Identical plasmids. Medical search. Frequent questions

The IncP-1 plasmid group (IncP plasmids in Escherichia coli) of which RK2 is a part has been described as "highly potent, self-transmissible, selfish DNA molecules with a complicated regulatory circuit" RK2 was first isolated in connection with an outbreak of antibiotic-resistant Pseudomonas aeruginosa and Klebsiella aerogenes in Birmingham in 1969, as one of a family of plasmids implicated in transfer of Ampicillin resistance between bacterial strains. (wikipedia.org)
To investigate the origin of the mF plasmid, we collected many Physarum laboratory strains as are available at present throughout the world, and classified their origin on the basis of the results of mating-type analysis and restriction endonuclease analysis of their mtDNA. (go.jp)
The mtDNA of each strain formed a single 80-90kbp band but the mF + strains yielded a 14-16kbp mF plasmid band in addition to this main band. (go.jp)
Southern hybridization using labeled plasmid DNA as the probe allowed the mF - strains to be classified into two categories: simple mF - having only an mID sequence and ΔmF having some part of the mF plasmid integrated into the mtDNA. (go.jp)
This PCR system enabled us to determine whether apparent mF - strains and sclerotia possessed the free or integrated mF plasmids. (go.jp)
Twenty ESBL producing strains (15%) including Escherichia coli (n = 9), Klebsiella pneumoniae (n = 7), Klebsiella oxytoca (n = 2) and Enterobacter aerogenes (n = 2) were detected and further analyzed for their resistance transfer features, plasmid profile and nature of the resistance genes. (scielo.br)
Strains belonging to the same species had identical DGGE fingerprints, and in most cases, these fingerprints were typical for one species. (ispub.com)
Genetically identical plasmids were identified globally in different, completely unrelated strains of bacteria. (resistancecontrol.info)
Comparative genomics of several strains of Erwinia amylovora, a plant pathogenic bacterium causal agent of fire blight disease, revealed that its diversity is primarily attributable to the flexible genome comprised of plasmids. (udg.edu)
A duplex PCR assay was developed to survey the prevalence of plasmid pEI70 and also that of pEA29, which had previously been described in several E. amylovora strains. (udg.edu)
Restriction analysis and hybridization demonstrated that this plasmid was identical in at least 13 strains. (udg.edu)
Curing E. amylovora strains of pEI70 reduced their aggressiveness on pear, and introducing pEI70 into low-aggressiveness strains lacking this plasmid increased symptoms development in this host. (udg.edu)
PacBio Genome Sequences of Escherichia coli Serotype O157:H7, Diffusely Adherent E. coli , and Salmonella enterica Strains, All Carrying Plasmids with an mcr-1 Resistance Gene. (cdc.gov)

