KinasePhosphorylationKinasesTyrosineGeneImatinibInhibitorInducesApoptosisPathwaysMutantInhibitorsInhibitionChronic myeloidAutophagyCharacterizationMurineCellsFamily of proteinsMyeloid leukemiaResistanceGenesHomologyReceptorEncodes a proteinMembrane proteinSerineRegulatorLeukemiaBreakpointFunctionalUbiquitinationSynthesisClinicalLymphoidPhosphorylatesPatientsFunctionallyRegulationMutationCellCellularChromosomeG93AMRNAAdaptorActivationMutationsInductionActivity
Kinase16
- The PHLPP isoforms (PH domain and Leucine rich repeat Protein Phosphatases) are a pair of protein phosphatases, PHLPP1 and PHLPP2, that are important regulators of Akt serine-threonine kinases (Akt1, Akt2, Akt3) and conventional/novel protein kinase C (PKC) isoforms. (wikipedia.org)
- In addition, PHLPP dephosphorylates conventional and novel members of the protein kinase C family at their hydrophobic motifs, corresponding to Ser-660 in PKCβII. (wikipedia.org)
- These enzymes are members of the serine/threonine-specific protein kinase family (EC 2.7.11.1). (wikipedia.org)
- PHLPP1 and 2 also dephosphorylate the hydrophobic motifs of two classes of the protein kinase C (PKC) family: the conventional PKCs and the novel PKCs. (wikipedia.org)
- The hallmark of Philadelphia chromosome positive (Ph+) leukemia is the BCR/ABL kinase, which is successfully targeted by selective ATP competitors. (bios-mep.info)
- The derivative chromosome BIBR 953 22 is the so called Philadelphia chromosome (Ph) which encodes the BCR/ABL kinase. (bios-mep.info)
- Two principal breaks occur in the (breakpoint cluster region) gene locus on chromosome 22: the (major) M-BCR, between exons 12 and 16, and the (minor) m-BCR, in the first intron of and m-BCR to that of p185(Abelson tyrosin protein kinase 1) gene on chromosome 9 falls within the intron between the exons 1 and 2. (bios-mep.info)
- The native ABL kinase is finely regulated in response to growth factors and other stimuli [11]. (bios-mep.info)
- Through the fusion to BCR, ABL constitutively activates its down-stream signaling pathways, including RAS, JAK/STAT and PI-3 kinase [1,12]. (bios-mep.info)
- Here, we demonstrate that the S phase checkpoint protein CHK1 is maintained in a low phosphorylation state in Spi1/PU.1-overexpressing cells and provide evidence that this is not due to negative control of its primary kinase ATR. (oncotarget.com)
- The most frequently identified mechanism of acquired secondary imatinib resistance involves point mutations associated with BCR-ABL kinase domain name that inhibit imatinib binding [13]. (abic2004.org)
- In contrast, classical immune (type I/ II) cytokine receptors do not have intrinsic protein kinase activity but associate with the Janus family of kinases (JAKs). (openrheumatologyjournal.com)
- The mechanistic analysis of antimycin A revealed that it enhanced the degradation of c-Myc protein through the activation of glycogen synthetic kinase 3 by reactive oxygen species (ROS) from damaged mitochondria. (bvsalud.org)
- Dr. Gray has also developed structure-based, generalized approaches for designing drugs to overcome one of the most common mechanisms of resistance observed against most kinase inhibitor drugs, mutation of the so-called 'gatekeeper' residue, which has been observed in resistance to drugs targeting BCR-ABL, c-KIT and PDGFR. (stanford.edu)
- An in vitro immunocomplex kinase assay indicated that the rpS3 protein acts as a substrate for Lyn, which phosphorylates the Y167 residue of rpS3. (bmbreports.org)
- Equipped with a mouse model of stress (5-HT1A-R-/- mice) and a 5-HT1A-R-expressing hippocampal neuron-derived cell line, HN2-5, our earlier studies have reported that a 5-HT1A-R-mediated signaling pathway functions via extracellular receptor-activated kinase 1/2 (ERK1/2)-catalyzed activation of protein kinase C alpha (PKC) to promote synaptogenesis at P15 in the hippocampal CA1 region [12,16]. (thetechnoant.info)
Phosphorylation4
- The results revealed that AVM inhibited the phosphorylation of BCR/ABL and their subsequent molecular signals including AKT and MAPK activation. (spandidos-publications.com)
- Administration of dasatinib attenuated each c Abl phosphorylation and caspase three activation inside a dose dependent method. (smadpathway.com)
