Ross Hardison - Wikipedia
Hardison, R. C. (2000). "Conserved noncoding sequences are reliable guides to regulatory elements". Trends in Genetics. 16 (9 ... "An integrative view of the regulatory and transcriptional landscapes in mouse hematopoiesis". Genome Research. 30 (3): 472-484 ... Further, they have utilized systematic integration of epigenomic data to predict a broader set of regulatory elements, which ... "Finding cis-regulatory elements using comparative genomics: some lessons from ENCODE data". Genome Research. 17 (6): 775-786. ...
CpG domains downstream of TSSs promote high levels of gene expression
CpG dinucleotides are known to play a crucial role in regulatory domains, affecting gene expression in their natural context. ... Molecular Sequence Data * Protein Biosynthesis * Protein Processing, Post-Translational * Regulatory Elements, Transcriptional ... CpG dinucleotides are known to play a crucial role in regulatory domains, affecting gene expression in their natural context. ... nuclear export and translation are not affected by the sequence modification. Differences in chromatin accessibility in vivo ...
A View on the Role of Epigenetics in the Biology of Malaria Parasites | PLOS Pathogens
... control expression of the genes by acting on regulatory elements in the promoter sequences (colored DNA). Some histone PTMs are ... B) The transcriptional status of clonally variant promoters often does not coincide with the state of the endogeneous promoter ... Further investigations are needed to determine the relative contribution of DNA sequence and epigenetic elements in specifying ... These cis-acting DNA elements are bound by the ApiAP2 factor PfSIP2, and this interaction plays a likely role in var gene ...
Chromatin interaction maps reveal genetic regulation for quantitative traits in maize | Nature Communications
Spatial organization of regulatory elements and its impact on gene expression in plants remain unclear. Here, the authors ... They serve as bridges between transcriptional regulation and phenotypic variation in mammals. However, spatial organization of ... high-resolution chromatin interaction maps for maize via long-read chromatin interaction analysis by paired-end tag sequencing ... Here, we characterize epigenetic features of active promoter proximal regions and candidate distal regulatory elements to ...
The Nobel Prize in Physiology or Medicine 2019 - Advanced information - NobelPrize.org
Semenza decided to trace the transcriptional regulatory elements of the EPO gene in transgenic mice, using clones of different ... enhancer element of the EPO gene (Wang et al., 1995; Wang and Semenza, 1995). Amino acid sequencing and subsequent cDNA cloning ... Beck, I., Ramirez, S., Weinmann, R., and Caro, J. (1991). Enhancer element at the 3-flanking region controls transcriptional ... the next step was to determine the actual DNA sequence in the EPO gene regulatory region that was responsible for the oxygen ...
Frontiers | Single-Nucleotide RNA Maps for the Two Major Nosocomial Pathogens Enterococcus faecalis and Enterococcus faecium
... which also limits our understanding of post-transcriptional control small regulatory RNA (sRNA) functions in these bacteria. ... which also limits our understanding post-transcriptional control small regulatory RNA (sRNA) functions in these bacteria. Here ... Our data should provide a useful resource for the continued exploration of transcriptional and post-transcriptional regulatory ... 6S RNA or RnpB which is the ribozyme element of RNase P, in our samples sent for sequencing and in the sequencing results ( ...
Controlled vocabulary for /regulatory class - International Nucleotide Sequence Database Collaboration
enhancer_blocking_element: a transcriptional cis regulatory region that when located between an enhancer and a genes promoter ... response_element: a regulatory element that acts in response to a stimulus, usually via transcription factor binding. ... other: /regulatory_class not included in any other term.. regulatory classes not yet in the INSDC /regulatory_class controlled ... regulatory_class="promoter". /regulatory_class="enhancer". /regulatory_class="ribosome_binding_site". Comment: TYPE is a term ...
