Sirna rna interference. Medical search. Frequent questions

DNA detailed study DNA-directed RNA interference (DRNAI) is a gene-silencing technique that utilizes DNA constructs to activate an animal cell's endogenous RNA interference (RNAI) pathways. (wikipedia.org)
Zamore, P. D., Tuschl, T., Sharp, P. A. & Bartel, D. P. RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. (nature.com)
RNA interference (RNAi) for promoting osteoblastic bone formation is a promising approach to the challenges. (edu.hk)
The bottleneck for translating RNAi with efficiency and safety to clinical bone anabolic strategy is to seek targeted delivery systems for osteogenic siRNAs. (edu.hk)
The current proposal would provide a novel aptamer-functionalized osteoblast-targeting delivery system for osteogenic siRNAs to update the targeted delivery from tissue level toward cellular level for accommodating translation of RNAi-based clinical bone anabolic strategy in efficiency and safety to metabolic skeletal disorders associated with impaired bone formation. (edu.hk)
In particular, the RNA interference (RNAi) pathways are of notable significance for the control of viral infections. (mdpi.com)
Some of the same strategies already developed for delivery of siRNA for RNA interference (RNAi) also are being applied to miRNA. (genengnews.com)
Published in the March 21, 2010 advance online edition of the journal Nature , the results demonstrate the feasibility of using both nanoparticles and RNA interference (RNAi)-based therapeutics in patients. (nanowerk.com)
It's the first time anyone has found an RNA fragment from a patient's cells showing the mRNA was cut at exactly the right base via the RNAi mechanism," Davis said. (nanowerk.com)
The strategy is based on the RNA interference (RNAi), a process which has been the winning research of the Nobel Prize in Physiology or Medicine in 2006. (europa.eu)
RNAi is activated when RNA molecules occur as double-stranded pairs in the cell. (europa.eu)
Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. (scientistlive.com)
NEW YORK, Aug. 18 (GenomeWeb News) - About a year after reinventing itself as an RNAi company, Sirna Therapeutics (formerly Ribozyme Pharmaceuticals) appears to have gotten back into the swing of things. (genomeweb.com)
In April this year, Ribozyme changed its name and stock ticker symbol (RNAI) to reflect its new focus, and then netted $45 million in a round of private financing that included venture capital firms The Sprout Group, Venrock Associates, Oxford Bioscience Partners, Techno Venture Management, and Granite Global Ventures -- all the while touting its RNA experience and IP estate as the keys to future success. (genomeweb.com)
There is some potential for RNAi to avoid the problems that were encountered in the clinic with ribozymes," said Douglas Fambrough, Sirna board member and principal at Oxford Bioscience, which invested about $8 million in the company for a mid-teens percentage stake. (genomeweb.com)
Small interfering RNAs (siRNAs) expressed from short hairpin RNAs (shRNAs) are a powerful way to mediate gene specific RNA interference (RNAi) in mammalian cells. (sigmaaldrich.com)
Experimentally confirmed target genes were identified for the 73 diagnostic miRNAs, from which proliferation genes were selected from CRISPR-Cas9/RNA interference (RNAi) screening assays. (cdc.gov)

Unlike small interfering RNA (siRNA) therapeutics that turn over within a cell and consequently only silence genes transiently, DNA constructs are continually transcribed, replenishing the cellular 'dose' of shRNA, thereby enabling long-term silencing of targeted genes. (wikipedia.org)
In a noteworthy development in the pharmaceutical industry, SiSaf Ltd, a renowned RNA delivery and therapeutics firm, recently announced that the U.S. FDA has granted Orphan Drug Designation and Rare Pediatric Disease Designation to its novel siRNA therapeutic, SIS-101-ADO, for the treatment of Autosomal Dominant Osteopetrosis Type 2 (ADO2). (biopharmatrend.com)
One of the most problematic has been finding a way to ferry the therapeutics, made up of fragile siRNAs, into tumor cells after injection into the bloodstream. (nanowerk.com)
This article provides an overview of the major pharmaceutical challenges facing siRNA therapeutics, focusing on the delivery strategies for synthetic siRNA duplexes in vivo, as this remains one of the most important issues to be resolved. (jci.org)
The tools and knowledge presented in this work will contribute to the development of future delivery strategies aimed at enhancing the effectiveness of siRNA and other nucleic acid-based therapeutics. (lu.se)