- instead cytokines function through binding to a cognate receptor proteins, which trigger phosphorylation and activation of intracellular signaling proteins. (openrheumatologyjournal.com)
- The compound enhanced the c-Myc phosphorylation of threonine-58, consequently increasing the proteasome-mediated c-Myc degradation. (bvsalud.org)
Kinases5
- The fusion proteins p185and p210are mutant ABL kinases. (bios-mep.info)
- Protein phosphatases play essential roles as negative regulators of kinases and signaling cascades involved in cytoskeletal organization. (cancerbiomed.org)
- of c Abl signaling to MST kinases more builds the situation that c Abl can be a crucial regulator in neuronal cell death. (aktinhibitor.com)
- Selective for Bcr-Abl over a panel of serine, threonine and tyrosine kinases. (tocris.com)
- Classification of nonenzymatic homologues of protein kinases. (leibniz-fli.de)
Tyrosine1
- Upon cytokine activation receptor chain- bound STATs are then phosphorylated on the tyrosine residues, which results in dimerisation of STAT proteins that translocate to the nucleus and activate gene transcription. (openrheumatologyjournal.com)
Gene16
- The fusion gene on der9 differs between m-BCR-p185and M-BCR-p210gene encodes a small ABL/BCR with an approximate molecular mass of 40 kDa (p40transcript is detectable in 65% of the CML patients [15] and the p96transcript is present in 100% of examined patients with m-BCR Ph+ ALL [16]. (bios-mep.info)
- [ 1 ] His prediction was subsequently supported by the cloning of the retinoblastoma tumor suppressor gene ( RB1 ) and by functional studies of the retinoblastoma protein, Rb. (medscape.com)
- For example, the TP53 gene, located on chromosome 17, encodes a 53-kd nuclear protein that functions as a cell cycle checkpoint. (medscape.com)
- PP2A, a serine/threonine phosphatase composed of 3 distinct subunits-65-kDa PP2A-A (scaffold subunit), 55-kDa PP2A-B (regulatory subunit), and 37-kDa PP2A-C (catalytic subunit)-constitutes 0.2%-1.0% of the total protein content in mammalian cells and has been implicated in the regulation of diverse cellular processes, including signal transduction, cell cycle progression, DNA replication, gene transcription, and protein translation 5 - 8 . (cancerbiomed.org)
- Note that by convention gene names are italicized and the proteins they make are not. (cancerquest.org)
- As an example TP 53 refers to the gene and p53 refers to the protein. (cancerquest.org)
- An abnormal chromosomal translocation known as t(9;22) results in the establishment of the Philadelphia chromosome, which contains the BCR-ABL gene, culminating in the development of this syndrome ( 1 ). (spandidos-publications.com)
- [ 2 ] Histones are proteins that both provide structural support for DNA (DNA wraps around a core of histones to form nucleosomes) and are involved in the regulation of gene expression. (medscape.com)
- 05. Between the 69 ejaculated proteins, 68 may very well be linked to Gene Ontology data. (smadpathway.com)
- Chronic myeloid leukemia (CML) is characterized by the presence of BCR-ABL1 fusion gene. (cmleukemia.com)
- The protein encoded by this gene belongs to the pyridine nucleotide-disulfide oxidoreductase family, and is a member of the thioredoxin (Trx) system. (cancerindex.org)
- What does this gene/protein do? (cancerindex.org)
- What pathways are this gene/protein implicaed in? (cancerindex.org)
- Using in vitro cell lines derived in from conditional MYC, RAS, and BCR-ABL transgenic murine models and oncogene-driven human cell lines, we determined gene regulation, metabolic profiles, and sensitivity to inhibition of lipogenesis in lymphoid malignancies. (biomedcentral.com)
- This gene encodes a transcription factor belonging to a family of proteins that share homology with the high mobility group protein-1. (cancer-genetics.org)
- The protein encoded by this gene can bind to a functionally important site in the T-cell receptor-alpha enhancer, thereby conferring maximal enhancer activity. (cancer-genetics.org)
Imatinib7
- Targeting BCR/ABL by selective ATP competitors, such as imatinib or nilotinib, is a well validated therapeutic concept, but unable to definitively eradicate the disease. (bios-mep.info)
- However, mutation or amplification is not observed in 50% or more of IM-resistant CML patients [14C16] and the molecular basis of such BCR-ABL-independent imatinib resistance is poorly comprehended. (abic2004.org)
- Interestingly, Spautin-1 enhances imatinib mesylate (IM)-induced CML cell apoptosis by reducing the expression of the anti-apoptotic proteins Mcl-1 and Bcl-2. (cancer-research-network.com)
- As a result, cells expressing different forms of BCR/ABL were recruited for the present study, including K562 (human wild‑type) or TCCY‑T315I (human imatinib‑resistant) and the Ba/F3‑(T315I/E279K/Y253H) (mouse BCR/ABL point mutation‑transfected cells). (spandidos-publications.com)
- Interestingly, AVM appeared to be more sensitive to imatinib‑resistant (T315I, Y253H, and E279K) than wild‑type BCR/ABL cells, indicating its potential to overcome imatinib‑resistant severe issues in CML. (spandidos-publications.com)
- Focusing on preventing BCR-ABL activation is quite efficient, as imatinib has demonstrated, but may not be the optimal option. (spandidos-publications.com)
- Thus, cells expressing different forms of BCR/ABL were recruited for the present study, including K562 [human wild-type (WT)] or TCCY-T315I [human imatinib-resistant (IR)] and the Ba/F3-(T315I/E279K/Y253H) (mouse BCR/ABL point mutation-tranfected cells). (spandidos-publications.com)
Inhibitor5
- Nrf2 consists of six functional Neh domains (Neh1-Neh6), from which, the amino-terminal Neh2 domain controls binding Keap1-the inhibitor protein Kelch-like ECH-associated protein 1, that is responsible for the cytosolic sequestration of Nrf2 under physiological conditions (Fig. 2 a). (springer.com)
- The p16INK4A protein is a cell-cycle inhibitor that acts by inhibiting activated cyclin D:CDK4/6 complexes, which play a crucial role in the control of the cell cycle by phosphorylating Rb protein. (medscape.com)
- doi:10.1371 MEK inhibitor cancer journal.pone.0036562.g002 A Conserved Signaling Pathway in Neuron Apoptosis PLoS One particular www.plosone.org 4 May perhaps 2012 Volume 7 Difficulty 5 e36562 Elements and Techniques Plasmids and transfection The plasmids made use of have been as follows: pCMV Myc c Abl was a present from Dr. Cheng Cao. (aktinhibitor.com)
- Using cell lines derived from conditional MYC, RAS, and BCR-ABL transgenic murine models, we demonstrate shared responses to inhibition of lipogenesis by the acetyl-coA carboxylase inhibitor 5-(tetradecloxy)-2-furic acid (TOFA), and other lipogenesis inhibitors. (biomedcentral.com)
- ATM inhibitor review by quite a few downstream proteins during the HGF c Met pathway. (hormonespathway.com)
Induces3
- Notably, the inhibition of BCR-ABL by TKIs induces autophagy [20] that is a cell-survival response in CML stem cells [21]. (abic2004.org)
- inhibits proliferation and induces apoptosis in Bcr-Abl-expressing cells. (tocris.com)
- GSK699 (GSK-699) is a potent, cell penetrant PCAF/GCN5 PROTAC, induces concentration-dependent degradation of PCAF and GCN5 in THP1 cells. (probechem.com)
Apoptosis1
- It is thus concluded that AVM inhibits the activity of BCR/ABL and their subsequent molecular signals, including AKT and MAPK, resulting in cytotoxicity via apoptosis. (spandidos-publications.com)
Pathways3
- Akt1 is also able to induce protein synthesis pathways, and is therefore a key signaling protein in the cellular pathways that lead to skeletal muscle hypertrophy, and general tissue growth. (wikipedia.org)
- Our results support the relevance of NOX2 to regulate metabolism-related signalling pathways downstream of BCR-ABL. (biomed.news)
- Fault tolerance in protein interaction networks: stable bipartite subgraphs and redundant pathways. (leibniz-fli.de)
Mutant5
- The mutant proteins often retain some of their capabilities but are no longer sensitive to the controls that regulate the normal form of the protein. (cancerquest.org)
- The cytotoxicity of mutant SOD1s was also measured by lactate dehydrogenase release assay at 48 h following the induction of SOD1 proteins. (hormonespathway.com)
- c Abl activation attributable to mutant SOD1 in NSC 34 cells We then investigated no matter whether overexpression of mutant SOD1s influenced the expression of c Abl. (hormonespathway.com)
