Loading...
*  RNA Transcription Detected on Chromosomes 21 and 22 Using High Density Oligonucleotide Arrays
Oligonucleotide probes of 25 nucleotides in length have been selected to interrogate the non-repetitive nucleotide sequences ... 400,000 probe pairs (probes designed to be perfect match and mismatch) are needed to interrogate ~35 Mb of non-repetitive ... By using the very high information content inherent in high-density oligonucleotide arrays it will be possible to map the ... measured from the central positions of each adjoining probe). A total of three arrays each of which contain ~ ...
http://web.ornl.gov/sci/techresources/meetings/transcriptome2002/gingeras.shtml
*  Oligonucleotide Synthesis Market To Witness Enhanced Usage In Research, Diagnostics And Therapeutics Applications Till 2021 |...
Synthesized Oligonucleotides, Primers, Probes, Intermediate-scale synthesis Oligos, Large-scale synthesis Oligos, Linkers and ... Oligonucleotides are short nucleic acid polymers used in research, genetic testing and forensics. Oligonucleotides are usually ... Whereas, high cost of synthesized oligonucleotides and strict regulatory requirements for the approval of oligonucleotide-based ... Oligonucleotide synthesis is the chemical synthesis of relatively short fragments of nucleic acids with defined chemical ...
http://www.thedaytimereport.com/oligonucleotide-synthesis-market-to-witness-enhanced-usage-in-research-diagnostics-and-therapeutics-applications-till-2021-million-insights.html
*  Methods, compositions, and kits relating to chitinases and chitinase-like molecules and inflammatory disease - Patent...
It should be noted that YM staining was not detected when the same tissues were probed using sense oligonucleotides (FIG. 11), ... Antisense and sense probes for YM (YM antisense probe: TCCTCGAGACCCAGGGTACTGC; SEQ ID NO:9, YM sense probe: ... 11H depict lung tissue from 10 week old transgene (+) mice probed with antisense and sense probes, respectively. [0064]FIG. 12 ... The antisense oligonucleotides of the invention include, but are not limited to, phosphorothioate oligonucleotides and other ...
http://www.patentsencyclopedia.com/app/20090148539
*  Patente US5538871 - In situ polymerase chain reaction - Google Patentes
"Nucleic acid probe" refers to an oligonucleotide or polynucleotide containing a sequence complementary to part or all of the ... wash of the microscope slide with a solvent under stringent conditions to remove unhybridized probe, and detection of the probe ... Therefore, an additional probing step is no longer needed but still can be used. The increased sensitivity also simplifies ... The signal derives directly or indirectly from a molecular "tag" attached to a PCR primer or dNTP or to a nucleic acid probe, ...
http://www.google.es/patents/US5538871
*  Patent US5200313 - Nucleic acid hybridization assay employing detectable anti-hybrid antibodies - Google Patents
... selective for binding the hybrids in the presence of the single stranded sample and probe nucleic acids. No immobilization or ... A nucleic acid hybridization assay employing an immobilized or immobilizable polynucleotide probe selected to form DNA.RNA or ... Nucleic acid detection by oligonucleotide probes cleaved by both exonuclease and endonuclease. ... DNA probes can be used advantageously when the sample is RNA.. Immobilization of the Probe. As described previously, the probe ...
http://www.google.ca/patents/US5200313
*  A Method for High Quality Digoxigenin-Labeled RNA Probes for In Situ Hybridization | SelectScience
DIG-labeled RNA probes are also stable for more than a year, making them ideal for long-term studies with high consistency and ... In this application note read how DIG-labeled probes were used to investigate the localization of human hepatocyte growth ... labeled RNA antisense probes are widely used for in situ hybridization due to their high sensitivity and specificity. ... DIG-labeled RNA probes are also stable for more than a year, making them ideal for long-term studies with high consistency and ...
http://www.selectscience.net/application-notes/roche-applied-science---a-member-of-the-roche-group/a-method-for-high-quality-digoxigenin-labeled-rna-probes-for-in-situ-hybridization/?artID=29204
*  Neurons Containing Hypocretin (Orexin) Project to Multiple Neuronal Systems | Journal of Neuroscience
1994) Specific inhibition of endogenous neuropeptide Y synthesis in arcuate nucleus by antisense oligonucleotides suppresses ... rat hcrt probe using T3 polymerase (Ambion, Austin, TX) and [35S]UTP (DuPont NEN, Boston, MA). For the colorimetric procedure, ...
http://www.jneurosci.org/content/18/23/9996.long
*  Patent US5667972 - Method of sequencing of genoms by hybridization of oligonucleotide probes - Google Patents
The sequence of a given DNA fragment is read by the hybridization and assembly of positively hybridizing probes through ... with about 50,000 to 100,000 groups of probes, the main type of which is (A,T,C,G)(A,T,C,G)N8(A,T,C,G), information for ... The conditions under which oligonucleotides hybridize only with entirely homologous sequences are recognized. ... wherein a portion of the labeled oligonucleotide probe sequence at an end of the labeled oligonucleotide probe is the same as ...
