Loading...
*  Homologous chromosome
Humans have a total of 46 chromosomes, but there are only 22 pairs of homologous autosomal chromosomes. The additional 23rd ... pair is the sex chromosomes, X and Y. If this pair is made up of an X and Y chromosome, then the pair of chromosomes is not ... So humans have two homologous chromosome sets in each cell, meaning humans are diploid organisms. Homologous chromosomes are ... Therefore, when two chromosomes of the exact structure exist, they are able to pair together to form homologous chromosomes. ...
*  Chromosome 5 (human)
A ring chromosome occurs when both ends of a broken chromosome are reunited. G-banding ideograms of human chromosome 5 "Human ... See also: Category:Genes on human chromosome 5. The following is a partial list of genes on human chromosome 5. For complete ... One example would be acute myeloid leukemia (AML). The following are some of the gene count estimates of human chromosome 5. ... Chromosome 5q deletion syndrome is caused by the deletion of the q arm (long arm) of chromosome 5. This deletion has been ...
*  TMEM33
This 1069 base pair promoter sequence spans 41936535-41937603 on human chromosome 4. The promoter sequence overlaps with the 5 ... In humans, this gene's DNA location is the short arm of chromosome 4, loci position: 4p13. The genomic range is 41937502- ... Transcripts a, b, and c have a 744 base pair long coding range and a particularly long 3' UTR that is 6000 base pairs long. In ... There is an experimentally determined acetylation point is at alanine, amino acid residue 2 in humans. Human TMEM33 has ...
*  Jane Grimwood
"320 million base pairs . . . comprising more than 10% of the human genome." They discovered that chromosome 19 has the highest ... "GNN - Two More Human Chromosomes Are Complete". www.genomenewsnetwork.org. Retrieved 2017-03-02. Grimwood, Jane; Gordon, Laurie ... gene density of any human chromosome, and were able to link certain genes on the chromosome to genetic diseases including ... Grimwood was an important part of the Human Genome Project effort, working from the Stanford Human Genome Center. Grimwood ...
*  Arachidonate 5-lipoxygenase
The ALOX5 gene, which occupies 71.9 kilobase pairs (kb) on chromosome 10 (all other human lipoxygenases are clustered together ... Aberrant expression of LOX5 is seen in various types of human cancer tumors in vivo as well as in various types of human cancer ... Studies with cultured human cells have found that there are a large number of ALOX5 mRNA splice variants due to Alternative ... Human ALOX5 is a soluble, monomeric protein consisting of 673 amino acids with a molecular weight of ~78 kDa. Structurally, ...
*  Human chorionic gonadotropin
... encoded by six highly homologous genes that are arranged in tandem and inverted pairs on chromosome 19q13.3 - CGB (1, 2, 3, 5, ... Talwar GP (1997). "Fertility regulating and immunotherapeutic vaccines reaching human trials stage" (PDF). Human Reproduction ... Human chorionic gonadotropin (hCG) is a hormone produced by the placenta after implantation. The presence of hCG is detected in ... Human chorionic gonadotropin interacts with the LHCG receptor of the ovary and promotes the maintenance of the corpus luteum ...
*  Chromosome 7 (human)
Chromosome 7 is one of the 23 pairs of chromosomes in humans. People normally have two copies of this chromosome. Chromosome 7 ... A ring chromosome occurs when both ends of a broken chromosome are reunited. G-banding ideograms of human chromosome 7 In the ... See also: Category:Genes on human chromosome 7. The following is a partial list of genes on human chromosome 7. For complete ... "Chromosome 7". Genetics Home Reference. Retrieved 2017-05-06. "Chromosome 7". Human Genome Project Information Archive 1990- ...
*  LSMEM1
Aliases for LSMEM1 include C7orf53, chromosome 7 open reading frame 53, and FLJ39575. The human mRNA is 1686 base pairs long ... In humans, LSMEM1 is located on chromosome 7q31.1. LSMEM1 neighbors the gene IFRD1 in humans. ... It also shows expression in both the fetal and adult stages of life in humans. LSMEM1 is predicted to have a 615 base pair ... In humans, LSMEM1 is very highly expressed in skeletal muscle. In humans, LSMEM1 also shows high expression in nerve tissue, ...
*  1q21.1 deletion syndrome
A human cell has one pair of identical chromosomes on chromosome 1. With the 1q21.1 deletion syndrome, one chromosome of the ... Meiosis is the process of dividing cells in humans. In meiosis, the chromosome pairs split and a representative of each pair ... pair is not complete, because a part of the sequence of the chromosome is missing. One chromosome has the normal length and the ... In 1q21.1, the '1' stands for chromosome 1, the 'q' stands for the long arm of the chromosome and '21.1' stands for the part of ...
*  TMCO6
The human TMCO6 is found on chromosome 5 (position 5q31.3). The entire gene spans 5568 base pairs on the positive strand of ... 1,925 base pair mRNA sequence. Variant 2 is the second longest at 1,907 base pairs in length and also consists of 12 exons. ... Variant 3 has a total length of 1,614 base pairs and differs from variant 1 because it lacks two consecutive exons. It has an ... Transmembrane and coiled-coil domain 6, TMCO6, is a protein that in humans is encoded by the TMCO6 gene with aliases of PRO1580 ...