In these plasmids most of the genes have been removed, leaving only genes essential for replication and one or more selectable markers. (wikipedia.org)
David H. Figurski, Robert F. Pohlman, David H. Bechhofer, Alice S. Prince and Christie A. Kelton: "Broad host range plasmid RK2 encodes multiple kil genes potentially lethal to Escherichia coli host cells", Genetics, Volume 79. (wikipedia.org)
Some of the most clinically relevant resistance genes, such those encoding carbapenemases (ß-lactamase enzymes able to degrade carbapenem antibiotics), are carried on conjugative plasmids that spread across high-risk bacterial clones 5 , 6 . (nature.com)
AMR, through acquired genes located on transposons or conjugative plasmids, is the horizontal transmission of genes required for a given bacteria to withstand antibiotics. (mdpi.com)
This implies that FI are rapidly-moving accessory genes, possibly acting on evolutionary fights between plasmids for the colonization of specific hosts. (frontiersin.org)
Among them, different plasmids (IncI1, IncFI, CloDF13-like, and IncX) inhibit the transfer of IncF plasmids, although the responsible genes were not characterized ( Gasson and Willetts, 1975 ). (frontiersin.org)
Two genes of IncP-1α plasmids, fiwA and fiwB , block conjugation of IncW plasmids ( Fong and Stanisich, 1989 ). (frontiersin.org)
Understanding the interaction network between transmissible plasmids is essential to know how the main carriers of antibiotic resistance genes disseminate in the environment. (frontiersin.org)
Most of these plasmids were detected to carry both TEM- and SHV-derived genes by PCR, and confirmed by localizing each gene by hybridization assay. (scielo.br)
Plasmids are fragments of double-stranded DNA that typically carry genes and can replicate independently from chromosomal DNA. (addgene.org)
The combination of a DNA fragment with a plasmid or vector DNA backbone generates a recombinant DNA molecule, which can be used to study DNA fragments of interest, such as genes. (addgene.org)
Plasmids that are used most commonly in the field of recombinant DNA technology have been optimized for their use of studying and manipulating genes. (addgene.org)
Whole genome sequences of these isolates were determined and analysed to compute bacterial multilocus sequence types and plasmid replicon types, infer phylogenetic relationships, and identify antimicrobial resistance and virulence genes. (biomedcentral.com)
Plasmids are recognized as one of the major contributors to the rapid worldwide spread of resistance genes. (resistancecontrol.info)
In addition, many plasmids can transfer from one bacterium to another, the most sophisticated mechanism being by conjugation in which the plasmid carries genes that can create a bridge between bacteria through which a copy of the plasmid can move (Fig 1a). (resistancecontrol.info)
The set of genes for multiplication, stable inheritance and transfer are called the plasmid backbone or core. (resistancecontrol.info)
Plasmids can also pick up a variable cargo of other genes that can help their host bacterium grow or survive in different environments - the plasmid spreads them between bacteria and if a survival advantage is gained due to the carried genes on the plasmid there will be positive selection for its carriage. (resistancecontrol.info)
Amongst the favourable traits carried on plasmids, genes conferring antibiotic resistance are of particular concern in the spread of drug-resistant infections (6) . (resistancecontrol.info)
Although all plasmids basically function in similar ways, what makes targeting plasmids difficult is that the genes and proteins they need for multiplication and stable inheritance are highly diverse making it unlikely to find a single compound that will block them all. (resistancecontrol.info)
Genes such as NDM-1 conferring resistance to β -lactam antibiotics, and other essential antibiotics, have been observed on dominant plasmid types that are known to have been in circulation for over 50 years. (resistancecontrol.info)
Polymerase chain reaction (PCR) assays and sequencing was used to determine the presence of β-lactamase encoding genes (bla) including bla NDM-1 and plasmid-mediated quinolone and aminoglycoside resistance determinants. (who.int)
Antimicrobial susceptibility testing, molecular typing, characterization of ESBL-encoding genes and the genetic environment, conjugation experiments and plasmid analysis were carried out. (who.int)

Analysis of the mechanisms of inhibition between conjugative plasmids could provide new alternatives to fight antibiotic resistance dissemination. (frontiersin.org)
Conjugation experiments of different mobilizable plasmids, helped by either FI-susceptible or FI-resistant transfer systems, demonstrated that the conjugative component affected by both PifC and Osa was the type IV conjugative coupling protein. (frontiersin.org)
In addition, in silico analysis of FI proteins suggests that they represent recent acquisitions of conjugative plasmids, i.e., are not shared by members of the same plasmid species. (frontiersin.org)
Mechanisms to control conjugative transfer are also present in plasmids themselves. (frontiersin.org)
For example, all conjugative plasmids code for exclusion systems that act in recipient bacteria to prevent competition between identical plasmid backbones, block uneconomical excess of conjugative transfer, and protect recipients from lethal zygosis ( Garcillan-Barcia and de la Cruz, 2008 ). (frontiersin.org)
The role of plasmids, particularly those able to transfer autonomously (conjugative), in the spread of antibiotic resistance was quickly established. (resistancecontrol.info)

Incorporating our fitness results into a simple population dynamics model revealed a new set of conditions for plasmid stability in bacterial communities, with plasmid persistence increasing with bacterial diversity and becoming less dependent on conjugation. (nature.com)
Plasmids are extra-chromosomal mobile genetic elements able to transfer between bacteria through conjugation 1 . (nature.com)
Bacteria display a variety of mechanisms to control plasmid conjugation. (frontiersin.org)
Among them, fertility inhibition (FI) systems prevent conjugation of co-resident plasmids within donor cells. (frontiersin.org)
In this work, inhibition of conjugation of broad host range IncW plasmids was analyzed in the presence of a set of co-resident plasmids. (frontiersin.org)
Strong FI systems against plasmid R388 conjugation were found in IncF/MOB F12 as well as in IncI/MOB P12 plasmids, represented by plasmids F and R64, respectively. (frontiersin.org)
It was also discovered that the R388 gene osa , which affects T-DNA transfer, also prevented conjugation of IncP-1/MOB P11 plasmids represented by plasmids RP4 and R751. (frontiersin.org)
Since the relevant products act in trans , the FinOP system collaterally inhibits conjugation of related plasmids ( Frost and Koraimann, 2010 ). (frontiersin.org)
Beyond FinOP, there exist "unusual" FI systems that affect conjugation of unrelated co-resident plasmids. (frontiersin.org)
A conjugation test was done using our conjugation protocol to verify that Conjugation Testing Plasmid 1 was transmitted during conjugation. (igem.org)

