There was an error running the query [insert into queries_english (query) values ('3' flanking region') on duplicate key update repetitions=repetitions+1, last=now() - You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near 'flanking region') on duplicate key update repetitions=repetitions+1, last=now()' at line 1]3' Flanking Region. Medical search. FAQ


There was an error running the query [select categoryid from categories where title like '3' Flanking Region' limit 1 - You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near 'Flanking Region' limit 1' at line 1]
  • sequence
  • Genetic characterization of the cry1Ab coding region allowed us to identify and quantify several sequence variants. (springer.com)
  • Hernandez M, Pla M, Esteve T, Prat S, Puigdomenech P, Ferrando A (2003) A specific real-time quantitative PCR detection system for event MON810 in maize YieldGard based on the 3′-transgene integration sequence. (springer.com)
  • Both genetic analyses and X-ray crystallography indicate that this region, termed the P box, makes sequence specific contacts with the DNA. (google.com)
  • For example, in a typical gene a start codon (5′-ATG-3′) is a DNA sequence within the sense strand. (wikipedia.org)
  • The 5′-untranslated region is the portion of the DNA starting from the cap site and extending to the base just before the AUG translation initiation codon of the main coding sequence. (wikipedia.org)
  • This region may have sequences, such as the ribosome binding site and Kozak sequence, which determine the translation efficiency of the mRNA, or which may affect the stability of the mRNA. (wikipedia.org)
  • strand
  • The 3′-end of a strand is so named due to it terminating at the hydroxyl group of the third carbon in the sugar-ring, and is known as the tail end. (wikipedia.org)
  • amino acids
  • Differences between Class I (the most commonly represented and constitutively expressed isotype) and class III β-tubulin are limited to only 13aa within region 1-429aa, while all amino acids in region 430-450aa are divergent. (wikipedia.org)
  • genomes
  • We scanned soybean and Arabidopsis seed genomes for hypomethylated regions, or DNA methylation valleys (DMVs), present in mammalian cells. (pnas.org)
  • methylation
  • Epigenetic analysis revealed a low degree of methylation, making it difficult to associate the coding region variants with methylation status. (springer.com)
  • These hypomethylated regions are similar to the DNA methylation valleys (DMVs), or canyons, found in mammalian cells. (pnas.org)
  • species
  • In this paper we focus on the most common and commercially important laminarialean species, Saccharina japonica [ 4 , 5 , 15 ] and its morphological forms, inhabiting contrasting depths of the northwest Pacific region. (pubmedcentralcanada.ca)
  • mutation
  • In conclusion, the variation in the coding region is either due to the increased age of the seeds from the tested maize varieties, which is known to increase the mutation rate, or due to the presence of a second (non-functional) cry1Ab fragment in the genome of the MON810 maize variety. (springer.com)
  • This is the case of PC and PS gene mutations, as well as the FV Leiden mutation (which modifies the activated PC cleavage site at position 506 of FVa 3 ) and the prothrombin gene 20210G/A mutation associated with high levels of circulating prothrombin. (ahajournals.org)
  • chromosome
  • We sequenced 2321 bp of the Y-chromosome in Bryonia dioica that flank a male-linked marker, BdY1 , reported previously. (biomedcentral.com)
  • Although the solo-LTR could have arisen before recombination was suppressed, creating the male-linked marker BdY1 , our previous study on B. dioica suggested that BdY1 may not lie in the recombination-suppressed region of the Y-chromosome in all populations. (biomedcentral.com)
  • highly
  • As a Ras superfamily member, RASD1 shares several motifs characteristic of Ras proteins, including four highly conserved GTP binding pocket domains: the phosphate/magnesium binding regions GXXXXGK(S/T) (domain Σ1), DXXG (domain Σ2), and the guanine base binding loops NKXD (domain Σ3) and EXSAK (domain Σ4). (wikipedia.org)
  • The S. cerevisiae IRs are highly clustered in intergenic regions, while their occurrence in coding sequences is consistent with random. (nih.gov)
  • The recombinant sequences show highly contrasted level of divergence in the 5'- and 3'- regions of the gene, leading to significantly different tree topologies depending on the gene segment (5'- or 3'-) used for tree reconstruction. (pubmedcentralcanada.ca)
  • pathway
  • These findings show that IRF6 and AP-2 alpha are in the same developmental pathway and identify a variant in a regulatory region that contributes substantially to a common complex disorder. (wikipedia.org)
  • vivo
  • Nucleic acids can only be synthesized in vivo in the 5′-to-3′ direction, as the polymerases that assemble various types of new strands generally rely on the energy produced by breaking nucleoside triphosphate bonds to attach new nucleoside monophosphates to the 3′-hydroxyl (-OH) group, via a phosphodiester bond. (wikipedia.org)
  • site
  • 3. The method of claim 1 , wherein said CAR receptor polypeptide binding site is GGGTAGGGTTCACCGAAAGTTCACTCG (SEQ ID NO: 5). (google.com)
  • single
  • By convention, single strands of DNA and RNA sequences are written in a 5′-to-3′ direction except as needed to illustrate the pattern of base pairing. (wikipedia.org)
  • variation
  • 3] The Dutch given name Reinder is a variation on Reinier (from Saint Rainier) or sometimes Reinhard. (wikipedia.org)
  • position
  • Specifically, position 71 of the analyzed region varied in 15 of 600 samples tested and thus appears to be a mutational hotspot. (springer.com)
  • similar
  • A number of the conventional and orphan members of the superfamily share identical or very similar amino acid sequences in an important region of the first zinc finger. (google.com)