Our results suggest the potential use of the Ad-shRNAN1 for the delivery of siRNA in PPRV-infected animals, its use as a therapeutic tool against this disease and to open up vast prospects in terms of animal health. (europa.eu)
Lastly, several mechanistic barriers limiting the lipid nanoparticle delivery of siRNA and mRNA are identified. (lu.se)

DNA constructs are designed to express self-complementary double-stranded RNAs, typically short-hairpin RNAs, that bring about the silencing of a target gene or genes once processed. (wikipedia.org)
This construct was designed to express three therapeutic RNAs, one of which was a shRNA, thereby combating HIV replication in three different ways: shRNA, that silences the tat and rev genes of the HIV genome CCR5 ribozyme, inhibiting viral cell entry TAR decoy RNA, inhibiting initiation of viral transcription. (wikipedia.org)
This biological process involves the use of small interfering RNA (siRNA) molecules that can downregulate or suppress the expression of specific genes. (biopharmatrend.com)
Selecting siRNA is more complicated than choosing a code complementary to the sequence of the RNA to be silenced, because siRNA can sometimes silence multiple genes and its effects can often be unpredictable, Rux says. (the-scientist.com)
The discovery of RNA interference, the mechanism by which double strands of RNA silence genes, won researchers Andrew Fire and Craig Mello the 2006 Nobel Prize in Physiology or Medicine. (nanowerk.com)
Optimally designed and formulated siRNA should then efficiently enter target cells and escape endosomal and other intracellular compartments to become highly bioavailable inside the cells so as to exert sequence-specific gene-silencing activity with no or minimal effects on nontargeted genes or inadvertent stimulation of the immune system (steps v-x) (see text for detailed explanation). (jci.org)
Cells can inhibit the expression of intrinsic or foreign genes at the mRNA level by RNA interference. (europa.eu)
RNA interference occurs in plants, animals, and humans and it is already being used as a method to study the function of genes and as a defence strategy against diseases. (europa.eu)
Synthetic antisense RNAs are used to effect the functioning of specific genes for investigative or therapeutic purposes. (genomicglossaries.com)
RNA interference of the glycoprotein-D and DNA polymerase genes of feline herpesvirus by synthetic siRNAs. (vin.com)
This defense mechanism is triggered by double stranded RNA, and small interfering RNAs can be chemically produced and delivered to cells to silence specific genes of interest. (vin.com)
Therefore, we implemented a short interfering RNA (siRNA) screen with 16,560 siRNAs targeting 5,520 unique druggable human genes aimed at identifying these survival genes in the T98G glioma cell line because glioblastoma represents a challenging form of cancer for chemotherapy. (aspetjournals.org)
We analyzed cell viability at 96 hr after siRNA transfection with two orthogonal statistical methods and identified 55 survival genes that encoded proteases, kinases, and transferases. (aspetjournals.org)
The results of this study should broaden our understanding of the core genes and pathways that regulate cell survival, and we highlight the potential significance of proteasome inhibition, through either small molecule inhibition or RNA interference. (aspetjournals.org)

