TATA-box binding protein associated factor 5 like), Authors: Dessen P. Published in: Atlas Genet Cytogenet Oncol Haematol. ...
TATA box-binding protein-associated factor RNA polymerase I subunit B - Also known as TAF1B_RAT, Taf1b. Component of RNA ... Taf1b (TATA box-binding protein-associated factor RNA polymerase I subunit B) ...
Interaction Analysis Between Polyglutamine-expanded TATA Box Binding Protein (TBP) and High Mobility Group Box 1 (HMGB1). Bio ... Interaction Analysis Between Polyglutamine-expanded TATA Box Binding Protein (TBP) and High Mobility Group Box 1 (HMGB1). In: ... Interaction Analysis Between Polyglutamine-expanded TATA Box Binding Protein (TBP) and High Mobility Group Box 1 (HMGB1). / 楊淑婷 ... T1 - Interaction Analysis Between Polyglutamine-expanded TATA Box Binding Protein (TBP) and High Mobility Group Box 1 (HMGB1) ...
TATA box-binding protein, nuclear factor erythroid-derived 2, nuclear factor-kappa B, and nuclear factor 1. Both USF1 and ... and their binding as heterodimers to E-boxes surrounding the hCYP19 promoter. ". ...
Transcription is initiated at the TATA box in TATA-containing genes. The TATA box is the binding site of the TATA-binding ... binds to the TATA box at its TATA-binding protein (TBP) subunit.[3] TBP binds to the minor groove[15] of the TATA box via a ... The TATA box is considered a non-coding DNA sequence (also known as a cis-regulatory element). It was termed the "TATA box" as ... Figure 1. TATA box structural elements. The TATA box consensus sequence is TATAWAW, where W is either A or T. ...
Crystal structure of TFIID TATA-box binding protein.. Nikolov DB1, Hu SH, Lin J, Gasch A, Hoffmann A, Horikoshi M, Chua NH, ... The structure of a central component of the eukaryotic transcriptional apparatus, a TATA-box binding protein (TBP or TFIID tau ... Riding high on the TATA box. [Nature. 1992]. *Deviant TATA-box binding protein. [Nature. 1992] ...
TATA-box binding protein, conserved site (IPR030491). Short name: TBP_CS Description. Transcription factor TFIID (or TATA- ... This region is necessary and sufficient for TATA box binding. The most significant structural feature of this domain is the ... Drosophila TRF (TBP-related factor) [PMID: 8429912] is a sequence-specific transcription factor that also binds to the TATA box ... TFIID binds specifically to the TATA box promoter element which lies close to the position of transcription initiation. ...
TATA box binding protein associated factor (TAF) (IPR004823). Short name: TAF_TATA-bd ... The TATA box binding protein associated factor (TAF) is part of the transcription initiation factor TFIID multimeric protein ... TFIID is composed of TATA binding protein (TBP)and a number of TBP-associated factors (TAFS). TAF proteins adopt a histone-like ...
Crystal structure of a human TATA box-binding protein/TATA element complex. D B Nikolov, H Chen, E D Halay, A Hoffman, R G ... Crystal structure of a human TATA box-binding protein/TATA element complex ... Crystal structure of a human TATA box-binding protein/TATA element complex ... Crystal structure of a human TATA box-binding protein/TATA element complex ...
"TATA box binding protein (TBP)-associated factor, RNA polymerase II, D, 100kD", "TAF5 RNA polymerase II, TATA box binding ... White boxes represent UTRs (untranslated regions). Orange: protein coding regions. The black lines connecting boxes represent ... The blue boxes on this track indicate regions for which coordinates have been observed in PDB. Clicking on this track shows ...
"TATA Box" by people in Harvard Catalyst Profiles by year, and whether "TATA Box" was a major or minor topic of these ... "TATA Box" is a descriptor in the National Library of Medicines controlled vocabulary thesaurus, MeSH (Medical Subject Headings ... Below are the most recent publications written about "TATA Box" by people in Profiles. ... Below are MeSH descriptors whose meaning is more general than "TATA Box". ...
Binding of TFIID to the TATA box is the initial transcriptional step of the pre-initiation complex (PIC), playing a role in the ... Binding of TFIID to the TATA box is the initial transcriptional step of the pre-initiation complex (PIC), playing a role in the ... "Cloning and properties of the Caenorhabditis elegans TATA-box-binding protein.". Lichtsteiner S., Tjian R.. Proc. Natl. Acad. ... "Cloning and properties of the Caenorhabditis elegans TATA-box-binding protein.". Lichtsteiner S., Tjian R.. Proc. Natl. Acad. ...
