Lipids | SpringerLink
Lee, N. S., Bertrand, E., & Rossi, J. J. (1997). Enhancement of ribozyme function by RNA binding proteins. Methods in Molecular ...
Chorismate mutase of Thermus thermophilus is a monofunctional AroH class enzyme inhibited by tyrosine | SpringerLink
Regulatory features of the trp operon and the crystal structure of the trp RNA-binding attenuation protein from Bacillus ... TtCM was purified to homogeneity on an SDS polyacrylamide gel as a His-fusion protein with a deduced molecular mass of 15.8 kDa ... Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissing H, Shindyalov IN, Bourne PE (2000) The Protein Data Bank. ... Combet C, Blanchet C, Geourjon C, Deleage G (2000) NPS@: network protein sequence analysis. Trends Biochem Sci 25:147-150 ...
ALMS1 and Alström syndrome: a recessive form of metabolic, neurosensory and cardiac deficits | Journal of Molecular Medicine
Numerous candidate ALMS1-interacting proteins have been reported. Members of the α-actinin family of actin-binding proteins ... Other AP-MS studies have identified ALMS1 as a possible binding partner of the RNA polymerase II (RNAPII) subunit RPB1 [77]; ... The ALMS1 protein. ALMS1 is a large (, 4000 residue) protein that lacks known catalytic domains [11, 12]. It has several ... Following up on leads from protein-protein interaction data, recently significantly enriched by a human interactome study [113 ...
Evaluating temperature-induced regulation of a ROSE-like RNA-thermometer for heterologous rhamnolipid production in Pseudomonas...
In the recent past, the presence and function of a ROSE-like RNA-thermometer located in the 5′UTR of the rhamnosyltransferase ... In this study, the temperature-induced regulation of this native RNA-thermometer for heterologous rhamnolipid production was ... control experiments unveiled that besides the regulatory effect of the RNA-thermometer, multiple metabolic effects may ... in promoter region where they can affect binding and interaction with regulatory proteins such as transcription factors and RNA ...
De novo missense variants disrupting protein-protein interactions affect risk for autism through gene co-expression and protein...
... we identify a set of missense variants that are likely disruptive to protein-protein interactions. For genes encoding the ... We investigate the functional relevance of de novo missense variants, specifically whether they are likely to disrupt protein ... Connecting all disrupted pairs of proteins, we construct an ... the association signal primarily arises from de novo protein- ... three interactors-RNA-binding proteins hnRNPK, DHX15, and RBM4-act as connectors linking DDX5 to another hub protein PABPC1 (p. ...
Cardiovascular Injury Due to SARS-CoV-2 | SpringerLink
... bind to viral genome to translate viral message into viral polymerase protein (light blue) and (4) RNA replication to produce ... SARS-CoV-2 has various proteins on its surface including (M) membrane protein, (E) envelope small membrane protein and (S) ... Zou X, Chen K, Zou J, Han P, Hao J, Han Z. Single-cell RNA-seq data analysis on the receptor ACE2 expression reveals the ... The mechanism of cardiac/cellular entry by SARS-CoV-2 begins with the binding of SARS-CoV-2 to the ACE2 receptor via the S1 ...
Sequencing technologies and genome sequencing | Journal of Applied Genetics
2010) and identification of 4883 SOX2 binding regions in the Glioblastoma (GBM) cancer genome (Fang et al. 2011). Small RNAs ... and the human growth-associated binding protein (GABP alpha) were directly sequenced instead of being hybridized on a chip- ... RNA sequencing. HT-NGS is also finding application in the study of small RNAs. For example, a comprehensive study of miRNA in ... 2010), as well as annotation and discovery of small RNAs from transcriptomic data (Yang et al. 2011). RNA seq using Illumina ...
In Vivo Cell Reprogramming to Pluripotency | SpringerLink
Telomeric and extra-telomeric roles for telomerase and the telomere-binding proteins. Nat Rev Cancer. 2011;11(3):161-76. doi: ... A tandemly repeated sequence at the termini of the extrachromosomal ribosomal RNA genes in tetrahymena. J Mol Biol. 1978;120(1 ... Generation of human induced pluripotent stem cells by direct delivery of reprogramming proteins. Cell Stem Cell. 2009;4(6):472- ... an RNA virus that does not integrate into the host genome. Proc Jpn Acad Ser B Phys Biol Sci. 2009;85(8):348-62. doi:10.2183/ ...
