Domain protein factor. Medical search. Frequent questions

However, it does bind tightly to other ligand-bound EGF receptor family members to form a heterodimer, stabilizing ligand binding and enhancing kinase-mediated activation of downstream signalling pathways, such as those involving mitogen-activated protein kinase and phosphatidylinositol-3 kinase. (origene.com)
CONCLUSION: These results suggest that overexpression of TrkB and activation of mitogen-activated protein kinase and AP-1, which may in turn induce the expression of vascular endothelial growth factor and interleukin 8, may mediate the cardinal clinical features of locally aggressive growth and metastasis of pancreatic cancer. (duke.edu)

This gene encodes for a bHLH transcription factor, which inhibits osteogenic differentiation by transc. (uni-marburg.de)
The present study was thus undertaken to determine how TWIST1 gene mutations affect protein function. (uni-marburg.de)
TWIST belongs to class B bHLH proteins which are known to form stable heterodimers with members of class A bHLH transcription factors including gene products of E12 and E47, respectively. (uni-marburg.de)
Using the entire coding sequence of TWIST1 gene, an interesting candidate was found belonging to the class A bHLH transcription factors that includes the SEF2 gene product. (uni-marburg.de)
Through the combined work of these three laureates it was thus demonstrated that the response by gene expression to changes in oxygen is directly coupled to oxygen levels in the animal cell, allowing immediate cellular responses to occur to oxygenation through the action of the HIF transcription factor. (nobelprize.org)
Deformed epidermal autoregulatory factor-1 (DEAF-1) is a transcription factor that was originally shown to bind the autoregulatory enhancer of the Deformed ( Dfd ) Hox gene, which is activated in embryonic head segments of Drosophila (Gross, 1996). (sdbonline.org)
One bacteria-induced gene encodes a proteinthat, after expression in the baculovirus system, was shown to be apeptidoglycan recognition protein (PGRP). (embl-heidelberg.de)
Genomic organization of the tag7gene and its promoter region remind those of the genes of the tumornecrosis factor locus, although the tag7 gene is not linked to this locus.The gene is located on chromosome 7 at the area that corresponds to band7A3, which has genetic linkage with lupus-like disease in mouse models.tag7 transcription is essential for lymphoid organs. (embl-heidelberg.de)
These transcription factors are known as masters regulators because its single transcript regulate more than one gene, in this context the regulon word is fascinating more in compass of transcription factors. (scielo.br)
These genes were uncovered on the basis of similarity to the DNA binding domain [ ( PUBMED:9504043 ) ] of Mus musculus (Mouse) Brachyury (T) gene product, which similarity is the defining feature of the family. (embl-heidelberg.de)
Regulation of gene expression at the beginning of mammalian development and the TEAD family of transcription factors. (embl-heidelberg.de)
The v-ets oncogene was originally discovered as part of a fusion protein expressed by a transforming retrovirus (avian E26), and later shown to be transduced from a cellular gene. (embl.de)
Translocation of EWSR1 (Ewing sarcoma breakpoint region 1) with an ETS (E26 transformation-specific) transcription factor gene occurs in more than 95% of Ewing sarcomas. (medscape.com)
This gene encodes a member of the epidermal growth factor (EGF) receptor family of receptor tyrosine kinases. (origene.com)
Various growth factors, cytokines, and prostaglandins upregulate HGF gene expression, including basic fibroblast growth factor, oncostatin M, hypoxia-inducible factor 1α and nuclear factor-κB (NF-κB) ( 9 ). (spandidos-publications.com)
By contrast, transforming growth factor (TGF)-β1 was demonstrated to markedly downregulate HGF gene expression ( 10 , 11 ). (spandidos-publications.com)
Interestingly, differential DNA methylation was related to several transcription factors and proteins with DNA binding domains, which implies direct effects of these DNA methylation changes on gene expression. (medscape.com)
The responsible gene has been mapped to band 12q24.1, which encodes the human transcription factor TBX5. (medscape.com)
Mutations of this gene introduce a premature stop codon and result in truncated protein versions. (medscape.com)
Evaluation of Factor V Leiden, Prothrombin G20210A, MTHFR C677T and MTHFR A1298C gene polymorphisms in retinopathy of prematurity in a Turkish cohort. (cdc.gov)