miRNAs trigger widespread epigenetically activated siRNAs from transposons in Arabidopsis . (nature.com)
miRNAs are a family of small non-coding RNAs that emerged as significant and versatile regulators involved in regulation of immune responses. (frontiersin.org)
MicroRNAs (miRNAs) are highly conserved, single-stranded, small non-coding RNAs that have been shown to act as essential regulators of gene expression at the posttranscriptional level. (frontiersin.org)
While siRNAs are double-stranded oligonucleotides that perfectly pair to degrade their target mRNA, miRNAs can pair perfectly or imperfectly. (genengnews.com)
Both miRNAs and siRNAs need to be delivered into the target tissue or cell in order to activate the desired therapeutic effect," Muthiah Manoharan, Ph.D., senior vp, drug discovery, Alnylam Pharmaceuticals, explained. (genengnews.com)
In addition, the lipid nanoparticles (LNP) platform, which has proven to be effective with siRNAs, is also showing promise with miRNAs and miRNA mimics. (genengnews.com)
DEFB1 expression after transfection with two micro RNAs (miRNAs), hsa-miR-186-5p and hsa-miR-340-5p, provided evidence that DEFB1 expression could be modulated by these miRNAs and hsa-miR-186-5p had a higher binding efficiency with DEFB1. (cdc.gov)

Collectively, this information is essential for the selection of optimally acting siRNA delivery system combinations for the many proposed applications of RNA interference. (jci.org)

To comprehend the potential of SIS-101-ADO, one needs to understand the basic working mechanism of RNA interference. (biopharmatrend.com)
6) To investigate the mechanism of the L6-mediated siRNA cellular uptake and sub-cellular trafficking. (edu.hk)
It proves that the RNA interference mechanism can happen using siRNA in a human. (nanowerk.com)
In hepatocytes, inclisiran utilizes the RNA interference mechanism and directs catalytic breakdown of mRNA for PCSK9. (centerwatch.com)
RNA interference is a RNA-guided gene regulatory mechanism that is found in a variety of eukaryotic organisms, including yeast, plants, and mammals. (vin.com)
In hepatocytes, inclisiran utilizes the RNA interference mechanism and directs catalytic breakdown of mRNA for proprotein convertase subtilisin kexin type 9 (PCSK9). (medscape.com)
RNA interference is an evolutionary conserved gene regulatory mechanism that can be used by introducing exogenous synthetic double-stranded RNAs, so called small interfering RNA (siRNA). (lu.se)

Chemical modifications to provide drug-like properties to RNA molecules are used in the synthesis of both siRNAs and antimicroRNAs (antimiRs). (genengnews.com)
Double-stranded RNA (dsRNA) activates a biochemical machinery into the cell which degrades those mRNA molecules with a genetic code complementary to that of the dsRNA. (europa.eu)
RNA interference can be induced by synthetic short double-stranded RNA molecules containing around 21-25 nucleotides (short interfering RNAs - siRNAs). (europa.eu)
Such silencing RNA molecules can be introduced into the cell and activate the RNA interference machinery to silence the complementary mRNA sequence. (europa.eu)
Because alternative RNA splicing allows different types of mRNA molecules to be created from a single gene, it generates the diversity of protein function and structure that is essential to complex organisms. (genomicglossaries.com)
RNA molecules which hybridize to complementary sequences in either RNA or DNA altering the function of the latter. (genomicglossaries.com)
More specifically, antisense oligonucleotides that are useful as reagents for target validation , or as drugs, are engineered molecules that differ from natural RNA but that have a base sequence that is recognized as being complementary to a very specific mRNA sequence. (genomicglossaries.com)

L6 facilitated the intracellular uptake of the siRNA (encapsulated in LNPs) and subsequently gene knockdown in osteoblast other than in hepatocyte and PBC in vitro. (edu.hk)
Moreover, siRNA-mediated knockdown of KLF5 blocked the expression of CDX2, MUC2 and villin, but transfection of a KLF5 expression vector into esophageal epithelial cells promoted their transdifferentiation into columnar-like cells, as demonstrated by increased expression of the intestinal markers CDX2, MUC2 and villin. (jcancer.org)
In a human prostate carcinoma cell line, small interfering RNA (siRNA)-mediated knockdown of USP9X reduced IGF-IR as well as IRS-2 protein levels and increased their ubiquitination. (oncotarget.com)
With these methods, single-cell knockdown kinetics of cytosol delivered siRNA is determined, and the dose-response correlation between knockdown and intracellular siRNA concentration is elucidated. (lu.se)