*  ZC3H12B
... is a protein encoded by gene ZC3H12B located on chromosome Xq12 in humans. The ZC3H12B gene is composed of 19,709 base pairs ( ... It is located on the X chromosome at q12 on the plus strand. ZC3H12B contains a ribonuclease domain, as well as a CCCH-type ... This is interesting because approximately 85% of human proteins are acetylated at the N terminus for synthesis, stabilization ... "Human PubMed Reference:". "Mouse PubMed Reference:". Liang J, Wang J, Azfer A, Song W, Tromp G, Kolattukudy PE, Fu M (March ...
*  Ribose-5-phosphate isomerase
RpiA in human beings is encoded on the second chromosome on the short arm (p arm) at position 11.2. Its encoding sequence is ... nearly 60,000 base pairs long. The only known naturally occurring genetic mutation results in ribose-5-phosphate isomerase ... Human ribose-5-phosphate isomerase A (RpiA) plays a role in human hepatocellular carcinoma (HCC). A significant increase in ... A pseudogene is found on chromosome 18. In the non-oxidative part of the pentose phosphate pathway, RPIA converts Ru5P to R5P ...
*  FKBP6
... is essential for homologous chromosome pairing in meiosis during spermatogenesis. Targeted inactivation of FKBP6 in mice ... FK506 binding protein 6, also known as FKBP6, is a human gene. The encoded protein shows structural homology to FKBP ... 2003). "Essential role of Fkbp6 in male fertility and homologous chromosome pairing in meiosis". Science. 300 (5623): 1291-5. ... Mutations in this gene have been associated with male infertility in humans. FKBP6 is deleted in Williams syndrome, however ...
*  C10orf76
"Human PubMed Reference:". "Mouse PubMed Reference:". "Entrez Gene: Chromosome 10 open reading frame 76 (Human)". Retrieved 28 ... In humans, the c10orf76 gene, also known by the alias FLJ13114, spans 210,577 base pairs on the reverse strand of the long arm ... C10orf76 or chromosome 10 open reading frame 76, also known as UPF0668, is a protein that in humans is encoded by the c10orf76 ... the largest of which being 4101 base pairs in length. The human c10orf76 locus is flanked on the left and right sides by HPS6 ...
*  IRX1
The human gene product is a 1858 base pair mRNA with 4 predicted exons in humans. Promoter analysis was performed using El ... IRX1, IRX2, and IRX4 are found on human chromosome 5, and their orientation corresponds to that of IRX3, IRX5, and IRX6 found ... The predicted promoter region spans 1040 base pairs from position 3595468 through 3595468 on the forward strand of chromosome 5 ... "Cloning and chromosome mapping of human and chicken Iroquois (IRX) genes". Cytogenet. Cell Genet. 92 (3-4): 320-5. doi:10.1159/ ...
*  MSH3
In humans, the encoding gene for MSH3 is found on chromosome 5 at location 5q11-q12 upstream of the dihydrofolate reductase ( ... MSH3 is encoded by 222,341 base pairs and creates a protein consisting of 1137 amino acids. MSH3 is typically expressed at low ... Identification of the human CHL12/RFCs2-5 complex as a novel PCNA-binding protein". J. Biol. Chem. 277 (43): 40362-7. doi: ... 1984). "The functional human dihydrofolate reductase gene". J. Biol. Chem. 259 (6): 3933-43. PMID 6323448. Shinya E, Shimada T ...
*  SCN1A (gene)
The SCN1A gene is located on chromosome 2 of humans, and is made up of 26 exons spanning a total length of 6030 nucleotide base ... The promoter has been identified 2.5 kilobase pairs (kb) upstream of the transcription start site, and the 5'- untranslated ... American Journal of Human Genetics, 68(6), 1327-1332. Yu, F. H., Mantegazza, M., Westenbroek, R. E., Robbins, C. A., Kalume, F ... From a gene symbol: This is a redirect from a Human Genome Organisation (HUGO) symbol for a gene to an article about the gene. ...
*  MTRR (gene)
Mitochondrial EC 1.16.1.8 CblE The gene was mapped to human chromosome 5. Gene specific primer pairs resulted in PCR ... MTRR):r.1462_1557del96 - Associated with splicing of exon 11 due to a 7 base pair deletion. A large deletion of this mutant ... Methionine synthase reductase also known as MSR is an enzyme that in humans is encoded by the MTRR gene. Methionine is an ... Found in 15 primates and over 16 tissues in humans, MTRR is 34 kb long. The gene comprises 15 exons and includes numerous ...
*  Haplogroup I-M170
2004). "Mitochondrial DNA and Y-Chromosome Variation in the Caucasus" (PDF). Annals of Human Genetics. 68 (Pt 3): 205-221. doi: ... base pair): 275 Total size (base pairs): 220 Forward 5′→ 3′: aaggggatatgacgactgatt Reverse 5′→ 3′: cagctcctcttttcaactctca ... "Y-chromosome diversity in Sweden - A long-time perspective". European Journal of Human Genetics. 14 (8): 963-970. doi:10.1038/ ... "Excavating Y-chromosome haplotype strata in Anatolia". Human Genetics. 114 (2): 127-148. doi:10.1007/s00439-003-1031-4. ISSN ...