Even supposing ID is not science, it does not automatically mean it is religion, philosophy, or metaphysics | Uncommon Descent
... motifs for new transcriptional regulatory elements, polyadenylation signals, and protein-coding sequences." (p. 1246) And ... The observation was that many sequences seem to mutate freely with no phenotypic effects. Not that there were sequences for ... The observation was that many sequences seem to mutate freely with no phenotypic effects. Not that there were sequences for ... I had the same conversation with ReMine and his eyes lit up, and I sent him links to deeply conserved sequences. I expect to ...
Global analysis of transcriptional regulators in Staphylococcus aureus | BMC Genomics | Full Text
... where transcriptional factors (TFs) are the primary elements. In this work, using diverse sequence analysis, we evaluated the ... A total of 135 TFs and sigma factors were identified and classified into 36 regulatory families. From these around 43% have ... A comparison of the TF repertoire of S. aureus against 1209 sequenced bacterial genomes was carried out allowing us to identify ... S. aureus has a vast array of virulence determinants whose expression is modulated by an intricate regulatory network, ...
GEO Accession viewer
... and their ability to achieve this is required to establish new regulatory elements and transcriptional networks during ... Expression profiling by high throughput sequencing. Summary. Pioneer transcription factors are able to recognise and bind their ... transcription factor co-binding and regulatory potential of thousands of distal regulatory elements in mouse embryonic stem ... The pioneer factor OCT4 requires the chromatin remodeller BRG1 to support gene regulatory element function in mouse embryonic ...
Rumors of pseudogenes' demise greatly exaggerated, new study says
... promoter and other transcriptional regulatory elements. In most cases, this duplicated gene will undergo crippling, ... Hence, the pseudogene product will lack intron and promoter sequences, and will bear characteristic repeat sequences at the ... DNA elements, as well as other unique DNA sequences, form the so-called "junk DNA". (For a more general discussion of "junk DNA ... retrogenes lack regulatory sequences, and therefore their only chance of becoming expressed is when they integrate in proximity ...
Investigating the Role of TM6SF2 in Lipid Metabolism | Academic Commons
... mediated transcriptional program regulating cholesterol synthesis is significantly increased in TM6SF2 KO iPSCs. However, ... RNA-sequencing and qPCR validation reveal that the Sterol Regulatory Element Binding Protein 2 (SREBP2)- ... RNA-sequencing and qPCR validation reveal that the Sterol Regulatory Element Binding Protein 2 (SREBP2)-mediated ... transcriptional program regulating cholesterol synthesis is significantly increased in TM6SF2 KO iPSCs. However, lipidomics ...
US Patent Application for Adeno-Associated Virus Virions with Variant Capsid and Methods of Use Thereof Patent Application ...
Control elements known in the art include, for example, transcriptional regulatory sequences such as promoters and enhancers. A ... A "control element" or "control sequence" is a nucleotide sequence involved in an interaction of molecules that contributes to ... Control Elements The heterologous nucleotide sequence can be operably linked to control elements that direct the transcription ... A microRNA sequence can be an RNA molecule composed of any one or more of these sequences. MicroRNA (or "miRNA") sequences have ...
Isabel C. Lopez-Mejia, Assistant Professor - CIG UNIL
Alternatively, spliced mRNAs typically encode distinct proteins or harbor modified cis-regulatory elements, thereby altering ... Alternative splicing involves the differential joining of exonic sequences within a nascent pre-mRNA transcript, to form ... Little information is available about how post-transcriptional RNA processing regulates metabolic adaptation in adipose tissue ... We use modern molecular biology, cellular biology and RNA sequencing approaches, in addition of metabolically phenotyping our ...
Long non-coding antisense RNA controls Uchl1 translation through an embedded SINEB2 repeat | Nature
Antisense Uchl1 activity depends on the presence of a 5′ overlapping sequence and an embedded inverted SINEB2 element. These ... Antisense Uchl1 increases UCHL1 protein synthesis at a post-transcriptional level, hereby identifying a new functional class of ... features are shared by other natural antisense transcripts and can confer regulatory activity to an artificial antisense to ... and repetitive sequences, such as SINEs (short interspersed nuclear elements). A large percentage of ncRNAs are nuclear- ...
