficient conditions with distinct patterns, which led to significant TAG and EAST accumulation. (researchsquare.com)
- These results (1) update the gene models of HpDGAT2s , (2) prove the TAG biosynthesis capacity of HpDGAT2s, (3) show the strong preference for MUFAs and PUFAs, and (4) offer target genes to modulate TAG biosynthesis by using genetic engineering methods. (researchsquare.com)
- The present study has identified many potential immune-related genes in A. mylitta some of which are vertebrate homologues and others are hitherto unreported putative defence proteins. (biomedcentral.com)
- Proteins/genes with a putative catabolic role and bacterium adaptation mechanisms during OPP degradation were identified via genomic and proteomic analysis. (nature.com)
- The genes encoding CaaX protein prenyltransferases are considerably longer than those encoding non-CaaX subunits, as a result of longer introns. (biomedcentral.com)
- The genomic organization of the human genes that encode protein prenyltransferases is shown in Figure 1 . (biomedcentral.com)
- Gene structures and chromosomal locations of human protein prenyltransferase subunit genes. (biomedcentral.com)
- (b) genes encoding non-CaaX protein prenyltransferases are much shorter. (biomedcentral.com)
- Automatic comparisons of data from expressed sequence tags (ESTs) with genes (for example using the program Acembly, for which the results are available from the NCBI AceView server [ 2 ]) shows that all the human protein prenyltransferase genes have multiple alternative splice variants. (biomedcentral.com)
- The chromosomal locations and number of exons from protein prenyltransferase genes in the major eukaryotic model organisms are shown in Table 2 . (biomedcentral.com)
- The valuable source of large-scale genomic information initiated attempts to identify the origin(s) of G protein-coupled receptors (GPCR), count and categorize those genes, and follow their evolutionary history. (springer.com)
- To address that issue, translatome analysis [ 18 ] has been applied to identify sex-specific genes expressed during pollination, but this strategy needed large amounts of tissues from a transgenic line expressing tagged ribosomes in pollen and fine techniques of biochemistry. (biomedcentral.com)
- As orthologous genes are commonly mutated in canine models of human blinding disorders, canine ABCA4 appears to be an ideal candidate gene to identify and study sequence changes in dogs affected by various forms of inherited retinal degeneration. (upenn.edu)
- Because many membrane proteins are expressed by multiple species, homologous genes should be tested and screened to identify proteins that are most amenable to crystallization. (the-scientist.com)
Putative2
- G protein-coupled receptors (GPCRs), such as GPR34, are integral membrane proteins containing 7 putative transmembrane domains (TMs). (wikipedia.org)
- Of the four putative novel defence proteins (DFPs) annotated by PSI-BLAST three showed similarity to extracellular matrix proteins from vertebrates implicated in innate immunity, while the fourth was similar to, yet distinct from, the anti-microbial protein cecropin. (biomedcentral.com)
Residues4
- Further, biophysical experiments suggested that HomA and HomB are dimeric and most likely the cysteine residues present on surface-exposed loops participate in protein-protein interactions. (nature.com)
- The most striking difference between JAK3 and the other JAKs was the presence of 2 stretches of additional amino acid sequences of 147 and 28 residues which spanned between amino acid positions 322 to 469 and 632 to 660, respectively. (appliedbioinfo.com)
- The human cellular prion protein (PrP C ) is a glycosylphosphatidylinositol (GPI) anchored membrane glycoprotein with two N-glycosylation sites at residues 181 and 197. (mdpi.com)
- A particular challenge is the synthesis of oligosaccharyltransferases (OSTs), which catalyze the attachment of glycans to specific amino acid residues in target proteins. (biorxiv.org)
Extracellular5
- The extracellular sequences of RON contain several domains including an N-terminal semaphorin (sema) domain, followed by the plexin, semaphorin, integrin (PSI) domain, and four immunoglobulin, plexin, transcription factor (IPT) domains. (spandidos-publications.com)
- Myelin extracellular leaflet compaction requires apolipoprotein D membrane management to optimize lysosomal-dependent recycling and glycocalyx removal. (genscript.com)