TSC1 and TSC2 regulate cilia length and canonical Hedgehog signaling via different mechanisms | Cellular and Molecular Life...
Active mTORC1 phosphorylates the eukaryotic initiation factor 4E-binding protein-1 (4E-BP1) and 40S ribosomal protein S6 kinase ... RNA silencing was achieved using siRNA targeting mouse Tsc1 (#1: TTGGTTGATTATTACCTGGAA #2: ATCGAGAAAGATAAGGAAGAA), Tsc2 (#1: ... d Normalized LC3B-II protein levels for experiments shown in a before PI treatment. b-d Quantifications of LC3B-I/II protein ... The expression levels were normalized to the level of TATA binding protein (TBP) in the same samples after amplification with ...
Analysis of the quinoa genome reveals conservation and divergence of the flowering pathways | Functional & Integrative Genomics
2017). For example FLOWERING CONTROL LOCUS A (FCA) and FPA are RNA-recognition proteins which regulate 3′-end formation, ... GIGANTEA (GI) and FLAVIN-BINDING KELCH REPEAT, F-BOX 1 form a complex which recognises CDFs as substrates for degradation. The ... which undergo conformational change allowing them to interact with the DELLA proteins. DELLA proteins in turn activate GAMYB33 ... There are 355 protein coding genes which have been identified as involved in flowering in a model plant species A. thaliana ( ...
The PRDM9 KRAB domain is required for meiosis and involved in protein interactions | Chromosoma
PR domain-containing protein 9 (PRDM9) is a major regulator of the localization of meiotic recombination hotspots in the human ... Lee JH, Voo KS, Skalnik DG (2001) Identification and characterization of the DNA binding domain of CpG-binding protein. J Biol ... b RNA expression of the PRDM9-interacting proteins in mouse testes (left) and ovaries (right) during meiosis. Data were ... DNA-binding, and/or protein interaction. This may lead to the absence of DSB formation at the potential binding sites for PRDM9 ...
Acne and Genetics | SpringerLink
C-peptide, insulin-like growth factors I and II, insulin-like growth factor binding protein-1 in cord serum of twins: genetic ... Alternative RNA processing produces two insulin-like growth factor I precursor peptides. J Biol Chem. 1986;261:4828-32. ... Insulin-like growth factors, insulin-like growth factor binding proteins and ovarian androgen production. Horm Res. 1994;42:49- ... Regulation of human dermal papilla cell production of insulin-like growth factor binding protein-3 by retinoic acid, ...
TGF-β1 increases permeability of ciliated airway epithelia via redistribution of claudin 3 from tight junction into cell nuclei...
TGF-β1 binding to either subunit initiates their assembly into a heteromeric protein complex that consists of two type I and ... Total RNA was isolated from cells grown at ALI conditions with or without TGF-β1 1 ng/ml (HZ-1131, Humanzyme via Biomol, ... Protein denaturation was performed at 70 °C for 10 min. Proteins were separated on Bolt™ 4-12% Bis-Tris Plus polyacrylamide ... 7j, k). Evidently, loss of CLDN3 protein at the TJ is not due to a reduction in cellular CLDN3 protein levels. Since we ...
Basic aspects of tumor cell fatty acid-regulated signaling and transcription factors | SpringerLink
Magana, M. M., & Osborne, T. F. (1996). Two tandem binding sites for sterol regulatory element binding proteins are required ... Double-stranded RNA-mediated TLR3 activation is enhanced by CD14. Immunity, 24, 153-163. ... protein kinase C) and other transcription factors (nuclear factor kappa B and sterol regulatory element binding protein). ... 2002). Crucial step in cholesterol homeostasis: sterols promote binding of SCAP to INSIG-1, a membrane protein that facilitates ...
Plant-Virus Interactions | SpringerLink
A variety of techniques have been used to examine plant viral genomes, the functions of virus-encoded proteins, plant responses ... The P30 movement protein of tobacco mosaic virus is a single-stranded nucleic acid binding protein. Cell 60, 637-647. ... Xie, Z.X., Fan, B.F., Chen, C.H., and Chen, Z.X. (2001) An important role of an inducible RNA-dependent RNA polymerase in plant ... 2003) Diverse RNA viruses elicit the expression of common sets of genes in susceptible Arabidopsis thaliana plants. Plant J. 33 ...