- Western blot assessment revealed that the expression of c Abl was better in cells expressing mutant SOD1s than cells expressing wild variety SOD1. (hormonespathway.com)
- Our review is targeted over the four primary subfamilies: Change/sucrose non-fermentable (SWI/SNF), imitation SWI (ISWI), chromodomain-helicase DNA-binding proteins (CHD), and INOsitol-requiring mutant 80 (INO80). (morainetownshipdems.org)
Inhibitors3
- Inhibitors of Bcr-abl. (tocris.com)
- Discovery and optimization of chromenotriazolopyrimidines as potent inhibitors of the mouse double minute 2-tumor protein 53 protein-protein interaction. (leibniz-fli.de)
- Small molecule protein-protein interaction inhibitors as CNS therapeutic agents: current progress and future hurdles. (leibniz-fli.de)
Inhibition3
- This approach was based on the assumption that the deregulation of a protein was causally linked to a disease state, and the pharmacological intervention through inhibition of the deregulated target was able to restore normal cell function. (biomedcentral.com)
- His research utilizes the tools of synthetic chemistry, protein biochemistry, and cancer biology to discover and validate new strategies for the inhibition of anti-cancer targets. (stanford.edu)
- Protein-protein interaction inhibition (2P2I): fewer and fewer undruggable targets. (leibniz-fli.de)
Chronic myeloid1
- The proportion of different BCR-ABL1 transcript types in chronic myeloid leukemia. (cmleukemia.com)
Autophagy5
- Autophagy refers to the natural and conservative degradation of cells through lysosome dependent regulation mechanism. (cancer-research-network.com)
- Moreover, autophagy is generally a non-selective degradation system because autophagosomes engulf part of the cytoplasm. (cancer-research-network.com)
- Furthermore, autophagy is an intracellular degradation system that transports cytoplasmic components to lysosomes. (cancer-research-network.com)
- Autophagy is a self-degradation process. (cancer-research-network.com)
- Autophagy plays a housekeeping role in removing misfolded or aggregated proteins, removing damaged organelles, eliminating intracellular pathogens. (cancer-research-network.com)
Characterization1
- Systematic characterization of the protein interaction network and protein complexes in Saccharomyces cerevisiae using tandem affinity purification and mass spectrometry. (leibniz-fli.de)
Murine1
- We utilize preclinical murine models and transgenic primary model of T-ALL to determine the effect of lipogenesis blockade across BCR-ABL-, RAS-, and c-MYC-driven lymphoid malignancies. (biomedcentral.com)
Cells5
- In models of Ph+ ALL we show that the functional interplay between ABL/BCR and BCR/ABL not only increases the transformation potential of BCR/ABL but is also indispensable for the growth and survival of Ph+ ALL leukemic cells. (bios-mep.info)
- We present a method enabling simultaneous, ultra-high throughput single-cell barcoding of millions of cells for targeted analysis of proteins and RNAs. (nature.com)
- Genes whose protein products stimulate or enhance the division and viability of cells. (cancerquest.org)
- We examined cells from mouse models of MYC-, RAS-, and BCR-ABL-driven lymphoid malignancies and find a convergence on de novo lipogenesis. (biomedcentral.com)
- Constructing glucagon like peptide-1 receptor fused with derivatives of GFP for visualizing protein-protein interaction in living cells. (leibniz-fli.de)
Family of proteins1
- RANK lacks intrinsic enzymatic activity in its intracellular domain, and it transduces signaling by recruiting adaptor molecules such as the TRAF family of proteins [8]. (plasignaling.com)
Myeloid leukemia1
- In fact M-BCR p210is associated with primarily myeloid leukemia. (bios-mep.info)
Resistance1
- Additionally, several resistance mechanisms, such as BCR-ABL genomic amplification, are considered ( 4 ). (spandidos-publications.com)
Genes6
- The multifunctional regulator nuclear factor erythroid 2-related factor (Nrf2) is considered not only as a cytoprotective factor regulating the expression of genes coding for anti-oxidant, anti-inflammatory and detoxifying proteins, but it is also a powerful modulator of species longevity. (springer.com)