In both cases, the responsible gene was pifC , known also to be involved in FI of IncP plasmids and Agrobacterium T-DNA transfer to plant cells. (frontiersin.org)
In the context of plasmid bioproduction, however, it is also common to include cell lysis and clarification as part of the upstream process, according to Nuria Gomez Santos, head of process and analytical development for pDNA with Catalent Cell & Gene Therapy. (biopharminternational.com)
For initially testing a new therapeutic gene candidate or gene delivery strategy, a research-grade plasmid would be sufficient. (biopharminternational.com)
Typically plasmids contain the minimum essential DNA sequences for this purpose, which includes a DNA replication origin, an antibiotic-resistance gene, and a region in which exogenous DNA fragments can be inserted. (addgene.org)
The gene was after that amplified by PCR from plasmid pJT1 using oligonucleotides 5′RelEGBK (5′GATGAAC TCATATGGCGTATTT3′) and 3′ RelEGBK (5′TGCTTTGGCTGCAGGAATGCGT3′) as primers. (sciencepop.org)
This brand-new construct was specified pGBKT7-E. The gene from plasmid pJT1 was PCR amplified using oligonucleotides 5′RelBGAD (5′AGGTGTAACATATGGGTAGCAT3′) and 3′RelBGAD (5′AATACGCCCTCGAGGTTCATCC3′) as primers. (sciencepop.org)
The gene was cloned in to the vector pET-30c(+) (Novagen) to make plasmid pJT9. (sciencepop.org)
Joshua Lederberg first coined the term "plasmid" in 1952 (3) , and since their discovery as "extra-chromosomal hereditary determinants", studies have highlighted their role in horizontal gene transfer (HGT) and usefulness as tools in molecular biology. (resistancecontrol.info)
However, in the early 1970s, Stanley Falkow, Stanley Cohen, Herbert Boyer, Donald Helinski, Charles Brinton and several others developed the concept of using plasmids as tools for gene cloning. (resistancecontrol.info)
A strain of E. coli bacteria modified synthesizes it by adding a plasmid, which contains the gene for human growth hormone. (hghmed.com)
enterica serovar Enteritidis strain (2017K-0021), all of which carried the mcr-1 resistance gene on an IncI2 or IncX4 plasmid. (cdc.gov)
One of the few antigens against which mammals develop protective immunity is the highly polymorphic OspC protein, encoded by the ospC gene on the cp26 plasmid. (cdc.gov)
Lateral gene transfers resulted in different linkages between the ospC gene and loci of the chromosome or other plasmids. (cdc.gov)
The bla NDM-1 gene was encoded on plasmids that were easily transferable. (who.int)

The mID sequence is almost identical to a 475-bp sequence (pID) of the mF plasmid. (go.jp)
it is generally believed that all the copies in an organism are identical or nearly identical in nucleotide sequence. (ispub.com)
In this way, the fragments were connected up into a long genome sequence -- which turned out to be identical to modern-day plague pathogens. (sciencedaily.com)
Partial confirmation of sequence of both plasmids. (igem.org)
A few seedlings of pear and apple became systemically infected with DAVd and the viroid progeny were confirmed by nucleotide sequence analysis to be identical to that of the inoculum. (usda.gov)
A collection of related protein sequences (clusters), consisting of Reference Sequence proteins encoded by complete prokaryotic and organelle plasmids and genomes. (nih.gov)

In this study, we determined the fitness effects of the major antibiotic resistance plasmid pOXA-48_K8 in wild-type, ecologically compatible enterobacterial isolates from the human gut microbiota. (nature.com)

These were all separate isolates, and later found to be identical plasmids. (wikipedia.org)

In E. coli, multiple plasmid copies appear to cluster together, creating a few multiplasmid clusters in each cell. (wikipedia.org)
Two such mutants, PFF1cop254D and PFF1cop271C, increase the copy number of PFF1 in E. coli from approximately 39-40 to about 501 and 113 plasmids per cell, respectively. (wikipedia.org)
For instance, most plasmids are replicated in E. coli and are relatively small (∼3000 - 6000 basepairs) to enable easy manipulation. (addgene.org)
Electroporation of plasmid 1 and 2 into Escherichia coli TOP10 cells. (igem.org)