Argonaute (AGO) proteins use small RNAs to recognize transcripts targeted for silencing in plants and animals. (nature.com)
In its previous incarnation, the company was focused on using ribozymes to cut up RNA encoding for disease-causing proteins. (genomeweb.com)

The pharmaceutical challenges to effective siRNA delivery and activity in vivo. (jci.org)
The challenges for effective siRNA delivery and activity in vivo range from the effective empirical or in silico design and selection of an effective siRNA sequence to its chemical modification or formulation with delivery vectors to improve biological stability and pharmacokinetics (steps i-iv). (jci.org)
The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo. (scientistlive.com)

Any RNA, including endogenous messenger RNA (mRNAs) or viral RNAs, can be silenced by designing constructs to express double-stranded RNA complementary to the desired mRNA target. (wikipedia.org)

87(5): 1663-1667] Specifically, the investigators started by priming whole cerebellar RNA with a synthetic oligonucleotide containing a T7 RNA polymerase promoter sequence. (genomicglossaries.com)

After second- strand cDNA synthesis, T7 RNA polymerase was used to generate aRNA. (genomicglossaries.com)

It builds on lipid nanoparticle technology by adding silicon for structural integrity and durability, resulting in nanoparticles with improved RNA loading capacity and protection from hydrolysis. (biopharmatrend.com)
Nanowerk News ) A team of researchers and clinicians from UCLA's Jonsson Comprehensive Cancer Center and the California Institute of Technology (Caltech) has published the first proof that a targeted nanoparticle-used as an experimental therapeutic and injected directly into a patient's bloodstream-can navigate into tumors, deliver double-stranded small interfering RNAs (siRNAs) and turn off an important cancer gene. (nanowerk.com)
They eventually created a four-component system featuring a unique polymer that can self-assemble into a targeted, siRNA-containing nanoparticle. (nanowerk.com)

Results show that prokaryotic and eukaryotic AGOs use distinct mechanisms for achieving target slicing and provide insights into small interfering RNA potency. (nature.com)
Sequence-specific gene silencing using small interfering RNA (siRNA) is a Nobel prize-winning technology that is now being evaluated in clinical trials as a potentially novel therapeutic strategy. (jci.org)
Leqvio (inclisiran) is a small interfering RNA (siRNA). (centerwatch.com)

SLN360 is designed to lower Lp(a) production by using RNA interference to silence messenger RNA transcribed from the LPA gene in liver cells. (medscape.com)

RNA-like oligonucleotides that are complementary to a portion of a target mRNA molecule. (genomicglossaries.com)
A complementary RNA sequence that binds to a naturally occurring (sense) mRNA molecule, thus blocking its translation. (genomicglossaries.com)

Additionally, we've made progress in hepatocyte-targeted in vivo gene silencing by modifying the siRNAs. (genengnews.com)
RNA silencing has recently been used for prevention of various mammalian viral infections both in vitro and in vivo. (vin.com)
The Boulder, Colo.-based company, which released its second-quarter results last Thursday, is conducting in vivo tests of its siRNA therapeutic candidates, and preparing to ask for the FDA's approval next year to begin clinical trials of at least one siRNA drug candidate, setting it up to possibly be the first to test the therapeutic possibilities of the technology in humans, according to company executives. (genomeweb.com)

These naturally occurring, noncoding, single-stranded RNAs (21-25 nucleotides long) base-pair with their target mRNA within the RISC (RNA-induced silencing complex). (genengnews.com)
After transcription, the shRNA is processed into active 21-nucleotides RNAs by a cellular enzyme called Dicer, and it recognises and destroys the viral mRNA target. (europa.eu)

Endogenous antisense RNAs function as regulators of gene expression by a variety of mechanisms. (genomicglossaries.com)