- The major characteristics of Nrf2 are to some extent mimicked by Nrf2-dependent genes and their proteins including heme oxygenase-1 (HO-1), which besides removing toxic heme, produces biliverdin, iron ions and carbon monoxide. (springer.com)
- Like Rb protein, many of the proteins encoded by tumor suppressor genes act at specific points in the cell cycle. (medscape.com)
- Genes whose protein products can directly or indirectly prevent cell division or lead to cell death. (cancerquest.org)
- Splicing factor mutations alter splicing in different ways and affect the expression of different genes involved in RNA splicing, protein synthesis, and mitochondrial function, suggesting common mechanisms of action in MDS. (medscape.com)
- 2nd, we qualitatively examined genes to search for commonality of function amid proteins with high NSAF. (smadpathway.com)
Homology1
- It bears no evident homology to any identified protein Recentin and its expression pattern is quite much like that of tau. (aktinhibitor.com)
Receptor1
- The conventional PKCs can be activated by calcium and diacylglycerol, two important mediators of G protein-coupled receptor signaling. (wikipedia.org)
Encodes a protein2
- This locus, however, also encodes a protein from an alternative reading frame, designated p19ARF. (medscape.com)
- Loss-of-function mutations of ASXL1 , which encodes a protein that recruits the PRC2 complex to the histones, is a driver event in some cases of MDS/MPN. (medscape.com)
Membrane protein1
- Deciphering soluble and membrane protein function using yeast systems. (leibniz-fli.de)
Serine1
- Protein phosphatase 2A (PP2A) is highly conserved and is the predominant serine/threonine phosphatase in the nervous system, constituting more than 70% of all neuronal phosphatases. (cancerbiomed.org)
Regulator1
- Native BCR acts as a negative regulator of proliferation and oncogenic transformation by a down-regulation of RAS-mediated signaling [18]. (bios-mep.info)
Leukemia2
- The presence of ABL/BCR changed the phenotype of the leukemia most likely due to its capacity CR2 to influence the stem cell population as shown by our data. (bios-mep.info)
- Tripartite Motif Containing 13 (TRIM13), a member of TRIM proteins, is deleted in multiple tumor types, especially in B-cell chronic lymphocytic leukemia and multiple myeloma. (cancerindex.org)
Breakpoint1
- Here we have analysed the relevance of NOX2 and NOX4 in the regulation of metabolism in chronic myeloid leukaemia (CML), a neoplasia driven by the expression of the breakpoint cluster region-Abelson fusion oncogene (BCR-ABL). (biomed.news)
Functional3
- It belongs to a group of EF-hand Ca2+?binding proteins including CAPN (calpain), ALG2, and SRI (sorcin), which show structural rather than functional similarity [28]. (abic2004.org)
- Testing for functional overrepresentation We took two approaches to recognize critical functions in ejaculated proteins. (smadpathway.com)
- The SurvivinGp localizes like a standard CPC protein capable of interacting with human CPC members To evaluate the functional properties on the guinea pig Survivin protein with people of its human homologue, we to begin with examined its localization while in mitosis. (mirnamimic.com)
Ubiquitination1
- Under normal conditions, Keap1 promotes ubiquitination and eventual degradation of Nrf2. (springer.com)
Synthesis1
- Ribosomal protein S3 is a protein component of the ribosome, which is a cellular structure that plays a central role in protein synthesis. (bmbreports.org)
Clinical1
- In principle, we really should not recognize SCH66336 clinical trial unlabeled proteins except if i sure proteins fail to integrate 15N, one example is proteins with low prices of turnover, or ii the male mounted and transferred some proteins without the need of genuine ejaculation. (smadpathway.com)
Lymphoid1
- In a panel of human cell lines, we demonstrate sensitivity to TOFA treatment as a metabolic liability due to the general convergence on de novo lipogenesis in lymphoid malignancies driven by MYC, RAS, or BCR-ABL. (biomedcentral.com)
Phosphorylates2