- Adhesion G-protein-coupled receptors (aGPCRs) are characterized by the presence of auto-proteolysing extracellular regions that are involved in cell-cell and cell-extracellular matrix interactions1. (stanford.edu)
- High-resolution structures of GPR56 and LPHN3 in their active, G-protein-coupled states, reveal that after dissociation of the extracellular region, the decrypted TA peptides engage the seven-transmembrane domain core with a notable conservation of interactions that also involve extracellular loop 2. (stanford.edu)
- The large proteoglycan molecules made up of protein cores, and GAG branches are secreted by cells and constitute a significant fraction of the extracellular matrix of connective tissue. (medscape.com)
Mitochondrial9
- Parkin plays an important role in directly supporting mitochondrial function and protecting mitochondrial genomic integrity from oxidative stress (2). (signalchem.com)
- 1. Yoshii, S. R. et.al: Parkin mediates proteasome-dependent protein degradation and rupture of the outer mitochondrial membrane. (signalchem.com)
- Alterations in mitochondrial dynamics due to mutations in proteins involved in the fusion-fission machinery represent an important pathogenic mechanism of human diseases. (centrodinoferrari.com)
- The most relevant proteins involved in the mitochondrial fusion process are three GTPase dynamin-like proteins: mitofusin 1 (MFN1) and 2 (MFN2), located in the outer mitochondrial membrane, and optic atrophy protein 1 (OPA1), in the inner membrane. (centrodinoferrari.com)
- Dynamin-related protein 1 (DRP1), a cytosolic dynamin-related GTPase, plays a central role in fission by promoting mitochondrial division through its oligomerization into multimeric spiral structures [5]. (centrodinoferrari.com)
- Fusion of the outer mitochondrial membrane depends on two GTPase family members: mitofusin 1 (MFN1) and mitofusin 2 (MFN2). (centrodinoferrari.com)
- Cell damage was assessed using MTT assays, and the lactate dehydrogenase (LDH) release rate and flow cytometry were used to detect the accumulation of reactive oxygen species (ROS) and mitochondrial membrane potential respectively. (sdbonline.org)
- GSOs also mitigated the deleterious effects of GLU on the mitochondrial membrane potential and Cyt C release, thus alleviating mitochondrial dysfunction, and increased GSH levels and CAT activity in both cells and Drosophila brain tissue. (sdbonline.org)
- Furthermore, GSOs protected cells against GLU-induced apoptosis by reducing the expression of the mitochondrial apoptosis-associated Bcl-2 family effector proteins and protected cells from GLU-induced oxidative damage by increasing the nuclear translocation of Nrf2 and HO-1 expression. (sdbonline.org)
MRNA5
- An expressed sequence tag (EST) library was constructed from mRNA obtained from fat bodies of A. mylitta larvae that had been challenged by infection with Escherichia coli cells. (biomedcentral.com)
- Here we performed mRNA profiling using Massively Parallel Signature Sequencing (MPSS) and combined it with available Expressed Sequence Tag (EST) data. (biomedcentral.com)
- The protein encoded by this mRNA contains the double catalytic domain characteristic of the JAK family. (appliedbioinfo.com)
- The presence of a stop codon in exon 13 generates two families of Sec31B gene products (each displaying additional patterns of mRNA splicing): a group of full-length proteins (hereafter referred to as Sec31B-F) and also a group of truncated proteins (hereafter referred to as Sec31B-T), distinguished by their utilization of exon 13. (biologists.com)
- However examination of cytoplasmic RNA and subcellular localization of IRS1 revealed a decrease in IRS1 mRNA accumulation Acetazolamide and displaced protein localization strongly suggesting that UL84 facilitated the localization of IRS1 mRNA to the cytoplasm. (bioshockinfinitereleasedate.com)
Recombinant9
- Recombinant full-length human Parkin was expressed by baculovirus in Sf9 insect cells using an N-terminal GST tag. (signalchem.com)
- A recombinant HCMV bacterial artificial chromosome plasmid (BACmid) expressing the nonshuttling UL84 mutant (NS84 BAC) was defective for production of infectious virus. (bioshockinfinitereleasedate.com)
- Era of recombinant BACmid expressing nonshuttling UL84. (bioshockinfinitereleasedate.com)
- Using DAS-ELISA, the detection limit of recombinant PDCoV N protein and virus titer were approximately 0.5 ng/mL and 10 3.0 TCID 50 /mL, respectively. (chxa.com)
- More importantly, the DAS-ELISA could detect the antigen of PDCoV Joblink C-terminal 10xHis-tagged Recombinant inactivated virus, and the viral antigen concentrations remained unchanged in the inactivated virus. (chxa.com)