Jian Ma :: Carnegie Mellon School of Computer Science
Uncover gene regulatory elements and their functions. (2) Study 3D epigenome evolution in mammals. (3) Discover crucial ... We have made contributions to the development of methods for genome sequence comparisons. Our recent work has contributed new ... disruptions in transcriptional regulation and the epigenome in cancer, informed by insights from genome evolution. [See ... Our research focuses on utilizing whole genome sequences of various species to study genome and epigenome evolution, gene ...
Integrated analysis of high‑throughput sequencing reveals the regulatory potential of hsa circ 0035431 in HNSCC
... protein translation and regulate mRNA stability at the post-transcriptional level by binding to miRNA recognition elements (30 ... Integrated analysis of high‑throughput sequencing reveals the regulatory potential of hsa_circ_0035431 in HNSCC. *Authors: * ... Whole-genome transcriptional sequencing identified 6,750 circRNAs, 265 miRNAs and 19,816 mRNAs. In total, 169 circRNAs, 214 ... NEB E7300L). The sequencing instrument platform was an Illumina Novaseq 6000 (Illumina, Inc.) and the sequencing strategy was ...
Analysis of hundreds of cis-regulatory landscapes at high resolution in a single, high-throughput experiment.
Molecular Sequence Data, Polymorphism; Single Nucleotide; genetics, Regulatory Elements; Transcriptional; genetics, Sequence ... which most frequently lie in intergenic cis-acting regulatory elements.. Analysis of hundreds of cis-regulatory landscapes at ... and stage-specific manner by complex networks of intergenic and intragenic cis-regulatory elements whose numbers and ... and stage-specific manner by complex networks of intergenic and intragenic cis-regulatory elements whose numbers and ...
OPUS 4 | Search
Control of alternative splicing is brought about by cis-regulatory elements, such as RNA sequence and structure, which recruit ... While the transcriptional changes induced in hypoxic tumours are well characterised, it is still poorly understood how hypoxia ... We discovered numerous previously unknown cis-regulatory elements in both introns and exons, and found that the RBP ... Here, we have established a high-throughput screen to comprehensively identify and characterise cis-regulatory elements that ...
Ketogenic HMGCS2 Is a c-Myc Target Gene Expressed in Differentiated Cells of Human Colonic Epithelium and Down-Regulated in...
... three main regulatory sequences have been described in the rat HMGCS2 promoter: (a) an insulin-responsive sequence, located at ... Mutation of critical elements in the HMGCS2 proximal promoter diminished its transcriptional activity and therefore hinders the ... HMGCS2 regulation occurs mainly at the transcriptional level. The proximal promoter of the gene contains elements that could ... which abrogates Miz-1-mediated transcriptional activation of HMGCS2 expression. Therefore, transcriptional repression by Myc ...
WACS: improving ChIP-seq peak calling by optimally weighting controls | BMC Bioinformatics | Full Text
Chromatin immunoprecipitation followed by high throughput sequencing (ChIP-seq), initially introduced more than a decade ago, ... such as transcriptional regulatory elements. The main goal of a ChIP-seq experiment is the detection of protein-DNA binding ... It allows the genome-wide investigation of the structural and functional elements encoded in a genomic sequence, ... Higher sequencing depth is recommended since input DNA signals represent broader genomic chromatin regions than ChIP-seq [9, 10 ...
Neuron-to-neuron α-synuclein propagation in vivo is independent of neuronal injury | Acta Neuropathologica Communications |...
Gene expression was enhanced using a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) and a ... The following primer sequences were used: (i) total (rat plus human) α-synuclein: 5tggttttgtcaaaaaggaccag forward and ... of transgenes from adeno-associated virus vectors with the woodchuck hepatitis virus posttranscriptional regulatory element: ... To ascertain targeted transduction, amplification reactions evaluated the presence of WPRE, an enhancer element incorporated ...