Among its diverse biological actions, the vasoactive peptide bradykinin (BK) induces the transcription factor AP-1 and proliferation of mesangial cells (S. S. El-Dahr, S. Dipp, I. V. Yosipiv, and W. H. Baricos. (nih.gov)
0.05) in phosphorylation of Elk-1, a transcription factor required for growth factor-induced c-fos transcription. (nih.gov)
GRs), which ultimately alter transcription through direct DNA binding 31 or transcription factor inactivation 32 . (ersjournals.com)
In studies during the early 1990's, Gregg Semenza identified, and then in 1995 purified and cloned, a transcription factor that regulates these oxygen-dependent responses. (nobelprize.org)
To describe the clinical phenotype and genetic basis of non-syndromic retinitis pigmentosa (RP) in one family and two sporadic cases with biallelic mutations in the transcription factor neural retina leucine zipper ( NRL) . (molvis.org)
40535) Transcription factor TFIIB cyclin-related protein CP001857 CDS Arcpr_0047 complement(40887. (go.jp)
This screen identifies new regulators of myofiber atrophy and hypertrophy, including the transcription factor Deaf1 . (sdbonline.org)
Since mTEAD-2 is the only one expressed during the first 7 days of mouse development, it is most likely responsible for the TEAD transcription factor activity that first appears at the beginning of ZGE. (embl-heidelberg.de)
Encodes a putative transcription factor (MYB22). (utoronto.ca)

First, I focused on functional characterization of the NLS1 and NLS2 domains as potential nuclear localization signals in TWIST. (uni-marburg.de)
This synergistic effect is consistent with the observation that combined K38R (NLS1) and K76R (NLS2) mutants dramatically reduced nuclear localization, further suggesting that both NLS1 and NLS2 work together in regulating nuclear localization of TWIST protein. (uni-marburg.de)
The nuclear protein levels of RXRα were reduced by LPS in wild-type but not in TLR4-mutant mice. (aspetjournals.org)
Induction of hepatic cytokines (interleukin-1β, tumor necrosis factor-α, and interleukin-6), c-Jun N-terminal kinase, and nuclear factor-κB was blocked in TLR4-mutant mice. (aspetjournals.org)
Ets transcription factors: nuclear effectors of the Ras-MAP-kinase signaling pathway. (embl.de)
The Ets family of transcription factors includes nuclear phosphoproteins that are involved in cell proliferation, differentiation and oncogenic transformation. (embl.de)
As targets of the Ras-MAPK signaling pathway, Ets proteins function as critical nuclear integrators of ubiquitous signaling cascades. (embl.de)
Electrophoretic mobility shift assays detected allele-dependent nuclear protein binding in A549 cells for 8 of 21 variants. (cdc.gov)

These genes encode proteins that are required for the development and maintenance of photoreceptor structure and its matrix membranes, visual transduction, ciliary trafficking and photoreceptor outer segment shedding. (molvis.org)
Immunity genes are activated in the Drosophila fat body by Rel and GATA transcription factors. (sdbonline.org)
The regulatory genes primarily the transcription factors that exert their activity by binding to certain cis DNA elements and consequently either up regulated or down regulate to target expression. (scielo.br)
Mice contain at least four, and perhaps five, genes with the same TEA DNA binding domain (mTEAD genes). (embl-heidelberg.de)
To direct signals to specific target genes, Ets proteins interact with (other) transcription factors that promote the binding of Ets proteins to composite Ras-responsive elements. (embl.de)
The conserved family of Transcription Intermediary Factors (TIF1) proteins consists of key transcriptional regulators that control transcription of target genes by modulating chromatin state. (elifesciences.org)