- The bacterial cells expressed recombinant TSWV-N protein up to a concentration of 9.48 µg/ml. (chxa.com)
- This antiserum specifically reacted with recombinant N protein as well as TSWV infected hosts, but not with groundnut bud necrosis orthotospovirus (GBNV) as well as capsicum chlorosis orthotospovirus (CaCV) infecting tomato and chilli plants. (chxa.com)
- The coating antibody at 1 µg/ml concentration and 1:500 dilution of enzyme conjugate were found to be effective and economical in the detection of recombinant N protein of TSWV and the virus present naturally in the infected hosts. (chxa.com)
- In this report, we conducted mass spectrometric analysis of the N-glycosylation profiles of recombinant spike proteins derived from four common SARS-CoV-2 variants classified as Variant of Concern, including Alpha, Beta, Gamma, and Delta along with D614G variant spike as a control. (cdc.gov)
Mutations2
- Background Mutations in forkhead box protein P1 ( FOXP1 ) cause intellectual disability (ID) and specific language impairment (SLI), with or without autistic features (MIM: 613670). (bmj.com)
- 5 Another approach is to insert mutations that alter the protein sequence in a manner that stabilizes one particular conformation, and screen to find those that might rigidify otherwise flexible regions. (the-scientist.com)
Genome sequence4
- The full-length viral genome sequence was similar to those derived from the Hong-Kong Hotel M isolate. (cdc.gov)
- The recently acquired genome sequence of globe artichoke (Cynara cardunculus var. (researchgate.net)
- The same search parameters were applied to reveal the SSR content of 14 other plant species for which genome sequence is available. (researchgate.net)
- This thematic series of companion papers constitutes the initial exploration of the genome biology of the waterflea (Daphnia) building on the first complete crustacean genome sequence. (biomedcentral.com)
Receptors6
- It is predominantly expressed in immune cells and transduces a signal in response to its activation via tyrosine phosphorylation by interleukin receptors. (appliedbioinfo.com)
- Schioth HB, Fredriksson R (2005) The GRAFS classification system of G-protein coupled receptors in comparative perspective. (springer.com)
- Sequence comparison does not support an evolutionary link between halobacterial retinal proteins including bacteriorhodopsin and eukaryotic G-protein-coupled receptors. (springer.com)
- Plant intracellular nucleotide binding and leucine-rich repeat proteins (NB-LRR, NLRs) function as immune receptors to detect microbial pathogens directly or indirectly. (ubc.ca)
- Despite representing one of the largest classes of therapeutic targets, most inactive-state G protein-coupled receptors (GPCRs) have remained inaccessible for cryo-EM because their small size and membrane-embedded nature impedes projection alignment for high-resolution map reconstructions. (stanford.edu)
- Yet these proteins, which represent nearly 40 percent of all known proteins, including receptors, channels, and signaling molecules, are essential for cell communication and their malfunctions are implicated in many diseases. (the-scientist.com)
Orthologous1
- Genomic analysis identified two orthologous operons encoding the ortho -cleavage of benzoic acid (BA) ( ben/cat ). (nature.com)
ESTs3
- We identified 719 unique ESTs from a total of 1412 sequences so generated. (biomedcentral.com)
- Among the matched sequences, ESTs were identified from tissues other than berries or from berries at different developmental stages. (biomedcentral.com)
- Additional MPSS signatures not matching to known grape ESTs can extend our knowledge of the V. vinifera transcriptome, particularly when these data are used to assist in annotation of whole genome sequences from Vitis vinifera . (biomedcentral.com)
Outer6
- H. pylori attaches and colonizes to the human epithelium using some of their outer membrane proteins (OMPs). (nature.com)
- Outer membrane proteins (OMPs) of H. pylori play a crucial role in the host-pathogen interaction, virulence and pathogenesis. (nature.com)
- Hom (Helicobacter outer membrane) family of OMPs in H. pylori consists of four members (HomA, B, C and D). In the H. pylori genome jhp 0870 open-reading frame (ORF) that codes for HomB outer membrane protein is associated with many stomach diseases and is a novel co-marker for peptic ulcer disease (PUD) 9 , 10 . (nature.com)
- Outer membrane proteins (OMPs) are distinctive features of Gram-negative bacteria. (nature.com)