In 1952, Joshua Lederberg coined the term plasmid, in reference to any extrachromosomal heritable determinant. (addgene.org)

By the 1970s the combined discoveries of restriction enzymes, DNA ligase, and gel electrophoresis allowed for the ability to move specific fragments of DNA from one context to another, such as from a chromosome to a plasmid. (addgene.org)
Because ET-A is chromosome borne and ET-B is plasmid borne, multiple intracellular copies of ET-B may exist, which would lead to higher ET-B production. (medscape.com)

Expression of ESBL is often associated with multidrug resistance and dissemination by resistance plasmids. (scielo.br)
But it was not until techniques like DNA sequencing became commonplace that the extent of the role plasmids play in the dissemination and evolution of resistance traits became clear (7) . (resistancecontrol.info)
The ease of NDM-1 plasmid transmissibility may help their dissemination among the Enterobacteriaceae. (who.int)

Construction of four DNA sequences in biobrick format and pSB1A3 plasmid backbone which encode lock for medium RBS ( K175031 ), key for the lock of medium RBS ( K175032 ), lock for weak RBS ( K175029 ) or key for the lock of weak RBS ( K175030 ). (igem.org)

The RK2 Plasmid is a broad-host-range plasmid belonging to the incP incompatibility group It is notable for its ability to replicate in a wide variety of single-celled organisms, which makes it suitable as a genetic engineering tool. (wikipedia.org)
Plasmids in the IncP-1 subgroup has been isolated from wastewater, agricultural soil, and hospitals. (wikipedia.org)

The techniques for plasmid and genomic DNA purification limitation endonuclease digestive function DNA ligation and PCR amplification had been those defined by Sambrook et al. (sciencepop.org)

These tools are essential to the field of recombinant DNA, in which many identical DNA fragments can be generated. (addgene.org)
This recombinant plasmid was specified pGADT7-B. The two-hybrid plasmids had been analyzed in stress AH109. (sciencepop.org)

EcoRI restriction enzyme analyses of R plasmids were used in the detection of epidemic plasmids. (scielo.br)
Fourteen plasmid profiles (A, B1, B2, C1, and C2 to L) were obtained with EcoRI restriction enzyme analysis. (scielo.br)

Characterization of the plasmids 1 and 2 by fluorescence experiments. (igem.org)
Plasmids pGADT7-B and pGBKT7-E had been transformed either individually or jointly PIK-III into AH109 and the precise actions of β-galactosidase had been quantified in the transformants in three unbiased experiments. (sciencepop.org)

In vitro synthesis of RNA requires a purified DNA plasmid, purified RNA polymerase, metal-ion enzyme cofactors, and raw-material nucleotides. (bioprocessintl.com)
To compare properties of such inhibitors, we express ciRS-7 and TuD-containing miRNA suppressor transcripts from identical vector formats adapted from RNA polymerase II-directed expression plasmids previously used for production of ciRS-7. (au.dk)

An optimistic control supplied by Clontech comprising plasmids pGADT7-T which encodes an activation domain-simian trojan 40 huge T-antigen fusion and pGBKT7-53 which encodes a DNA-binding domain-murine p53 fusion exhibited an identical β-galactosidase particular activity (17.2 ± 2.1 Miller systems). (sciencepop.org)

These results help to explain the high prevalence of plasmids in the greatly diverse natural microbial communities. (nature.com)

Our work is developing ways to displace plasmids from their hosts using incompatibility functions without disrupting cell viability by neutralizing plasmid-encoded toxin/anti-toxin systems. (resistancecontrol.info)

Moreover, genomic results showed a link between pOXA-48_K8 fitness effects and bacterial phylogeny, helping to explain plasmid epidemiology. (nature.com)

Second, studies tend to analyse the fitness effects of a single plasmid in a single bacterium. (nature.com)

The ET-A and ET-B amino acid sequences are approximately 40% identical with each other. (medscape.com)

Such scattered distribution of mF + and ΔmF suggests that the mitochondria occasionally acquired the mF plasmid after the establishment of P. polycephalum as a species. (go.jp)

Plasmid persistence in bacterial populations is strongly influenced by the fitness effects associated with plasmid carriage. (nature.com)

One such "mini-replicon" is the plasmid PFF1, which is 5873 basepairs long. (wikipedia.org)