Such is the case with two proteins identified by scientists at The University of Texas MD Anderson Cancer Center that fit on to the same binding site on an important cellular growth factor receptor called FGFR2 with starkly different results. (mdanderson.org)
Ladbury is senior author of a paper published Sunday online at Nature Structural & Molecular Biology that describes the competition, identifies Plγcl's role and its relationship to the metastasis-blocking growth factor receptor bound protein 2 (Grb2). (mdanderson.org)
These interactions occur outside normal activation of FGFR2 by growth factors, so the protein with the highest concentration levels in the cell wins the contest to bind to FGFR, or fibroblast growth factor receptor 2, Ladbury said. (mdanderson.org)
To provide insight into the molecular mechanisms of their activity and selectivity, we determined the crystal structures of the ERalpha ligand-binding domain (LBD) and a peptide from the glucocorticoid receptor-interacting protein 1 (GRIP1) coactivator complexed with the ligands OBCP-3M, OBCP-2M, and OBCP-1M. (rcsb.org)
LPS binds to the cell-surface receptor, Toll-like receptor 4 (TLR4), which initiates a signal transduction cascade, including recruitment of the Toll-interleukin 1 receptor domain-containing adaptor protein (TIRAP). (aspetjournals.org)
Was this a function of differences in receptor primary sequence, their locations in the cell, or, possibly, the specificity of the protein kinase domain of the receptor? (the-scientist.com)
As we mapped and mutated phosphorylation sites in the platelet-derived growth factor (PDGF) receptor, we found a dramatic difference in interactions of three tyrosines in the `kinase-insert' region. (the-scientist.com)
Hepatocyte growth factor (HGF) is produced by stromal and mesenchymal cells, and it stimulates epithelial cell proliferation, motility, morphogenesis and angiogenesis in various organs via tyrosine phosphorylation of its cognate receptor, Met. (spandidos-publications.com)
A cardiomelic developmental field has also been postulated to relate the genetic heterogeneity of HOS (and other similar syndromes) to a cascade of molecules, including the brachyury, sonic hedgehog, bone morphogenetic protein, retinoic acid receptor, and transforming growth factor beta families. (medscape.com)

In contrast, protein kinase C inhibition or depletion had no effect on BK-induced c-fos mRNA, AP-1-DNA binding activity, or DNA synthesis. (nih.gov)

A superfamily of proteins that share a highly conserved MADS domain sequence motif. (bvsalud.org)

Adam Kashishian (Fred Hutchinson Cancer Research Center, Seattle): "The question of the specificity of Src homology 2 (SH2) domain/phosphotyrosine interactions has been an important one since the ability of the SH2 domains to bind phosphotyrosine- containing peptides was first shown. (the-scientist.com)
Different growth factor receptors were known to bind different constellations of SH2 domain-containing proteins. (the-scientist.com)
The platinum complex also can bind to nucleus and cytoplasmic protein. (medscape.com)
The T-box is defined as the minimal region within the T-box protein that is both necessary and sufficient for sequence-specific DNA binding, all members of the family so far examined bind to the DNA consensus sequence TCACACCT. (embl-heidelberg.de)
The 72-amino acid TEA DNA binding domains in mTEAD-2, 3, and 4 are approximately 99% homologous to the same domain in mTEAD-1, and all four proteins bind specifically to the same DNA sequences in vitro with a Kd value of 16-38 nM DNA. (embl-heidelberg.de)
This protein has no ligand binding domain of its own and therefore cannot bind growth factors. (origene.com)

It consists of three alpha-helices and a four-stranded beta-sheet, similar to structures of the class of helix-turn-helix DNA binding proteins first found in the catabolite activator protein of Escherichia coli. (embl.de)

Fromfilamentous bacteriophage libraries containing random peptides thatwere recognized by JAR 4, we identified a consensus tripeptide,DHKthat matched residues 25-27 in the N-terminal domain of fHbp. (unimol.it)
The use of amino acids, proteins and peptides is not expected to have any environmental impact. (janusinfo.se)
According to the European Medicines Agency guideline on environmental risk assessments for pharmaceuticals (EMA/CHMP/SWP/4447/00),vitamins, electrolytes, amino acids, peptides, proteins, carbohydrates, lipids proteins, vaccines and herbal medicinal products are exempted because they are unlikely to result in significant risk to the environment. (janusinfo.se)