- Initially, the dimerization of mitofusins results in the tethering of the outer membranes of adjoining mitochondria. (centrodinoferrari.com)
- Before fusion, curving of the outer membranes is promoted by the phospholipase D-dependent hydrolysis of cardiolipin. (centrodinoferrari.com)
Basolateral3
- Immunocytochemistry of normal canine retina demonstrated specific localization of protein to the RPE basolateral plasma membranes. (upenn.edu)
- Figure 2.1: P6.p is the VPC closest to the AC, and it also expresses the highest levels of LET-23 on its basolateral membrane. (hideyuki-ts.com)
- The scaffold proteins LIN-2 (CASK), LIN-7 (Veli), and LIN-10 (Mint-1) form a complex which helps to maintain basolateral localisation of LET-23. (hideyuki-ts.com)
CDNA libraries1
- Microarrays were made from expressed sequence tags that were isolated from cDNA libraries of porcine ovary. (appliedbioinfo.com)
Variants4
- The Web site "www.artichokegenome.unito.it" hosts all the available genomic sequences, together with their structural/functional annotations and project information are presented to users via the open-source tool JBrowse, allowing the analysis of collinearity and the discovery of genomic variants, thus representing a one-stop resource for Cynara cardunculus genomics. (researchgate.net)
- Our data reveal that the amino acid substitutions and deletions between variants impact the abundance and type of glycans on glycosylation sites of the spike protein. (cdc.gov)
- In comparison with our previously reported site-specific glycan analysis on the S-D614G and its ancestral protein, glycan types on later variants showed high similarity on the site-specific glycan content to S-D614G. (cdc.gov)
- Detailed site-specific glycan analysis of a wide variety of SARS-CoV-2 variants provides useful information toward the understanding of the role of protein glycosylation on viral protein structure and function and development of effective vaccines and therapeutics. (cdc.gov)
Mass spectrometric analysis1
- The biotinylated proteins were affinity-purified for mass spectrometric analysis, and the candidate GRA proteins from BioID data set were identified by gene tagging. (biomedcentral.com)
Transcript3
- Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. (genscript.com)
- The genomic coordinates used for the transcript record were based on alignments. (genscript.com)
- The transcript is predominantly expressed in RPE/choroid and encodes bestrophin, a 580-amino acid protein of 66 kDa. (upenn.edu)
Complete genome2
- Sequence analysis of the complete genome of SARS-CoV has shown an RNA molecule of about 29,750 bases in length, with a genome organization similar to that of other coronaviruses ( 9 - 11 ). (cdc.gov)
- Studies on the molecular mechanisms of C. elegans development date back to the 1980s, when genetic manipulating techniques, especially gene cloning, were emerging, but the complete genome sequencing (of C. elegans and other model organisms) had yet to start. (hideyuki-ts.com)
Transcription2
- Real-time quantitative PCR (RT-qPCR) analysis and sfGFP (superfolder green fluorescent protein) analysis reveal that AmtR directly and negatively regulates the transcription and expression of crn A, cre T, csh A, and hyu B. A growth test shows that C. glutamicum ATCC 14067 can use creatine or creatinine as a sole nitrogen source. (frontiersin.org)
- The α subunits of protein prenyltransferases consist of tetratricopeptide repeats and are part of the tetratricopeptide repeat superfamily [ 5 ], which also includes functionally diverse proteins involved in transcription, co-chaperoning, protein transport, cell-cycle control and phosphorylation. (biomedcentral.com)
Gene Sequences1
- In this work, these gene sequences were individually disrupted and mutant strains were evaluated for their ability to grow on or degrade 2,4,6-TCP. (lookformedical.com)
Distinct1
- Overall, the molecular and biologic characteristics of the strain HSR1 provide evidence that SARS-CoV forms a fourth genetic coronavirus group with distinct genomic and biologic features. (cdc.gov)
Species4
- Background: Medicago truncatula has been chosen as a model species for genomic studies. (wustl.edu)
- The importance of this plant species to agriculture has made the development of genomic resources a high priority. (biomedcentral.com)
- These processes have left footprints in the genomic sequence that can be detected by bioinformatic methods and may help to interpret receptor function in the light of a given species in its environment. (springer.com)