http://www.google.com/patents/US5667972?dq=patent:6144888
*  Internal labeling of oligonucleotide probes by Diels-Alder cycloaddition - Strathprints
Graham, D. and Grondin, A. and McHugh, C. and Fruk, L. and Smith, W.E. (2002) Internal labeling of oligonucleotide probes by ... dna, oligonucleotide probes, cycloaddition, Chemistry, Biochemistry, Organic Chemistry, Drug Discovery. Subjects:. Science , ... A new method of adding fluorescent labels to the middle of oligonucleotides is reported. Diets-Alder cycloaddition was used to ... This is a new approach to internal oligonucleotide chemistry that opens Lip a large range of possibilities for further ...
https://strathprints.strath.ac.uk/1064/
*  Oligonucleotide Probes for Multiplex Genetic Analyses
This project discusses about Oligonucleotide Probes, Multiplex Genetic Analyses, Multiplex nucleic acid analyses, Genetic ... Oligonucleotide probes are effective tools for the research of nucleic acids. ... variation, Different Types of nucleic acid analyses, multiplex oligonucleotide design, ... In fact techniques utilizing oligonucleotide probes are effective tools for the research of nucleic acids. In the past few ...
http://www.projectsparadise.com/oligonucleotide-probes-multiplex-genetic-analyses/
*  Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes
Synthesis of the LNA-modified oligonucleotide probes. The LNA-modified and DNA oligonucleotide probes (Table ‚Äč(Table1)1) were ... Comparison of LNA2- and LNA3-modified oligonucleotide probes with DNA probes in the detection of the low-abundant miR171 in A. ... Besides being highly efficient as northern probes, the same LNA-modified oligonucleotide probes would also be useful for miRNA ... Besides being highly efficient as northern probes, the same LNA3-modified oligonucleotide probes could also be useful for ...
http://pubmedcentralcanada.ca/pmcc/articles/PMC545470/?lang=en-ca
*  Efficient oligonucleotide probe selection for pan-genomic tiling arrays | BMC Bioinformatics | Full Text
PanArray is an oligonucleotide probe selection algorithm for tiling multiple genome sequences using a minimal number of probes ... To minimize the required number of probes, probes conserved across multiple strains in the pan-genome are selected first, and ... Instead, probes are evenly tiled across all sequences of the pan-genome at a consistent level of coverage. ... An unbiased tiling of probes across the entire length of the genome is the most flexible design approach. However, such a whole ...
https://bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-10-293
*  BIOLOGICAL SAMPLE TARGET CLASSIFICATION, DETECTION AND SELECTION METHODS, AND RELATED ARRAYS AND OLIGONUCLEOTIDE PROBES -...
BIOLOGICAL SAMPLE TARGET CLASSIFICATION, DETECTION AND SELECTION METHODS, AND RELATED ARRAYS AND OLIGONUCLEOTIDE PROBES. United ... together with related arrays and oligonucleotide probes.. Inventors:. Gardner, Shea N. (Oakland, CA), Jaing, Crystal J. ( ... together with related arrays and oligonucleotide probes. ...
http://techportal.eere.energy.gov/application.do/ID=19987
*  Hybridization of Oligonucleotide Probes in Aqueous Solutions: Washing in Buffers Containing Quaternary Ammonium Salts
Synthesis of cDNA Probes from mRNA Using Random Oligonucleotide Primers *Protocol 7: Radiolabeling of Subtracted cDNA Probes by ... Hybridization of Oligonucleotide Probes in Aqueous Solutions: Washing in Buffers Containing Quaternary Ammonium Salts. ( ... TMACl is used with probes that are 1450 nucleotides in length, whereas TEACl is used with oligonucleotides that are 50200 ... Protocol 18: Hybridization of Oligonucleotide Probes in Aqueous Solutions: Washing in Buffers Containing Quaternary Ammonium ...
http://molecularcloning.com/index.php?prt=160
*  Detection of sequence variation in the HVII region of the humanmitochondrial genome in 689 individuals using...
Using a panel of 17 sequence-specific oligonucleotide (SSO) probes immobilized on nylon membrane strips, we typed 689 ... using the immobilized SSO probe panel. The SSO probe strips were used for the analysis of shed hairs and bloodstains from ... We have developed a rapid, immobilized probe-based assay for the detection of sequence variation in the hypervariable segment ... the HVII region of the humanmitochondrial genome in 689 individuals using immobilizedsequence-specific oligonucleotide probes. ...
http://uu.diva-portal.org/smash/record.jsf?pid=diva2%3A90716
*  Kinetics and thermodynamics of biotinylated oligonucleotide probe binding to particle-immobilized avidin and implications for...