Protein synthesis takes place on the ribosome, where genetic information carried by messenger RNA is translated into a sequence of amino acids. (nature.com)
From our results and the sequence homology, weconclude that PGRP is a ubiquitous protein involved in innate immunity,conserved from insects to humans. (embl-heidelberg.de)
Although ApoA-I amyloidosis is systemic, the different amyloidogenic variants show a preferential tissue accumulation that appears to correlate with the location of the mutation in the protein sequence and with the local extracellular microenvironment. (lu.se)
Distinct structural bases for sequence-specific DNA binding by mammalian BEN domain proteins. (bvsalud.org)
In vitro selection data revealed sequence-specific binding activities of isolated BEN domains from all of these factors. (bvsalud.org)
Together, these studies expand the DNA recognition activities of BEN factors and provide structural insights into sequence-specific DNA binding by mammalian BEN proteins . (bvsalud.org)

In a 2012 paper in the journal Cell, Ladbury and colleagues showed that Grb2 binds to FGFR2 and holds it in check, ready to be activated by a growth factor to signal other proteins. (mdanderson.org)
Det innebär att en eller flera fettsyror binds till proteinets N-terminal vilket senare utgör en signal till transportsystemet (LolACDE) att proteinet ska transporteras över periplasman. (umu.se)
domain of Tiam-1 to Rac-1 the switch I region within the GTP binding pocket of Rac-1 is shifted and binds within a groove formed by the CR1 and CR3 regions within Tiam-1. (cellsignal.com)
Binds to protein and other compounds containing SH group. (medscape.com)
This domain is rich in positively-charged and aromatic residues, and binds to purine-rich segments of DNA. (embl.de)

In the present study, we examined the role of protein tyrosine phosphorylation and the mitogen-activated protein kinases, ERK1/2,in mediating BK-induced AP-1 and DNA replication in cultured rat mesangial cells. (nih.gov)

The second screening of the yeast clones suggested some promising candidates protein as interacting partners with the NSEEE motif such as ETV5, SURF4, Spastin, Metalloproteinase 2, and ALR-like protein mRNA. (uni-marburg.de)
However, it is homologous to the amino-terminal part of the cleavage stimulation factor, which is thought to be involved with mRNA maturation in mammals. (wikipedia.org)
Pretreatment of murine myoblast (C2C12) cells with octyl-D-carnosine or carnosine enhanced HIF-1α protein expression, VEGF mRNA levels and VEGF release under hypoxic conditions. (frontiersin.org)

or RhoGEF domain consists of an ~ 150 amino acid region that induces Rho family GTPases to displace GDP. (cellsignal.com)
The Ets domains and the flanking amino acid sequences of the proteins influence the binding affinity, and the alteration of a single amino acid in the Ets domain can change its DNA binding specificities. (embl.de)
Accession H0042 Systematic name Allele 1: g.51581A>G, c.232A>G, r.232a>g, p.Arg78Gly Original code S023#101 Description Allele 1: a point mutation in the exon 2 leading to Description an amino acid change in the SUSHI1 domain Date 28-Dec-2004 (Rel. (lu.se)

I wanted to determine if the TWIST protein or its conserved motifs interact with other regulatory proteins to help to regulate the TWIST transcriptional activity. (uni-marburg.de)
Furthermore, two more highly conserved TWIST motifs NSEEE and WR were analyzed individually to find out their interacting proteins and their role in regulating the TWIST1 transcriptional activity. (uni-marburg.de)
Several BEN domain factors are known as transcriptional repressors, but, overall, relatively little is known of how BEN factors identify their targets in humans . (bvsalud.org)

START domain-containing proteins (STARDs) are responsible for lipid metabolism. (medsci.org)