- However, there is no way of knowing in advance which species or expression method is going to yield a well-behaved protein. (the-scientist.com)
Molecules3
- MAEBL is a chimera between two previously known molecules: AMA-1 (apical membrane antigen-1) and EBL (erythrocyte binding-like) protein. (the-scientist.com)
- Together, our work explains how Retro-2 prevents retrograde trafficking of toxins by inhibiting TA-protein targeting, describes a general CRISPR strategy for predicting the MOA of small molecules, and paves the way for drugging the TRC pathway to treat broad classes of viruses known to be inhibited by Retro-2. (elifesciences.org)
- Stevens collaborated with chemists to design new detergents, such as the cholate- based amphiphiles, that create smaller micelles, allowing the protein molecules to pack more closely and form better crystals. (the-scientist.com)
Similarity4
- In higher plants and microalgae, there are four major groups of DGATs: (1) the membrane bound form of DGAT1, (2) the membrane bound form of DGAT2 sharing low sequence similarity with DGAT1, (3) the soluble type of DGAT3, which is localized in the cytosol, and (4) the dual function of WS/DGAT, which possesses both wax ester and TAG biosynthesis activities [12-18]. (researchsquare.com)
- The protein encoded by this gene is a component of high-density lipoprotein (HDL), but is unique in that it shares greater structural similarity to lipocalin than to other members of the apolipoprotein family, and has a wider tissue expression pattern. (genscript.com)
- While NDRG3 shares a high similarity to NDRG2 in terms of amino acid sequence and structure, NDRG3 exhibited remarkable structural differences in a flexible loop corresponding to helix alpha6 of NDRG2 that is responsible for tumor suppression. (inra.fr)
- Despite the overall architectural similarity with our earlier structures of Ric-8A complexed to Galphaq and Galphai1, Ric-8B distinctly accommodates an extended loop found only in Galphas/olf proteins. (stanford.edu)
Tissues2
- As described in Materials and Methods, we constructed a cDNA library from fat body tissues of E. coli - challenged A. mylitta larvae and randomly sequenced a large number of inserts from the library. (biomedcentral.com)
- Title: Cerebral Apolipoprotein-D Is Hypoglycosylated Compared to Peripheral Tissues and Is Variably Expressed in Mouse and Human Brain Regions. (genscript.com)
Plasmids1
- Each target will be either amplified from genomic DNA/plasmids or a synthesized gene with ends that allow for simple seamless assembly into our expression vectors or your own expression vector. (intactgenomics.com)
Intracellular3
- The protein encoded by this gene is a member of the Janus kinase (JAK) family of tyrosine kinases involved in cytokine receptor-mediated intracellular signal transduction. (appliedbioinfo.com)
- When expressed as a fusion protein with eYFP in cultured cells, Sec31B-F associates with the endoplasmic reticulum and with vesicular-tubular clusters, displays restricted intracellular movement characteristic of COPII vesicle dynamics, co-distributes on organelles with Sec13, Sec31A and Sec23 (markers of the COPII coat), and concentrates with ts045-VSV-G-CFP (VSV-G) when examined early in the secretory pathway or after temperature or nocodazole inhibition. (biologists.com)
- however, the precise roles of these GRA proteins in the intracellular survival and growth of the parasites are not well elucidated. (biomedcentral.com)
Massively2
- In this study, chromatin immunoprecipitation and massively parallel DNA sequencing (ChIP-seq) was performed to identify the AmtR regulon in C. glutamicum ATCC 14067. (frontiersin.org)
- The number and relative abundance of transcripts from stage II grape berries was defined using Massively Parallel Signature Sequencing (MPSS). (biomedcentral.com)
Antibody1
- Here, we developed a double antibody sandwich quantitative enzyme-linked immunosorbent assay (DAS-ELISA) for detection of PDCoV by using a specific monoclonal antibody against the PDCoV N protein and an anti-PDCoV rabbit polyclonal antibody . (chxa.com)
Localization2
- To determine the cellular basis for the growth inhibition, we observed the localization of PepEST on the fungus and found the attachment of the protein on surfaces of conidia and germination tubes. (inra.fr)
- Using NcGRA17-BirA* fusion protein as bait, we have identified some known GRAs and verified localization of 11 novel GRA proteins by gene endogenous tagging or overexpression in the Nc1 strain. (biomedcentral.com)
Endoplasmic reticulum1