The antisense species processed from the shRNA can bind to the target RNA and specify its degradation. (wikipedia.org)
Natural sequence variations can render a single shRNA-target site unrecognizable, preventing RNA degradation. (wikipedia.org)
Perfect base pairing leads to the degradation of the mRNA (similar to siRNA), while imperfect complementarity inhibits translation. (genengnews.com)

This enables the efficient transfection and controlled release of the oligonucleotide payload, or the siRNA, to the targeted cells, in this case, osteoclasts and other cells expressing the mutant CLCN7 gene. (biopharmatrend.com)
The applicants have identified (AspSerSer)6 as a target moiety specifically approaching bone formation surface and further validated that (AspSerSer)6 could facilitate osteogenic siRNAs targeting osteogenic cells to promote bone formation in rodents (Zhang G. Nature Med 2012). (edu.hk)
Once they reach their target-in this case, the cancer cells within tumors-the nanoparticles enter the cells and release the siRNAs. (nanowerk.com)
With this adenovirus vector, an active siRNA sequences (N1-PPRV) was transcribed into the infected cells as a short hairpin RNA precursor (shRNA, with approximately 50 nt). (europa.eu)
We have demonstrated the ability of this modified vector to deliver efficiently siRNA and to decrease more than 100 times the amount of PPRV produced into the cells. (europa.eu)
Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. (scientistlive.com)

In contrast, RNA interference targets the messenger RNA (mRNA), which encodes the information needed to make a protein. (nanowerk.com)
There are many cancer targets that can be efficiently blocked in the laboratory using siRNA, but blocking them in the clinic has been elusive," said Dr. Antoni Ribas, associate professor of medicine and surgery, and a researcher at UCLA's Jonsson Comprehensive Cancer Center who is senior author of the study. (nanowerk.com)
As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. (scientistlive.com)
We identified neuregulin 3 (NRG3) as one of the targets of SNORD90, which we show is regulated through the accumulation of N6-methyladenosine modifications leading to YTHDF2-mediated RNA decay. (bvsalud.org)
We aim at identifying targets on DNA- or RNA-level that may facilitate the development of novel generations of highly efficient metal-based protocols for treatment of cancers. (lu.se)
Viral proteases (HCV and SARS-CoV) and viral RNA-dependent RNA polymerases (Lassa virus, HCV, WNV) are major targets, but treatments targeting viral enzymes often induce the rapid emergence of drug-resistant viruses. (cdc.gov)

Additionally, the mRNA fragments found were the exact length and sequence they should have been if they'd been cleaved in the spot targeted by the siRNA. (nanowerk.com)
RNA which contains an intron sequence that has an enzyme- like catalytic activity. (genomicglossaries.com)
siRNAs are sequence-specific inhibitors that are easily designed and could in theory target any gene of interest, making siRNA a promising modality for targeted therapy. (lu.se)

The latter is the same ribonucleoprotein machinery associated with siRNA-mediated gene silencing. (genengnews.com)
However, a key challenge in translating siRNA into the clinic is the inefficacy to deliver siRNA across the plasma membrane, but most importantly, to escape the endosomal system and reach the cytosol where they can interact with the RNA interference machinery. (lu.se)

So, LNPs with sufficient PEG shielding could serve as carriers for siRNAs to realize efficient extravasation from fenestrated capillaries to osteoblast and escape from MPS. (edu.hk)
Thus, aptamer-functionalized LNPs may be used as an efficient and safe delivery system for osteogenic siRNAs. (edu.hk)
Thereafter, the applicants linked L6 aptamer to the surface of the PEG-modified LNPs encapsulating osteogenic siRNA, i.e. (edu.hk)
L6-LNPs-siRNA, which had an average particle size of 84.0±5.3 nm and high encapsulation efficiency above 80% (Wu H et al. (edu.hk)
2012). L6-LNPs-siRNA showed satisfactory serum stability and no significant cytotoxicity in vitro. (edu.hk)
Further, osteoblast-selectivity of L6 aptamer did not alter after its linkage to LNPs-siRNA in vitro. (edu.hk)
We hypothesize that L6 aptamer could facilitate selectively targeting osteoblast for osteogenic siRNAs (encapsulated in LNPs) and subsequently promoting bone formation in established osteoporotic rodents. (edu.hk)
According to Dr. Manoharan, Alnylam is utilizing second-generation LNPs to enhance delivery of siRNAs in several models. (genengnews.com)

shRNAs that generate siRNAs intracellularly are expressed from amphotropic lentivirus viral particles, allowing screening in a wide range of mammalian cell lines. (sigmaaldrich.com)