Plasmids are typically circular (but also less commonly linear) double-stranded DNA molecules that are able to independently control their multiplication and stable inheritance from generation to generation in their bacterial h osts (2) . (resistancecontrol.info)

These fitness costs make it difficult to explain how plasmids are maintained in bacterial populations over the long-term in the absence of selection for plasmid-encoded traits, a puzzle known as "the plasmid-paradox" 10 . (nature.com)

However, plasmid fitness effects in wild-type bacterial hosts remain largely unexplored. (nature.com)
These examples do not necessarily replicate plasmid fitness effects in natural bacterial hosts, which remain largely unexplored. (nature.com)
In this study, we provide a detailed characterisation of the distribution of plasmid fitness effects in wild-type bacterial hosts. (nature.com)

Demand for plasmids is rising dramatically as large numbers of messenger RNA (mRNA) vaccines and viral-vector-based therapeutics advance through clinical trials toward approval and commercialization. (biopharminternational.com)
Plasmids for use in mRNA and viral-vector manufacturing may be intermediate- or GMP-grade, depending on the preference of the drug manufacturer. (biopharminternational.com)
All enzymes had been bought from New Britain BioLabs Inc. A 4.1-kb operon was initially subcloned from Kohara clone 308 (11) in to the low-copy-number vector pWKS30 (17) to make plasmid pJT1. (sciencepop.org)
The PCR item was cloned in to the vector pGEX-5X-1 (Pharmacia) to make plasmid pJT4. (sciencepop.org)

Minimal plasmids such as PFF1 are useful for studying the basic mechanisms of plasmid replication and copy number regulation, as there are less superfluous genetic elements which might affect the processes being studied. (wikipedia.org)

Process and plasmid design optimization, disposable equipment, and flexible platform processes all play important roles. (biopharminternational.com)

To confirm this finding, we designed PCR primers for amplifying certain parts of the mF plasmid. (go.jp)

FI systems are best known as regulators of plasmid transfer in donor bacteria. (frontiersin.org)
Plasmid transfer assays were performed using broth mating techniques. (scielo.br)
Much of the early work on plasmids focused on the observation that resistance to antibiotics seemed to transfer from one strain to another, leading to the description of R-factors (4, 5) . (resistancecontrol.info)
Some plasmids are not able to do this on their own, but can use the bridge made by other plasmids to transfer themselves. (resistancecontrol.info)

The mitochondrial-fusion promoting (mF) plasmid first found in the slime mold Physarum polycephalum is a parasitic, selfish mitochondrial plasmid, and is capable of manipulating mitochondria behavior as indicated by its name. (go.jp)
Plasmid pEI70 was found widely dispersed across Europe with frequencies of 5-92%, but it was absent in E. amylovora analyzed populations from outside of Europe. (udg.edu)

Plasmids used in direct clinical applications, such as for DNA vaccines, must be of GMP-grade, according to Marco Schmeer, project manager at PlasmidFactory. (biopharminternational.com)

Several mutants of PFF1 which affect the copy number of the plasmid have been identified. (wikipedia.org)
Like the bacterial chromosomal DNA, plasmid DNA is replicated upon cell division, and each daughter cell receives at least one copy of the plasmid. (addgene.org)

The discovery that plasmids could be efficiently used as cloning vectors led to an increased interest in understanding plasmid biology, as well as stimulating new types of biotechnology. (resistancecontrol.info)

This benefit can be context-dependent, and thus the plasmid exists in a symbiotic relationship with the host cell. (addgene.org)

We also determined that pMCR-1-CTSe is identical to a previously published plasmid, pMCR-1-CT. (cdc.gov)

Anatomy2

Organisms25

Diseases4

Chemicals and Drugs41

Analytical, Diagnostic and Therapeutic Techniques and Equipment19

Phenomena and Processes69

Information Science4

Strains13

Genes22

Conjugative6

Conjugation10

Gene14

Sequence6

Antibiotic1

Isolates1

Coli4

Joshua Lederberg1

Chromosome2

Dissemination3

Backbone1

IncP2

Purification1

Recombinant2

Restriction2

Experiments2

Polymerase2

Encodes1

Prevalence1

Incompatibility1

Genomic1

Bacterium1

Sequences1

Species1

Carriage1

Basepairs1

Circular1

Traits1

Hosts3

Vector4

Mechanisms1

Roles1

Primers1

Transfer4

Found2

Clinical1

Copy2

Discovery1

Cell1

Previously1