- Generally, TAG biosynthesis takes place in the endoplasmic reticulum, and TAG assembly can be divided into acyl-CoA-dependent and acyl-CoA independent pathways [10]. (researchsquare.com)
MPSS2
- The sequence depth of MPSS allowed us to capture and quantify almost all the transcripts at a specific stage in the development of the grape berry. (biomedcentral.com)
- Signatures from tissue-specific MPSS libraries identify transcripts preferentially expressed in the mouse inner ear. (genscript.com)
Receptor tyrosi1
- Recepteur d'origine nantais (RON) is a receptor tyrosine kinase (RTK) normally expressed at low levels in epithelial cells. (spandidos-publications.com)
Structural4
- In the present study, we explored the structural aspect of HomA and HomB proteins using various computational, biophysical and small-angle X-ray scattering (SAXS) techniques. (nature.com)
- Our study provides essential structural information of unexplored proteins of the Hom family that can help in a better understanding of H. pylori pathogenesis. (nature.com)
- The structures, along with results from Ric-8 protein thermal stability assays and cell-based Galphaolf folding assays, support a requirement for the Galpha C-terminal region for binding specificity, and highlight that multiple structural elements impart specificity for Ric-8/G protein binding. (stanford.edu)
- 1 This gave a structural explanation for the observation that cholesterol in the membrane is essential for the dimerization, and hence the signaling function, of this receptor. (the-scientist.com)
Genetic4
- Further understanding of the pathways and regulatory mechanisms involved in TAG accumulation will facilitate the genetic engineering of microalgae [7-9]. (researchsquare.com)
- DNA transposons are natural genetic elements residing in the genome as repetitive sequences. (biomedcentral.com)
- In chapter 2, by using CRISPR/Cas9 gene editing, genetic analysis and biochemical assays, I identified the differential pairings of typical NLR receptor SOC3 with atypical NLR proteins CHS1 or TN2 to guard the homeostasis of the E3 ligase SAUL1. (ubc.ca)
- CRISPRi genetic interaction analysis revealed Retro-2 activity resembles disruption of the transmembrane domain recognition complex (TRC) pathway, which mediates post-translational ER-targeting and insertion of tail-anchored (TA) proteins, including SNAREs required for retrograde transport. (elifesciences.org)
Pathways1
- Kim JY, Haastert PV, Devreotes PN (1996) Social senses: G-protein-coupled receptor signaling pathways in Dictyostelium discoideum . (springer.com)
Eukaryotic2
- Triacylglycerol (TAG) is the principal energy storage form in eukaryotic organisms and represents a promising source of biodiesel production [1]. (researchsquare.com)
- Three different protein prenyltransferases (farnesyltransferase and geranylgeranyltransferases I and II) catalyze the attachment of prenyl lipid anchors 15 or 20 carbons long to the carboxyl termini of a variety of eukaryotic proteins. (biomedcentral.com)
Bacterial1
- Here, we address this challenge by establishing a bacterial cell-free protein synthesis platform that enables rapid production of a variety of OSTs in their active conformations. (biorxiv.org)
Catabolic2
- Proteomics identified 13 up-regulated catabolic proteins when S. haloaromaticamans was growing on OPP and/or BA. (nature.com)
- A flavin-dependent monoxygenase (OppA1), one of the most up-regulated proteins in the OPP-growing cells, was isolated via heterologous expression and its catabolic activity was verified in vitro . (nature.com)
Analyses1
- Nordstrom KJ, Sallman Almen M, Edstam M et al (2011) Independent HHsearch, Needleman-Wunsch-based, and motif analyses reveal the overall hierarchy for most of the G protein-coupled receptor families. (springer.com)
Cytosolic1
- Chopping off the termini of proteins is a trick long-used to make soluble cytosolic proteins more amenable to crystallization. (the-scientist.com)
Mutant3
- However constitutive expression of the core replication proteins along with the nonshuttling UL84 mutant resulted in efficient oriLyt amplification suggesting that shuttling may contribute to the activity of one of the auxiliary replication proteins. (bioshockinfinitereleasedate.com)
- Lytic viral DNA synthesis needs both (Kan) cassette (lowercase) flanked by BAC sequences (uppercase) from plasmid pGalK-Kan. The oligonucleotide contains the same flanking BAC series as the forwards and invert primers plus mutant sites (in boldface): CAACAACTGACGCGCATGGCCATCGTGCGCGCATCAGCCAATCTCTTCGCGCTCCGTATCATCACGCCGCTGTTGAAACGGCTA. (bioshockinfinitereleasedate.com)