Kinetics and thermodynamics of biotinylated oligonucleotide probe binding to particle-immobilized avidin and implications for ... Kinetics and thermodynamics of biotinylated oligonucleotide probe binding to particle-immobilized avidin and implications for ... Kinetics and thermodynamics of biotinylated oligonucleotide probe binding to particle-immobilized avidin and implications for ... Kinetics and thermodynamics of biotinylated oligonucleotide probe binding to particle-immobilized avidin and implications for ...
https://eprints.soton.ac.uk/177015/
*  Transcript-based redefinition of grouped oligonucleotide probe sets using AceView: High-resolution annotation for microarrays |...
Based on this transcript-level annotation, a new probe set definition was created in which every probe in a probe set maps to a ... In addition, using artificial data sets we identified that a minimal probe set size of 4 is necessary for reliable statistical ... Redefinitions introduce probe sets whose sizes may not support reliable statistical summarization; therefore, we advocate using ... For convenience, we have created custom chip-description-files (CDFs) and annotation files for our new probe set definitions ...
https://bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-8-108
*  "Short oligonucleotide probes containing G-stacks display abnormal bind"
These probes are less likely to covary with other probes that interrogate the same genes. Moreover, we found that these probes ... we describe a probe performance assessment method based on the concordance of the observed signals from probes that share ... which gives reasonable estimates of binding affinity for most other probes. These results suggest that probes containing G- ... However, due to lack of tools, the observed microarray data have not been used to assess the performance of individual probes ...
http://stars.library.ucf.edu/facultybib2000/7801/
*  Sequence diversity within the HA-1 gene as detected by melting temperature assay without oligonucleotide probes | BMC Medical...
... assay that may help identification of HA-1 alleles without oligonucleotide probes. We report the frequencies of HA-1 alleles in ... Sequence diversity within the HA-1 gene as detected by melting temperature assay without oligonucleotide probes. ... assay that may help identification of HA-1 alleles without oligonucleotide probes. ... Probe-free, Tm assays most often require confirmation by other DNA mutation detection assays. However, we propose that Tm-based ...
https://bmcmedgenet.biomedcentral.com/articles/10.1186/1471-2350-6-36
*  Design and evaluation of 16S rRNA sequence based oligonucleotide probes for the detection and quantification of Comamonas...
We have designed an oligonucleotide probe for use in fluorescent in situ hybridization (FISH) and two pairs of PCR primers ... The FISH probe and one of the PCR primer pairs are suitable for quantification of C. testosteroni in mixed microbial ... The oligonucleotides presented here provide a useful tool to study C. testosteroni population dynamics in mixed microbial ... Probe CteA was labelled with the cyanine dye CY3, whereas the EUB probe mix (an equimolar mixture of probes EUB338, EUB338-II, ...
https://bmcmicrobiol.biomedcentral.com/articles/10.1186/1471-2180-6-54
*  Oligonucleotide Probe Design and Synthesis - Nucleic Acids
Oligonucleotide Probe Design and Synthesis. Thu, 15 Dec 2011 , Nucleic Acids Design oligonucleotide probes by looking for an ... 1). When developing and choosing optimal probes, take into consideration: 1) desired probe length: the optimal probe length is ...
https://www.barnardhealth.us/nucleic-acids/oligonucleotide-probe-design-and-synthesis.html
*  Use of an oligonucleotide probe to detect Vibrio parahaemolyti...
Use of an oligonucleotide probe to detect Vibrio parahaemolyticus in artificially contaminated oysters.: A 26-mer ... Use of an oligonucleotide probe to detect Vibrio parahaemolyticus in artificially contaminated oysters.. Authors * C Lee ... This oligonucleotide probe specifically reacted with DNA from 89 of 95 V. parahaemolyticus isolates but not with DNA from other ... The probe could be used to directly identify V. parahaemolyticus in artificially contaminated food without an isolation step. ...
https://www.mysciencework.com/publication/show/use-of-an-oligonucleotide-probe-to-detect-vibrio-parahaemolyticus-in-artificially-contaminated-oysters
*  Creating Scientific Software, with Application to Phylogenetics and Oligonucleotide Probe Design
The question of what makes a good microarray probe was a research area at the time, and YODA was developed to incorporate the ... YODA is an application primarily for selecting microarray probe sequences for measuring gene expression. At the time of its ... development, none of the existing programs for this task satisfied the best-known requirements for microarray probe selection. ...
https://vtechworks.lib.vt.edu/handle/10919/64366
*  Oligonucleotides, Primers, Probes & Genes | Thermo Fisher Scientific - US
Find oligonucleotides built to your specifications here. We offer options for virtually any application and delivery times to ...
https://www.thermofisher.com/us/en/home/life-science/oligonucleotides-primers-probes-genes.html