- The CDK4-cyclinD complex normally phosphorylates the retinoblastoma protein (Rb protein), leading to release of the E2F transcription factor and cell cycle progression. (medscape.com)
- The classical NF-κB MGCD0103 datasheet signaling pathway involves the activation of the IKK complex, which phosphorylates IκBα and targets them for ubiquitin-dependent degradation [8]. (plasignaling.com)
Patients1
- On the other hand about 30% of patients with Ph+ ALL harbor the M-BCR p210or p210[5,6,7]. (bios-mep.info)
Functionally1
- The aim of this selleck chemicals llc study was to assess the expression patterns of these three functionally relevant proteins, PAX5, c Met and paxillin, in the setting of neuroendocrine tumors with the lung. (hormonespathway.com)
Regulation2
- Negative regulation of protein phosphatase 2A (PP2A) as an adjuvant therapy has demonstrated such chemo- and radio-sensitizing effects 4 . (cancerbiomed.org)
- Having said that, no matter whether c Abl mediated regulation of MST1 and MST2 plays some distinct roles in other conditions is JNK Pathway always to be an exciting question in the future scientific studies. (aktinhibitor.com)
Mutation1
- The hpRNA targeting sequences applied consist of MST2 hpRNA: GGAATATTCTCCTCAATAC, c Abl hpRNA one, GACCAACCTGTTCAGCGCT, c Abl hpRNA 2, AAGCAGCTCGATGGACCTCCA, MST2 Rescue plasmids were created by developing three silent base pair mutations during the WT or mutation sequences. (aktinhibitor.com)
Cell6
- The inhibitory effect of BCR/ABL on the B-cell signaling is counteracted by the ABL/BCRs, the reciprocal t(9;22) fusion proteins [13]. (bios-mep.info)
- The p19ARF protein, which is encoded by the same locus as p16, also leads to cell cycle arrest by inhibiting the ability of MDM2 to inactivate TP53. (medscape.com)
- We found that TRIM13 mRNA and protein expression was reduced in NSCLC tissues and cell lines in comparison to paired non-cancerous tissues and a human normal bronchial epithelial cell line, respectively. (cancerindex.org)
- Proteomics-Based Discovery of First-in-Class Chemical Probes for Programmed Cell Death Protein 2 (PDCD2). (stanford.edu)
- One particular of them is paxillin, a crucial focal adhesion protein that is definitely important for cell matrix adhesion, cell motility and migration. (hormonespathway.com)
- Western blot assessment confirmed that myc tagged human SOD1 proteins were induced by doxycycline in these cell lines. (hormonespathway.com)
Cellular2
- Specifically, it allows the orderly degradation and recovery of cellular components. (cancer-research-network.com)
- Oxidative stress generated during such stressful conditions may damage DNA and proteins, and as a consequence the cellular processes are disturbed. (springer.com)
Chromosome1
- Little is known about the role of the fusion protein encoded by the reciprocal derivative chromosome 9, the ABL/BCR. (bios-mep.info)
G93A1
- Considering the fact that amounts of total and active c Abl had been enhanced from the spinal cords of G93A mice at the early stage in the disease, dasatinib seems to enhance NMJ perform by way of c Ablmediated signaling. (smadpathway.com)
MRNA1
- Both technologies have been primarily focused on measurement of protein epitopes, but have been used to measure nucleic acids such as targeted mRNA 11 , 12 . (nature.com)
Adaptor1
- Keap1 is a cysteine-rich protein, known to be anchored to actin cytoskeleton [ 5 ], serving as an adaptor protein for the Cul3-dependent E3 ubiquitin ligase complex. (springer.com)
Activation1
- GCA (grancalcin) is usually a cytosolic protein that is translocated to the granule membrane upon neutrophil activation [26,27]. (abic2004.org)
Mutations1
- Scope includes mutations and abnormal protein expression. (cancerindex.org)
Induction1
- deletion in vitro led to global boost of energetic histone marks and upsurge in proteins appearance through induction of Myc, aswell as acinar, to ductal metaplasia [49]. (morainetownshipdems.org)
Activity2
- BCR harbors both RHO-GEF and RAC-GAP functions and controls cytoskeleton modeling by regulating the activity of RHO-like GTPases [17,20]. (bios-mep.info)
- Ribosomal protein S3 (RpS3) is involved in protein biosynthesis as a component of the ribosome complex and possesses endonuclease activity to repair damaged DNA. (bmbreports.org)