- For the UL84 L359A mutation the forwards PCR primer 5 as well as the change primer 5 had been utilized to amplify a cassette (lowercase) flanked by BAC sequences (uppercase) from plasmid pGalK-Kan. The oligonucleotide contains both same flanking BAC series as forwards and invert primers plus mutant sites (in boldface): GTCTTTGGACGATTGGAGCTAGACCCGAACGAATCACCGCCGGACGCGACGCTGTCGTCACTCACGCTATACCAAGACGGCATATTACGTTTC. (bioshockinfinitereleasedate.com)
Context3
- Finally, we have observed that (5) only sites with a particular sequence context can be targeted by either piggyBac or Tol2 . (biomedcentral.com)
- Which of the P4Hs act on signaling peptides, and whether or not they differ in preference for proline in a certain sequence context is still unclear. (elifesciences.org)
- This basic two-step process has been confirmed in most mammalian cells, although its regulation and the repertoire of specific accessory proteins are likely to be highly context dependent. (centrodinoferrari.com)
RefSeq1
- The following Vmo1 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). (genscript.com)
Strain4
- investigated pathogenesis and immunological response caused by HomB protein in clinical patients and 190 H. pylori strain isolated from patients with peptic ulcer disease (PUD) or gastritis were evaluated for the clinical importance of homB . (nature.com)
- Functional complementation demonstrated that HpDGAT2A, HpDGAT2B, HpDGAT2D, and HpDGAT2E had the capacity to restore TAG synthesis in a TAG-deficient yeast strain (H1246) showing a large difference in enzymatic activity. (researchsquare.com)
- The constructs will be transformed into an expression strain, and the expression of the target protein will be optimized by testing the conditions of expression (temperature, media, inductions conditions), as well as the most ideal tags (type of affinity tag and position). (intactgenomics.com)
- A number of these targets were confirmed by gene overexpression or endogenous tagging in the Nc1 strain, thereby validating our approach. (biomedcentral.com)
Retinal1
- Oesterhelt D (1998) The structure and mechanism of the family of retinal proteins from halophilic archaea. (springer.com)
Assays2
- Fatty acid (FA) profile assays revealed that HpDGAT2A, HpDGAT2D, and HpDGAT2E, but not HpDGAT2B, preferred monounsaturated fatty acyl-CoAs (MUFAs) for TAG synthesis in yeast cells, and showed a preference for polyunsaturated fatty acyl-CoAs (PUFAs) based on their feeding strategy. (researchsquare.com)
- Cell-based and in vitro assays show that Retro-2 blocks delivery of newly-synthesized TA-proteins to the ER-targeting factor ASNA1 (TRC40). (elifesciences.org)
Lipid3
- The encoded protein is involved in lipid metabolism, and ablation of this gene results in defects in triglyceride metabolism. (genscript.com)
- Large micelles increase the ratio of lipid to protein, making it difficult to pack the protein to a density sufficient for crystal formation. (the-scientist.com)
- Specifically, by using lipid nanodiscs as cellular membrane mimics, we obtained yields of up to 440 µg/mL for the single-subunit OST enzyme, 'Protein glycosylation B' (PglB) from Campylobacter jejuni , as well as for three additional PglB homologs from Campylobacter coli, Campylobacter lari , and Desulfovibrio gigas . (biorxiv.org)
Viral1
- Human being cytomegalovirus (HCMV) UL84 is a multifunctional protein that is the proposed initiator for lytic viral DNA synthesis. (bioshockinfinitereleasedate.com)
Degradation1
- Parkin or parkinson protein 2 is a RING domain-containing E3 ubiquitin protein ligase involved in proteasome-dependent degradation of proteins. (signalchem.com)
Reference sequence1
- The reference sequence was derived from AL592547.9. (genscript.com)
Functionally1
- Interestingly, functionally redundant SNIPER1 and SNIPER2 can control the protein levels of diverse sNLRs and the interactions between SNIPER1 and sNLRs appear to be through the common nucleotide-binding (NB) domains of sNLRs. (ubc.ca)
Kinase4
- RON is a 180-kDa heterodimeric protein composed of a 40-kDa α-chain and a 150-kDa transmembrane β-chain with intrinsic tyrosine kinase activity. (spandidos-publications.com)
- Maturation occurs in the cell membrane resulting in a 180-kDa heterodimeric protein composed of a 40-kDa α-chain and a 150-kDa transmembrane β-chain with intrinsic tyrosine kinase activity ( 5 , 6 ). (spandidos-publications.com)
- GTP-bound LET-60 then activates the LIN-45 (Raf) 13 , MEK-2 14 and MPK-1 (MAPK) kinase cascade, which is facilitated by the scaffold protein KSR. (hideyuki-ts.com)