Alnylam Pharmaceuticals is using its lipid nanoparticles platform to enhance delivery of siRNAs in several models. (genengnews.com)
In particular, advanced high resolution microscopy techniques have been used to in detail characterize and determine the efficacy of lipid mediated delivery of RNA. (lu.se)
This thesis advances our understanding on the limiting step of endosomal escape and cytosolic entry of RNA during lipid-based delivery. (lu.se)

In addition, nickel -induced activation of p38 MAPK was attenuated by a small interference of RNA specific to ASK1 (siRNA ASK1), implying that p38 MAPK was downstream of ASK1, while ASK1 activation was not reversely regulated by the inhibition of p38 MAPK by SB203580, a widely used p38 MAPK inhibitor. (cdc.gov)
An expression survey of a panel of glioma cell lines demonstrated expression of the proteasome component PSMB4, and the validity of the proteasome complex as a target for survival inhibition was confirmed in a series of glioma and non-glioma cell lines by pharmacological inhibition and RNA interference. (aspetjournals.org)

Still, there have been many potential roadblocks to applying RNA interference technology in humans. (nanowerk.com)

Silencing Akt by siRNA reduced the activation of ASK I and p38 MAPK and cell apoptosis, whereas without nickel stimulation, siRNA Akt had no effect on the activation of ASK1 and p38 MAPK. (cdc.gov)

Multi-cassette constructs that target multiple sites within the same viral RNA circumvent this issue. (wikipedia.org)
Furthermore, to facilitate the transfer of the functional interfering RNA sequences to infected animals, we have constructed a recombinant DNA viral vector commonly used as a vaccine. (europa.eu)

The aim of this thesis was to develop novel methods to study the process of endosomal escape and cytosolic delivery of RNA. (lu.se)
In a second study, endosomal structures damaged by membrane-destabilizing substances are characterized and their potential improvements on cholesterol conjugated siRNA delivery. (lu.se)

We conjugated an N-acetylgalactosamine moiety (GalNac) to siRNAs and achieved improved potency using subcutaneous delivery at low, clinically relevant doses. (genengnews.com)

Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. (scientistlive.com)
The purpose of this study is to determine the feasibility of using RNA interference to prevent or treat FHV-1 infections in vitro and to lay the ground work for a new therapeutic approach for the treatment of FHV-1 infected cats. (vin.com)

Non-target of hepatocytes and PBCs will facilitate reducing siRNA accumulation in liver and escaping from MPS uptake, respectively. (edu.hk)
Leqvio (inclisiran) is a double-stranded small interfering ribonucleic acid (siRNA), conjugated on the sense strand with triantennary N-Acetylgalactosamine (GalNAc) to facilitate uptake by hepatocytes. (centerwatch.com)

Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. (scientistlive.com)
Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. (scientistlive.com)
The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. (scientistlive.com)

As SiSaf prepares for first-in-human clinical trials for SIS-101-ADO, it's evident that this groundbreaking RNA therapy could well pave the way for new treatment options for rare bone and skeletal diseases. (biopharmatrend.com)

The FDA's recognition of SIS-101-ADO and the underlying RNA interference technology reinforces the potential of RNA-based therapies in managing a wide range of medical conditions. (biopharmatrend.com)
The development of therapies targeting messenger RNA has made possible significant lowering of lipoprotein(a). (medscape.com)

Slicing by DNA-guided prokaryotic AGOs has been studied in detail, but structural insights into RNA-guided slicing by eukaryotic AGOs are lacking. (nature.com)
Fig. 4: Structural basis for RNA slicing. (nature.com)