... γ TATA box, 5′GGATGAAGAATAAAAGGAAGCACCCT3′; γ mut TATA box, 5′GGATGAAGAGCTAGCGGAAGCACCCT3′. (B) The TATA box mutation abolishes ... The mutated TATA box fails to bind TBP (lane 8) and to compete away the TBP binding on the wild-type TATA box (lane 4 and 5). ... or the TATA box mutated construct [μLCR(−382)Aγ(mut TATA)] and were subjected to real-time PCR quantitative ChIP assay with ... Developmental specificity of recruitment of TBP to the TATA box of the human γ-globin gene. Zhi-Jun Duan, Xiangdong Fang, Alex ...
The TATA Box Binding Protein (TBP) is a 20 kD protein that is essential and universally conserved in eucarya and archaea. ... Analysis of a hybrid TATA box binding protein originating from mesophilic and thermophilic donor organisms. Annette Kopitz,1,2 ... To receive news and publication updates for Journal of Spectroscopy, enter your email address in the box below. ...
TAF12 TATA-box binding protein associated factor 12 [Homo sapiens] TAF12 TATA-box binding protein associated factor 12 [Homo ... TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa. TAFII-20/TAFII-15. TAFII20/TAFII15. TATA box ... TATA-box binding protein associated factor 12provided by HGNC. Primary source. HGNC:HGNC:11545 See related. Ensembl: ... TAF12 TATA-box binding protein associated factor 12 [ Homo sapiens (human) ] Gene ID: 6883, updated on 6-Jan-2019 ...
TATA-BINDING PROTEIN/TRANSCRIPTION FACTOR (II)B/TATA-BOX COMPLEX FROM PYROCOCCUS WOESEI ... TATA-box-binding protein/transcription factor (II)B core/TATA-box.. Kosa, P.F., Ghosh, G., DeDecker, B.S., Sigler, P.B.. (1997 ... TATA-BINDING PROTEIN/TRANSCRIPTION FACTOR (II)B/TATA-BOX COMPLEX FROM PYROCOCCUS WOESEI. *DOI: 10.2210/pdb1AIS/pdb ... Here we report the 2.1-A crystal structure of the archaeal transcription factor complex formed by the TATA-box-binding protein ...
TATA box-binding protein-like protein 2Add BLAST. 344. Proteomic databases. PaxDb, a database of protein abundance averages ... sp,A6H909,TBPL2_RAT TATA box-binding protein-like protein 2 OS=Rattus norvegicus OX=10116 GN=Tbpl2 PE=2 SV=1 ...
Molecular model showing a yeast TATA box-binding protein (TBP) complexed with a strand of DNA (deoxyribonucleic acid) and ... TATA box-binding protein complex. Molecular model showing a yeast TATA box-binding protein (TBP) complexed with a strand of DNA ... TBP is a general transcription factor that binds specifically to the TATA box DNA sequence during DNA transcription. TATA boxes ...
What is TATA box? Meaning of TATA box as a finance term. What does TATA box mean in finance? ... Definition of TATA box in the Financial Dictionary - by Free online English dictionary and encyclopedia. ... TATA box financial definition of TATA box https://financial-dictionary.thefreedictionary.com/TATA+box ... Related to TATA box: CAAT box Box. The actual physical location at a brokerage house or bank where securities or other ...
TAF5L, TATA-box binding protein associated factor 5 like. Orthology source: HomoloGene, HGNC ...
The TBP gene encodes TATA Box-Binding Protein, the DNA-binding subunit of the RNA polymerase II transcription factor D (TFIID ... As the name suggests, the TBP subunit attaches to the DNA promoter at its TATA box, to initiate transcription. Binding of the ...
TATA-box-binding protein/transcription factor (II)B core/TATA-box. ... TATA-box binding protein-like TATA-box binding protein (TBP), C-terminal domain TATA-box binding protein (TBP), C-terminal ... TATA-box binding protein-like TATA-box binding protein (TBP), C-terminal domain TATA-box binding protein (TBP), C-terminal ... TATA-BINDING PROTEIN/TRANSCRIPTION FACTOR (II)B/TATA-BOX COMPLEX FROM PYROCOCCUS WOESEI. ...
The TATA-box binding protein associated factor 1 page is available on the IUPHAR/BPS Guide to PHARMACOLOGY site.. You will ...
TATA-box binding protein associated factor, RNA polymerase I subunit C), Authors: Dessen P. Published in: Atlas Genet Cytogenet ... TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kD. ... TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa. ... TAF1C (TATA-box binding protein associated factor, RNA polymerase I subunit C). ...
Binds specifically to the TATA box promoter element which lies close to the position of transcription initiation (By similarity ... Binds specifically to the TATA box promoter element which lies close to the position of transcription initiation (By similarity ... sp,O27664,TBP_METTH TATA-box-binding protein OS=Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM ...