There was an error running the query [insert into queries_english (query) values ('3' flanking region') on duplicate key update repetitions=repetitions+1, last=now() - You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near 'flanking region') on duplicate key update repetitions=repetitions+1, last=now()' at line 1]3' Flanking Region. Medical search. FAQ


There was an error running the query [select categoryid from categories where title like '3' Flanking Region' limit 1 - You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near 'Flanking Region' limit 1' at line 1]
  • exon
  • Three fragments of DGAT - 2 gene were investigated, only exon 3 of DGAT - 2 gene showed polymorphism. (springer.com)
  • The alignment between nucleotide sequences of NM_205793.2 in GenBank and the sequencing results of three PCR products with different patterns revealed that there was one mutation (A → G) in exon 3 of DGAT - 2 gene, which resulted in amino acid change (Lys → Arg) and constructed two genotypes (AA, AB). (springer.com)
  • A mutation in exon 3 (V102I) was diagnosed in an obese and diabetic. (wikipedia.org)
  • Allele frequency of exon 3 and exon 6 splice at an alliance mutation were analyzed to be similar in African American and mende tribe and was absent in Caucasians. (wikipedia.org)
  • contains
  • In a single strand of DNA or RNA, the chemical convention of naming carbon atoms in the nucleotide sugar-ring means that there will be a 5′-end, which frequently contains a phosphate group attached to the 5′ carbon of the ribose ring, and a 3′-end (usually pronounced "five prime end" and "three prime end"), which typically is unmodified from the ribose -OH substituent. (wikipedia.org)
  • strand
  • The 3′-end of a strand is so named due to it terminating at the hydroxyl group of the third carbon in the sugar-ring, and is known as the tail end. (wikipedia.org)
  • This 'sense' or 'coding' strand, runs in the 5' to 3' direction where the numbers refer to the carbon atoms of the backbone's ribose sugar. (wikipedia.org)
  • amino acids
  • Differences between Class I (the most commonly represented and constitutively expressed isotype) and class III β-tubulin are limited to only 13aa within region 1-429aa, while all amino acids in region 430-450aa are divergent. (wikipedia.org)
  • mutation
  • This is the case of PC and PS gene mutations, as well as the FV Leiden mutation (which modifies the activated PC cleavage site at position 506 of FVa 3 ) and the prothrombin gene 20210G/A mutation associated with high levels of circulating prothrombin. (ahajournals.org)
  • wherein
  • 3. A pharmaceutical composition comprising an oligonucleotide consisting of SEQ ID NO:1439, wherein all of said cytosine bases in said oligonucleotide are 5-methylcytosine. (google.com)
  • 3. The method of claim 1 , wherein said CAR receptor polypeptide binding site is GGGTAGGGTTCACCGAAAGTTCACTCG (SEQ ID NO: 5). (google.com)
  • 3. The method of claim 1, wherein said steroid 5α-reductase is a rat steroid 5α-reductase. (google.co.uk)
  • highly
  • The S. cerevisiae IRs are highly clustered in intergenic regions, while their occurrence in coding sequences is consistent with random. (nih.gov)
  • The recombinant sequences show highly contrasted level of divergence in the 5'- and 3'- regions of the gene, leading to significantly different tree topologies depending on the gene segment (5'- or 3'-) used for tree reconstruction. (pubmedcentralcanada.ca)
  • As a Ras superfamily member, RASD1 shares several motifs characteristic of Ras proteins, including four highly conserved GTP binding pocket domains: the phosphate/magnesium binding regions GXXXXGK(S/T) (domain Σ1), DXXG (domain Σ2), and the guanine base binding loops NKXD (domain Σ3) and EXSAK (domain Σ4). (wikipedia.org)
  • species
  • In this paper we focus on the most common and commercially important laminarialean species, Saccharina japonica [ 4 , 5 , 15 ] and its morphological forms, inhabiting contrasting depths of the northwest Pacific region. (pubmedcentralcanada.ca)
  • single
  • By convention, single strands of DNA and RNA sequences are written in a 5′-to-3′ direction except as needed to illustrate the pattern of base pairing. (wikipedia.org)
  • ribosome
  • If the transcript encodes one or (rarely) more proteins, translation of each protein by the ribosome will proceed in a 5′ to 3′ direction, and will extend the protein from its N terminus toward its C terminus. (wikipedia.org)
  • vivo
  • Nucleic acids can only be synthesized in vivo in the 5′-to-3′ direction, as the polymerases that assemble various types of new strands generally rely on the energy produced by breaking nucleoside triphosphate bonds to attach new nucleoside monophosphates to the 3′-hydroxyl (-OH) group, via a phosphodiester bond. (wikipedia.org)
  • family
  • C-C chemokine ligand 2 (CCL2), also known as monocyte chemoattractant protein-1 (MCP-1), is a member of the C-C beta chemokine family that is produced by macrophages, fibroblasts, and endothelial cells to stimulate chemotaxis of monocyte/macrophages and other inflammatory cells through its receptor, CCR2 ( 2, 3 ). (aacrjournals.org)
  • important
  • A number of the conventional and orphan members of the superfamily share identical or very similar amino acid sequences in an important region of the first zinc finger. (google.com)
  • entire
  • These 3 mutations were screened for in the entire study population of 327 patients and 398 controls. (ahajournals.org)