The short interfering RNA (siRNA) agent SLN360 was well tolerated and lowered lipoprotein(a) by up to 98% in volunteers without cardiovascular disease but with elevated Lp(a) in the small dose-ranging APOLLO trial. (medscape.com)
In a recently initiated project we are also investigating how short interfering RNAs (siRNA) might be used in combination with the metal-based drugs to optimize anticancer activity. (lu.se)

In the case of SIS-101-ADO, siRNA is used to suppress the expression of CLCN7, a mutant gene associated with ADO2. (biopharmatrend.com)
By suppressing its expression, the RNA therapy aims to restore bone mass and quality to nearly normal levels. (biopharmatrend.com)
Small interfering RNAs were used to inhibit PTPN2, STAT1, Bim, and Jun NH 2 -terminal kinase 1 (JNK1) expression. (diabetesjournals.org)
Investigating different cohorts of depressed individuals treated with serotonergic and other monoaminergic antidepressants, we found that the expression of a small nucleolar RNA, SNORD90, was elevated following treatment response. (bvsalud.org)
In a PCR array analysis of 84 transcription factors, either overexpressing DEFB1 or siRNA silencing of DEFB1 expression significantly modulated the expression of signal transducer and activator of transcription 3 (STAT3). (cdc.gov)

They are targeting the messenger RNA of the nucleoprotein gene of these viruses, then blocking the virus multiplication process. (europa.eu)

The work in our group focuses around studies of anticancer active drugs- and drug candidates and their interactions with DNA and RNA. (lu.se)

During this Marie Curie action, we have identified siRNA sequences capable of inhibiting more than 90 % of the replication of PPRV and RPV in infected cell cultures. (europa.eu)
Here, we explore the contribution of cell types to transcriptional sex dimorphism using single-cell RNA sequencing. (bvsalud.org)

Here we present cryogenic electron microscopy structures of the Arabidopsis thaliana Argonaute10 (AtAgo10)-guide RNA complex with and without a target RNA representing a slicing substrate. (nature.com)
Fig. 1: Structure of the AtAgo10-guide RNA complex without target RNA. (nature.com)
Nucleation, propagation and cleavage of target RNAs in Ago silencing complexes. (nature.com)
In the case of a GalNAc-conjugated siRNA targeting transthyretin (TTR), target gene silencing was achieved with an ED50 of approximately 5 mg/kg with a single subcutaneous injection. (genengnews.com)
These results represent a greater than 30-fold improvement in target gene silencing with siRNA conjugates as compared with first-generation siRNA conjugates previously described. (genengnews.com)
RNA interference therapy would specifically target FHV-1. (vin.com)

The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. (scientistlive.com)

Different gases emit at a specific wavelength which makes it identifiable when using a relevant Interference Bandpass Filter . (globalspec.com)

Anatomy17

Organisms25

Diseases2

Chemicals and Drugs101

Analytical, Diagnostic and Therapeutic Techniques and Equipment33

Psychiatry and Psychology1

Phenomena and Processes77

Disciplines and Occupations2

Technology, Industry, Agriculture2

Information Science4

RNAI17

Therapeutics5

Delivery of siRNA2

Genes14

MiRNAs7

Acting siRNA delivery1

Mechanism7

Molecules7

Knockdown4

Proteins2

Effective siRNA3

Double-str1

Synthetic1

Polymerase1

Nanoparticle3

Small int3

Silence1

Complementary2

Vivo3

Nucleotides2

Regulators of gene expression1

Degradation3

Cells6

Targets6

Sequence3

Machinery2

LNPs8

Mammalian1

Lipid3

Inhibition2

Humans1

Apoptosis1

Viral2

Endosomal2

Potency1

Vitro2

Hepatocytes2

Vectors3

Clinical trials1

Therapies2

Structural2

Short2

Expression5

Viruses1

Candidates1

Cell2

Target6

Effectiveness1

Specific1