2018 Annual Report of the Division of Intramural Research, NICHD | James A. Kennison, PhD
In addition to transcriptional regulation exerted through cis-regulatory elements by trans-acting factors, gene regulation can ... Cis-acting sequences for transcriptional regulation of the Sex combs reduced (Scr) homeotic gene. Assays in transgenes in ... The assays found tissue-specific enhancer elements as well as cis-regulatory elements that are required for the maintenance of ... We are currently attempting to identify the cis-regulatory DNA sequences in the Scr that are required for Polycomb-group ...
Transposable elements modulate human RNA abundance and splicing via specific RNA-protein interactions | Genome Biology | Full...
... have significantly influenced the evolution of transcriptional regulatory networks in the human genome. Post-transcriptional ... We detect widespread interactions between RNA binding proteins (RBPs) and many families of TE-derived sequence in the CLIP-Seq ... Our meta-analysis suggests a widespread role for TEs in shaping RNA-protein regulatory networks in the human genome. ... Further, alignment coverage peaks on specific positions of the TE consensus sequences, illuminating a diversity of TE-specific ...
JAX researchers Michael Stitzel and Ryan Tewhey are examining genetic susceptibility to type 2 diabetes
Cis-regulatory elements (CREs) are key components of the non-coding regulatory framework. Altered islet cell CRE activity has ... for their ability to alter transcriptional activation. A total of 1982 SNP-containing elements were found to activate ... JAX offers clinical whole genome sequencing test. The Advanced Precision Medicine Laboratory at JAX is offering a fully ... and the findings reveal the specific regulatory elements that respond to ER stress conditions. ...
Mononuclear Phagocytes | Musculoskeletal Key
These changes are regulated primarily at the epigenetic and transcriptional levels. The M1/M2… ... proteins that recognize specific DNA sequences or motifs; and the cis-regulatory elements, such as enhancers, that they bind. ... transgenic model was generated through overexpression of the human TNF gene lacking post-transcriptional regulatory elements, ... bulk RNA sequencing and single-cell RNA sequencing). It has now become clear that macrophages express a different ...
Diseases | Free Full-Text | A Systems Biology Approach on the Regulatory Footprint of Human Endogenous Retroviruses (HERVs)
I analyzed the presence of HERV sequences on consensus cis-regulatory elements (cCREs) from ENCODE data. On the one side, HERVs ... derived from HERVs is critical for epigenetic innovation that may have wired together genes into novel transcriptional networks ... In the current report, a systematic approach is implemented to catalogue regulatory elements within HERVs, as a roadmap to ... Collectively, these results support the concept that the expansion of regulatory sequences ...
Molecular Vision: ETS-1 and ETS-2 are upregulated in a transgenic mouse model of pigmented ocular neoplasm
... absence of important cis-acting regulatory elements favoring significant transcription of the large T antigen coding sequence ... However, several previous studies have shown that early oncogenic sequences of SV40 under transcriptional control of the ... These domains specifically recognize the 5′-GGAA/T-3′ sequence [16]. More than 27 ETS proteins have been identified in humans [ ... One role for ETS-1 and ETS-2 in ocular cancer and choroidal melanoma may be mediated through their increased transcriptional ...
BayCis: A Bayesian Hierarchical HMM for Cis-Regulatory Module Decoding in Metazoan Genomes | Sciweavers
The transcriptional regulatory sequences in metazoan genomes often consist of multiple cis-regulatory modules (CRMs). Each CRM ... their first-order dependencies on upstream sequence elements, as well as prior... ... amplifying or attenuating multiple regulatory signals via combinatorial interaction with these proteins. The architecture of ... contains locally enriched occurrences of binding sites (motifs) for a certain array of regulatory proteins, capable of ...
Improved wound healing due to cardiac overexpression RNA m5C modification's emerging role in Cardiovascular Diseases.
Methylation of RNAs results in post-transcriptional regulatory mechanisms that can fine-tune gene expression by changing how ... Although the coding sequence is unaffected, these modifications have a significant impact on the expression characteristics of ... RNAs interact with other cellular elements. The writers, erasers, and readers are all involved in RNA methylations. ... Post-transcriptional gene, Cardiovascular disease, Pulmonary hypertension.. Introduction. The most common cause of morbidity ...