Other AP-MS studies have identified ALMS1 as a possible binding partner of the RNA polymerase II (RNAPII) subunit RPB1 [77]; ... Recent data indicate that pericentrosomal levels of centriolar satellites, key regulators of centrosome composition, are ... cilia and centriolar satellites, centriole assembly factors including CEP152, CPAP, CEP135 and SASS6 were among 11 baits ... Centriole splitting caused by loss of the centrosomal linker protein C-NAP1 reduces centriolar satellite density and impedes ...

Microfluidic Approaches to Fluorescence In Situ Hybridization (FISH) for Detecting RNA Targets in Single Cells Chapter © 2016 ... As a the model system, we used an immobilized MCF-7 cell monolayer and the centromeric FISH probes (satellite enumeration ... J. G. Gall, M. L. Pardue, Formation and detection of RNA-DNA hybrid molecules in cytological preparations. Proc. Natl. Acad. ... Currently, a range of probes can be synthesized to locate and quantify specific short RNAs, genes, entire chromosomes, and even ...

RNA silencing was achieved using siRNA targeting mouse Tsc1 (#1: TTGGTTGATTATTACCTGGAA #2: ATCGAGAAAGATAAGGAAGAA), Tsc2 (#1: ... Tang Z, Lin GM, Stowe TR et al (2013) Autophagy promotes primary ciliogenesis by removing OFD1 from centriolar satellites. ... To validate the transfection efficiency with plasmids (p.TSC1, p.TSC2, p.Gli2), an isolated RNA was treated with DNase I ( ... The RNA concentration was determined using a NanoDrop Spectrophotometer (Thermo Fisher Scientific). For cDNA preparation, ...

Quinodoz SA, Jachowicz JW, Bhat P et al (2021) RNA promotes the formation of spatial compartments in the nucleus. Cell 184:5775 ... been successfully used to simultaneously modify expression patterns of thousands of LINE-1 transposable elements and satellite ...