Characterisation of Stramenopile-specific mastigoneme proteins in Phytophthora parasitica | Protoplasma
... and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. ... RNA-Seq analyses indicate that PnMas1 and PnMas2 genes have similar expression profiles both in vitro and in planta but that ... Construction of a fusion protein between protein a and green fluorescent protein and its application to Western blotting. FEBS ... LC-MS/MS analysis of proteins co-precipitated by anti-PnMas2 mAb in P. parasitica flagellar protein extracts. (DOCX 16 kb) ...
Predicting host tropism of influenza A virus proteins using random forest | BMC Medical Genomics
... capable of determining host tropism of individual influenza proteins. In addition, features from all 11 proteins were used to ... Several influenza proteins have been shown to be major determinants in host tropism. Further understanding and determining host ... The prediction models were trained on influenza protein sequences isolated from both avian and human samples, which were ... In this study, computational models for 11 influenza proteins have been constructed using the machine learning algorithm random ...
Role of Nrf2/HO-1 system in development, oxidative stress response and diseases: an evolutionarily conserved mechanism |...
It might also be sequestered by p62, a ubiquitin-binding protein acting as a scaffold for several protein aggregates and ... Seydoux G, Fire A (1994) Soma-germline asymmetry in the distributions of embryonic RNAs in Caenorhabditis elegans. Development ... the amino-terminal Neh2 domain controls binding Keap1-the inhibitor protein Kelch-like ECH-associated protein 1, that is ... After binding Maf proteins, Nrf2 activates antioxidant response element (ARE) and increases transcription of Nrf2-regulated ...
Delineation of phenotypes and genotypes related to cohesin structural protein RAD21 | Human Genetics
... the variant was located in a protein-binding domain (F2, F3a, F8, F9, F11a, F11b, F12, F14a, F14b, F16a, F17, F18). As numbers ... found haploinsufficiency for RAD21 led to approximately halved RAD21 RNA in a cell line from a patient with classical CdLS, ... although missense variants tend to cluster around protein binding domains.. RAD21 missense variants and their predicted effect ... Variants for which protein modelling is available, are marked in bold. F family number. The horizontal black line represents ...
Islet autoimmunity in human type 1 diabetes: initiation and progression from the perspective of the beta cell | Diabetologia
... type 1 diabetes and its relationship with antigen presentation comes from work on the IRE1α/spliced x-box binding protein 1 ( ... 1b). Interestingly, the RNA editing enzyme adenosine deaminase RNA specific 1 (ADAR1) is upregulated in response to IFN-α but ... Conditional knockout of the unfolded protein response (UPR) mediator Ire1α (also known as Ern1) in young beta cells of NOD mice ... Supporting the importance of this process, inactivation of the gap junction protein connexin 36 (encoded by Gjd2) in beta cells ...
Alpha-synuclein suppresses mitochondrial protease ClpP to trigger mitochondrial oxidative damage and neurotoxicity | Acta...
Co-IP analysis demonstrated that ClpP strongly interacted with αSyn A53T protein, while it weakly bound to αSyn WT protein (Fig ... Total RNA was isolated using RNeasy Mini Kit (QIAGEN), and 0.5-1 µg of total RNA was used to synthesize cDNA using QuantiTect ... The mitochondrial proteins VDAC, the ER protein WFS1, and the cytosolic protein Enolase were used as loading controls for ... 40 µg of mitochondrial protein in each group was subjected to protein oxidation determination using OxyBlot™ Protein Oxidation ...
Epigenetic Manipulation of Transposable and Repetitive Elements | SpringerLink
Boch J, Scholze H, Schornack S et al (2009) Breaking the code of DNA binding specificity of TAL-type III effectors. Science 326 ... Quinodoz SA, Jachowicz JW, Bhat P et al (2021) RNA promotes the formation of spatial compartments in the nucleus. Cell 184:5775 ... Targeted DNA demethylation and activation of endogenous genes using programmable TALE-TET1 fusion proteins. Nat Biotechnol 31: ... Cong L, Zhou R, Kuo YC et al (2012) Comprehensive interrogation of natural TALE DNA-binding modules and transcriptional ...
A generalizable NLP framework for fast development of pattern-based biomedical relation extraction systems | BMC Bioinformatics
... for the Binding events on the BioNLP-ST 2011 GE test set, comparing favorably with the top performing systems that participated ... the binding relation should not be extracted if its themes are not proteins or protein parts; and (3) for triggers like " ... to be an RNA. These examples show that argument types in the trigger specification are essential to the framework to achieve a ... but binding is non-directional. This is because "A binds B" and "B binds A" may be used to specify the same relation between "A ...