*  Vertebrate and Genome Annotation Project
Pairwise comparisons between three pairs of full length mouse and human chromosomes: human chromosome 1 and mouse chromosome 4 ... human chromosome 17 and mouse chromosome 11 human chromosome X and mouse chromosome X "Vega Genome Browser". Wellcome Sanger ... gorilla and human (nine haplotypes): pig chromosome 6 (53.6Mbp to 54.0Mbp) gorilla chromosome 19-LRC human chromosome 19q13.4 ( ... mouse and eight human haplotypes: dog chromosome 12-MHC gorilla chromosome 6-MHC chimpanzee chromosome 6-MHC wallaby chromosome ...
*  TMEM143
Located on the negative strand of human DNA, TMEM143 spans 31,882 base pairs on human chromosome 19 (19q13.33), neighbored by ... human)]". NCBI. "Tmem143 (human)". NCBI. "TMEM143 Gene". GeneCards. "TMEM143 - Normal human tissue expression profiling". NCBI ... There are no known paralogs for the human TMEM143 sequence. Possible human expression of TMEM143 protein occurs in Jurkat cells ... Chromosome 14 open reading frame 28 (C14orf28), Chromosome 14 open reading frame 28 (TRIN71), and Cytoplasmic polyadenylation ...
*  FAM83H
The FAM83H gene spans 14097 base pairs and is orientated on the-strand. The coding region is made up of 5,604 base pairs and 5 ... "Genecards". The Gene Human Database. "Aceview". NCBI. "Genecards". The Gene Human Database. "BLAST". NCBI. Hedges, SB. " ... FAM83H is located on the long arm of chromosome 8 (8q24.3), starting at 143723933 and ending at 143738030. ... FAM83H is ubiquitously expressed throughout the human body at relatively low levels. In humans, there is only one known major ...
*  CCDC94
The gene product is a 1,441 base pair mRNA with 8 predicted exons in the human gene. As predicted by Ensemble, there exists one ... The predicted promoter region spans 714 basepairs from 4,246,532 to 4,247,245 on the plus strand of chromosome 19. CCDC94 is ... The human form as 323 amino acid residues, with an isoelectric point of 5.618 and a molecular mass of 37,086 Daltons. There are ... Coiled-coil domain containing 94 (CCDC94), is a protein that in humans is encoded by the CCDC94 gene. The CCDC94 protein ...
*  CGB2 (gene)
1984). "The beta chorionic gonadotropin-beta luteinizing gene cluster maps to human chromosome 19". Hum. Genet. 67 (2): 174-177 ... is encoded by six highly homologous and structurally similar genes that are arranged in tandem and inverted pairs on chromosome ... 1997). "Expression of the human chorionic gonadotropin-beta gene cluster in human pituitaries and alternate use of exon 1". J. ... Choriogonadotropin subunit beta variant 2 is a protein that in humans is encoded by the CGB2 gene. The beta subunit of ...
*  CD300C
... gene structure predicts for an independently expressed member of an ITIM/ITAM pair of molecules localized to human chromosome ... "The gene encoding the immunoregulatory signaling molecule CMRF-35A localized to human chromosome 17 in close proximity to other ... CMRF35-like molecule 6 (CLM-6) also known as CD300 antigen-like family member C (CD300c) is a protein that in humans is encoded ... "Entrez Gene: CD300C CD300c molecule". Human CD300C genome location and CD300C gene details page in the UCSC Genome Browser. ...
*  TENM3
Odz1 to Mouse Chromosome 11; and ODZ3 to Human Chromosome Xq25". Genomics. 58 (1): 102-3. doi:10.1006/geno.1999.5798. PMID ... Levine A, Bashan-Ahrend A, Budai-Hadrian O, Gartenberg D, Menasherow S, Wides R (May 1994). "odd Oz: A novel Drosophila pair ... Odz1to Mouse Chromosome 11; and ODZ3 to Human Chromosome Xq25". Genomics. 58 (1): 102-103. doi:10.1006/geno.1999.5798. PMID ... Ben-Zur, T.; Feige, E.; Motro, B.; Wides, R. (2000). "The Mammalian Odz Gene Family: Homologs of a Drosophila Pair-Rule Gene ...
*  FAM71F2
The gene paralog FAM71F1 and the gene LINC01000 directly neighbor FAM71F2 on chromosome 7. The gene spans 30,627 base pairs and ... FAM71F2 gene is located on chromosome 7 in humans (7q32.1), starting at 128,671,636 and ending at 128,702,262 on the positive ... The time of divergence between eight orthologs from the human FAM71F2 is shown in Figure 5. It is not found in birds or in ... Isoform a is the longest of the mRNA transcripts and spans 5,775 base pairs that translates into a 309 amino acids sequence. It ...