Animal peptidoglycan recognition proteins homologous to Bacteriophage T3 lysozyme. (embl-heidelberg.de)
This domain is found in a family of animal peptidoglycan recognition proteins homologous to Bacteriophage T3 lysozyme [ ( PUBMED:9707603 ) ], and some bacterial homologues. (embl-heidelberg.de)

39504) translation initiation factor 2%2C alpha subunit CP001857 CDS Arcpr_0045 complement(39546. (go.jp)

BK (10(-9) to 10(-7) M) stimulated a rapid increase in tyrosine phosphorylation of multiple proteins with an estimated molecular mass of 120-130, 90-95, and 44-42 kDa. (nih.gov)
AP-1 pathway and that BK mitogenic signaling is critically dependent on protein tyrosine phosphorylation. (nih.gov)

55699) Ribosomal protein L15e CP001857 CDS Arcpr_0066 complement(55738. (go.jp)

Evolutionary alignment of Twist proteins from different species, indicate TWIST contain 4 additional conserved regions such as NSEEE, NLS1, NLS2, and WR-domain besides the bHLH motif. (uni-marburg.de)
Many MADS domain proteins have been found in species from all eukaryotic kingdoms. (bvsalud.org)

The 32-aa MYND domain (for myeloid, Nervy, and Deaf-1) contains non-DNA-binding zinc fingers that are thought to mediate protein-protein interactions (Gross, 1996). (sdbonline.org)

The family is defined by a conserved DNA-binding domain (the ETS-DBD), which forms a highly conserved, winged, helix-turn-helix structural motif. (embl.de)

The relationship between Tag7 andtumor necrosis factor family of ligands is discussed. (embl-heidelberg.de)
Then, similar charges were obtained for five additional proteins (the carbohydrate-recognition domain of Galectin-3 (two different crystal structures and five different ligands), factor Xa, hisactophilin (three different protonation states of all 21 histidines), haloalkane dehalogenase, and the GCN4 leucine zipper) [S.Genheden, P. Söderhjelm, U. Ryde (2010) "Transferability of conformational dependent charges from protein simulations" J. Chem. (lu.se)

virtually every tissue expresses at least one family member, consistent with a critical role for TEAD proteins in either cell proliferation or differentiation. (embl-heidelberg.de)

Recognition of protein folds via dipolar couplings. (lu.se)

HGF was cloned as a growth factor for hepatocytes ( 1 , 2 ), is identical to scatter factor (SF) and was originally discovered as a fibroblast-derived cell motility factor for epithelial cells ( 3 ). (spandidos-publications.com)
A Systematic Review of Mesenchymal Epithelial Transition Factor (MET) and Its Impact in the Development and Treatment of Non-Small-Cell Lung Cancer. (lu.se)

Deletions in the stalk of the influenza neuraminidase (NA) surface protein are associated with increased virulence, but the mechanisms responsible for this enhanced virulence are unclear. (nih.gov)

Bacterial polypeptide release factor RF2 is structurally distinct from eukaryotic eRF1. (nature.com)

NMR and mutagenesis experiments suggest that in comparison to structurally related proteins, the ets domain uses a new variation of the helix-turn-helix motif for binding to DNA. (embl.de)

In vertebrates this subfamily contains four proteins: TIF1α/TRIM24, TIF1β/TRIM28, TIF1γ/TRIM33, and TIF1δ/TRIM66, while only one protein, Bonus (Bon), is present in Drosophila , making it an attractive model to understand the conserved functions of TIF1 proteins. (elifesciences.org)

The inflammatory process in asthma involves the increased expression of various pro-inflammatory chemokines, cytokines, growth factors, lipid mediators, adhesion molecules, enzymes, and receptors for the same inflammatory mediators 21 . (ersjournals.com)
Interleukin 2 (IL2) and Tumor Necrosis Factor (TNF) are pro-inflammatory cytokines with anti-tumor activity. (tmcnet.com)

Estrogens are important regulators of growth and differentiation in (range, 0 -9 fmol/mg protein, median 0.7). (lu.se)