Kn1 gene overexpression drastically improves genetic transformation efficiencies of citrus cultivars | Plant Cell, Tissue and...
KNOTTED1 mRNA undergoes long-distance transport and interacts with movement protein binding protein 2C in pear (Pyrus ... Total RNA was isolated from leaves of transgenic and wild type plants using RNeasy Plant Mini Kit (QIAGEN) according to the ... On the other hand, small increases in transgenic KN1 protein in citrus cells can enhance shoot regeneration upon Agrobacterium- ... KN1 is a transcription factor protein involved in the establishment and maintenance of plant meristems (Bolduc and Hake 2009). ...
Genomics and clinical correlates of renal cell carcinoma | World Journal of Urology
It is, therefore, an attractive target for systemic therapies via compounds collectively named rapalogs that bind to FKBP12 to ... RNA processing, and double-stranded DNA break repair [22] that may then activate the p53-mediated checkpoint in the absence of ... Cancer-associated PTEN mutants act in a dominant-negative manner to suppress PTEN protein function. Cell 157(3):595-610. https ... most likely via retinoblastoma protein. The presence of CDKN2A alterations was also adversely associated survival in univariate ...
Reciprocal Interaction of Cancer Stem Cells of Cholangiocarcinoma with Macrophage | Stem Cell Reviews and Reports
2021). S100 calcium-binding protein A9 from tumor-associated macrophage enhances cancer stem cell-like properties of ... RNA was extracted according to the manufactures instruction of RNA extraction kit (Qiagen). Messenger RNA was purified from ... Protein samples from tumors derived SORE6± cells were extracted using the mammalian protein extraction reagent M-Per (Promega, ... were used to detect individual protein expression. Western blot imaging system was used for testing individual protein ...
Splenic Ly6Chi monocytes contribute to adverse late post-ischemic left ventricular remodeling in heme oxygenase-1 deficient...
... is a stress-inducible protein crucial in heme catabolism. The end products of its enzymatic activity possess anti-oxidative, ... Total RNA isolation, reverse transcription and quantitative PCR. Pieces of tissue from infarct area of the hearts and ... Heme oxygenase-1 (Hmox1) is a stress-inducible protein crucial in heme catabolism. The end products of its enzymatic activity ... Several leukocyte receptors and vascular adhesion ligands enable leukocyte binding to and passing through the endothelial layer ...
In Vitro Bactericidal and Virucidal Efficacy of Povidone-Iodine Gargle/Mouthwash Against Respiratory and Oral Tract Pathogens |...
... which was tested without protein load). Pathogens are eradicated by the active moiety (non PVP-bound free iodine) being ... Respiratory virus RNA is detectable in airborne and droplet particles. J Med Virol. 2013;85:2151-9. ... For all virus testing, AEC (dilution 1:500) was used to visualise antibody binding and infected cells were stained red. Stained ... resulting in impaired protein synthesis and alteration of cell membranes [38]. This basic mechanism of action leads to strong ...
Micro fluorescence in situ hybridization (μFISH) for spatially multiplexed analysis of a cell monolayer | Biomedical...
Microfluidic Approaches to Fluorescence In Situ Hybridization (FISH) for Detecting RNA Targets in Single Cells Chapter © 2016 ... The coverslip was removed, and non-specifically bound probes on the chamber slide were removed by washing twice with 0.1 % ... 2016, Rapid subtractive patterning of live cell layers with a microfluidic probe, unpublished), and high-quality protein ... J. G. Gall, M. L. Pardue, Formation and detection of RNA-DNA hybrid molecules in cytological preparations. Proc. Natl. Acad. ...
NPD1 Plus RvD1 Mediated Ischemic Stroke Penumbra Protection Increases Expression of Pro-homeostatic Microglial and Astrocyte...
Total RNA was prepared using RNeasy columns (Cat. #74004, Qiagen, Valencia, CA). RNA quantity and purity were assessed using ... FC receptor-like molecule (Fcrls) belongs to a family of receptors that bind IgG and identifies canonical microglia presenting ... 2018). NPD1 also upregulates the anti‐apoptotic proteins Bcl‐2 and Bcl-xL and decreases pro‐apoptotic Bax and Bad expression ( ... Sample Collection and RNA Isolation. Brain samples of the anterior and posterior ipsilesional cortex and subcortex regions were ...