- Gene therapy displacement of endogenous MCUb with a dominant-negative MCUb transgene (MCUb W246R/V251E ) in vivo rescued T2D cardiomyocytes from metabolic inflexibility and stimulated cardiac contractile function and adrenergic responsiveness by enhancing phospholamban phosphorylation via protein kinase A. We conclude that MCUb represents one newly discovered molecular effector at the interface of metabolism and cardiac function, and its repression improves the outcome of the chronically stressed diabetic heart. (diabetesjournals.org)
Analysis7
- We also identified several unknown proteins, some of which could have probable immune-related functions based on the results of the ProDom analysis. (biomedcentral.com)
- Ultrastructural analysis of infected Vero cells showed the virions within cell vesicles and around the cell membrane. (cdc.gov)
- This protein migrates in several bands by Western blot analysis (WB). (mdpi.com)
- Each target protein will require analysis to determine physical characteristics that can be exploited in order to purify it from bulk cell lysate. (intactgenomics.com)
- In addition to chromatograms and standard SDS-PAGE analysis for each purification, Intact Genomics can develop analysis strategies for each protein target in coordination with the client. (intactgenomics.com)
- Sequence analysis of the Daphnia pulex genome holds some surprises that could not have been anticipated from what was learned so far from other arthropod genomes. (biomedcentral.com)
- Our sequence analysis of the complete canine ABCA4 coding region will clearly provide a baseline and tools for future association studies and comparative genomics to further delineate the role of ABCA4 in canine blinding disorders. (upenn.edu)
Antigen1
- Kappe didn't find the homologs (those were identified later by another group), but he uncovered something else: a paralog of the Duffy protein that his group named MAEBL, for membrane antigen-1-erythrocyte binding-like protein. (the-scientist.com)
Chromosomal1
- Performing genome-wide target profiling on data sets obtained by retrieving chromosomal targeting sequences from individual clones, we have identified several piggyBac and Tol2 hotspots and observed that (4) piggyBac and Tol2 display a clear difference in targeting preferences in the human genome. (biomedcentral.com)
Stability2
- We evaluated FOXP1 activity by an in vitro luciferase model and assessed protein stability in vitro by western blotting. (bmj.com)
- Protein glycosylation, or the attachment of sugar moieties (glycans) to proteins, is important for protein stability, activity, and immunogenicity. (biorxiv.org)
Integrity1
- DNA mismatch repair (MMR) enzymes act as proofreading complexes that maintains genomic integrity and MMR-deficient cells show an increased mutation rate. (oncotarget.com)
Cell5
- RON is activated in response to macrophage-stimulating protein (MSP), and then induces an invasive program ( 8 ) consisting of cell proliferation, migration, and invasion, all of which are important at multiple points during tumorigenesis. (spandidos-publications.com)
- By epub Strategisches Controlling in international tätigen Konzernen: Aufgaben - Instrumente, joint cell grids make been creating the regulatory research Protein. (scoutconnection.com)
- There are three localizations in PVs within the infected cell where Neospora dense granule proteins (NcGRAs) are exhibited: the vacuolar space, intravacuolar membranous nanotubular network (MNN), and parasitophorous vacuole membrane (PVM). (biomedcentral.com)
- The volume and quality of proteins produced depends on the organism, cell type, promoter, and vector used to generate them. (the-scientist.com)
- Furthermore, we demonstrate the ability of cell-free synthesized OSTs to glycosylate multiple target proteins with varying N -glycosylation acceptor sequons. (biorxiv.org)
Transmembrane1
Ligase2
Encode1
- RS_01910 may encode a protein related to creatine transport. (frontiersin.org)
Amino acid1
- Interested in the mechanism of a CLC chloride transporter protein, they tried to improve the data they obtained from their crystal by replacing a naturally occurring amino acid with a methionine at each of 30 sites in the protein. (the-scientist.com)
Glycosylation2
Transcriptional2
- These tag-based technologies, which do not require a priori knowledge of genomic sequence, are well-suited for transcriptional profiling. (biomedcentral.com)
- SOC3 forms a head-to-head genomic arrangement with CHS1 and TN2, indicative of transcriptional co-regulation. (ubc.ca)