We investigated whether inhibition of hypoxia-inducible factor prolyl 4-hydroxylase-2 (HIF-P4H-2), a key cellular oxygen sensor whose inhibition stabilizes HIF, would protect from NAFLD by subjecting HIF-P4H-2-deficient ( Hif-p4h-2 gt/gt ) mice to a high-fat, high-fructose (HFHF) or high-fat, methionine-choline-deficient (HF-MCD) diet. (springer.com)
The anti-inflammatory actions of corticosteroids occur with a considerable delay (within hours or days) because of the multiple steps of cellular actions required to change protein expression. (ersjournals.com)

The other protein inhibits the opportunity for this to occur," said John Ladbury, Ph.D., professor of Biochemistry and Molecular Biology. (mdanderson.org)

TheTag7 protein consists of 182 amino acids. (embl-heidelberg.de)

We did not detect association between the remaining risk factors and neonatal FeNO levels.Increased FeNO in healthy newborns seems strongly influenced by genetics including father's atopy and child's variants in the DENND1B locus at chromosome 1q31.3. (nih.gov)

Even though the exact mechanisms underlying ischemic injury in the muscle are not completely understood, hypoxia-inducible factor-1 alpha (HIF-1α) has emerged as an attractive target to enhance post ischemic angiogenesis. (frontiersin.org)

Accession H0024 Systematic name Allele 1: g.51431_51434delAGAA, c.155_158delAGAA, Systematic name p.28fsX32 Original code Sporadic case Description Allele 1: deletion in the exon 2 leading to a Description premature stop codon in the SUSHI1 domain Date 13-May-2003 (Rel. (lu.se)
Accession H0034 Systematic name Allele 1: g.54439_54463delTTAATTACCGTGAATGTGACACAGA, Systematic name c.371_395delTTAATTACCGTGAATGTGACACAGA, Systematic name r.371_395deluuaauuaccgugaaugugacacaga, p.Ile124fsX13 Original code Patient 9 Description Allele 1: a frame shift deletion mutation in the exon Description 4 leading to a premature stop codon in the SUSHI2 domain Date 23-Dec-2004 (Rel. (lu.se)

Furthermore, interleukin 8 and vascular endothelial growth factor were more strongly expressed in Colo357L3.6pl than Colo357FG cells, and these findings were confirmed in Colo357L3.6pl and Colo357FG orthotopic tumors. (duke.edu)

SCOPe: Structural Classification of Proteins - extended. (berkeley.edu)
The virion envelope surrounding the nucleocapsid contains the following structural proteins: S (spike), M (matrix), E (envelope) and N (nucleocapsid). (iucr.org)
Finally, comparison with our previous invertebrate BEN structures, along with additional structural predictions using AlphaFold2 and RoseTTAFold, reveal distinct strategies for target DNA recognition by different types of BEN domain proteins . (bvsalud.org)

Polymorphisms of Vascular Endothelial Growth Factor and Retinopathy of Prematurity. (cdc.gov)

Finally, we showed that Bonus SUMOylation is mediated by the SUMO E3-ligase Su(var)2-10, revealing that although SUMOylation of TIF1 proteins is conserved between insects and mammals, both the mechanism and specific site of modification is different in the two taxa. (elifesciences.org)

1,100 muscle-targeted RNAi interventions to comprehensively assess the function of 447 transcription factors in the developmental growth of body wall skeletal muscles in Drosophila. (sdbonline.org)

Figure 2: CPK (Corey-Pauling-Koltun) representation of RF2 domain constellations in the two conformations. (nature.com)

1251 orc1%2Fcdc6 family replication initiation protein CP001857 CDS Arcpr_0002 1251. (go.jp)
9195) PhoH family protein CP001857 CDS Arcpr_0008 9278. (go.jp)
41666) ExsB family protein CP001857 CDS Arcpr_0048 41748. (go.jp)
45756) PEBP family protein CP001857 CDS Arcpr_0056 45795. (go.jp)
47904) TATA-box binding family protein CP001857 CDS Arcpr_0059 47991. (go.jp)
The most effective enhancer in cleavage stage mouse embryos depends on DNA binding sites for TEF-1, the prototype for a family of transcription factors that share the same TEA DNA binding domain. (embl-heidelberg.de)
Different members of the Ets family proteins display distinct DNA binding specificities. (embl.de)
Members of the ets family of transcription factors share a conserved DNA-binding domain, the ets domain. (embl.de)
The Ets family of transcription factors. (embl.de)
Alternative translocations include EWS-ERG t(21;22), EWS-ETV t(7;22), and EWS-FEV t(2;22), all of which involve the ETS family protein. (medscape.com)
HGF forms a family with HGF-like protein (HLP), a unique protein with a domain structure similar to that of HGF ( 12 ). (spandidos-publications.com)
TRIM/RBCC is an ancient protein family characterized by the presence of an N-terminal RING finger domain closely followed by one or two B-boxes and a coiled coil domain. (elifesciences.org)
Here, we characterize several mammalian BEN domain (BD) factors, including from two NACC family BTB-BEN proteins and from BEND3, which has four BDs. (bvsalud.org)

Quantifying the relative concentration of these two proteins in a patient's tumor, Ladbury said, might be developed into reliable markers for gauging the likelihood that the cancer will spread and guide treatment decisions. (mdanderson.org)

Using affinity chromatography coupled to multidimensional protein identification technology (MudPIT), DEAF-1 was identified as a candidate regulator. (sdbonline.org)
Recombinant protein was captured through anti-DDK affinity column followed by conventional chromatography steps. (origene.com)

The active substance of ELOCTA, efmoroctocog alfa, is a recombinant human coagulation factor VIII, Fc fusion protein (rFVIIIFc) comprising B-domain deleted (BDD) human FVIII covalently linked to the Fc domain of human immunoglobulin G1(IgG1). (janusinfo.se)

Altogether, this study defines the repertoire of transcription factors that regulate developmental myofiber growth and the role of Gsk3/Deaf1/glycolysis in this process. (sdbonline.org)

In particular, X-ray structures of BEN domain DNA complexes are only known for Drosophila factors bearing a single BEN domain, which lack direct vertebrate orthologs. (bvsalud.org)

Thus, the region of fHbp encompassing residues 25-59 in the N-terminal domain is important for eliciting antibodies that can cooperate with other anti-fHbp antibodies for cross-reactive bactericidal activity against strains expressing fHbp from different antigenic variant groups. (unimol.it)
The N-terminal domain of the nucleocapsid protein from Middle East respiratory syndrome coronavirus (MERS-CoV NP-NTD) contains many positively charged residues and has been identified to be responsible for RNA binding during ribonucleocapsid formation by the virus. (iucr.org)
domain causing residues 59 and 64 in Rac-1 to be displaced. (cellsignal.com)

By using multidimensional NMR, we have determined the structure of the ets domain of human Fli-1 in the DNA-bound form. (embl.de)

Anatomy19

Organisms14

Chemicals and Drugs106

Analytical, Diagnostic and Therapeutic Techniques and Equipment34

Phenomena and Processes83

Information Science4

Health Care2

Mitogen-activa2

Gene20

Transcription factor9

Nuclear8

Genes6

Receptor9

Kinase1

Superfamily1

Bind6

Escherichia1

Peptides3

Sequence6

Binds5

Kinases1

MRNA3

Amino-acid3

Transcriptional3

Metabolism1

Homologous2

Subunit1

Tyrosine2

Ribosomal protein1

Species2

Mediate1

Highly conserved1

LIGANDS2

Cell proliferation1

Folds1

Epithelial2

Virulence1

Eukaryotic1

Structurally1

Subfamily1

Cytokines2

Differentiation1

Cellular2

Biochemistry1

Consists1

Locus1

Hypoxia-induci1

Premature stop2

Interleukin1

Structural3

Vascular endoth1

Mammals1

RNAi1

Constellations1

Family13

Tumor1

Affinity2

Recombinant1

Regulate1

Vertebrate Orthologs1

Residues3

Multidimensional1