Loading...
*  Durability of Hypertonic Saline for Enhancing Mucociliary Clearance in Cystic Fibrosis
Mice, Inbred Cftr. A strain of mice widely studied as a model for cystic fibrosis. These mice are generated from embryonic stem ... As a result, all mice have one copy of this altered gene in all their tissues. Mice homozygous for the disrupted gene exhibit ... Abnormalities in the CFTR gene have been shown to cause cystic fibrosis. (Hum Genet 1994;93(4):364-8) ... Cystic fibrosis is the most common lethal genetic disease in the Caucasian population, characterized by CFTR gene mutations, ...
https://www.bioportfolio.com/resources/trial/66505/Durability-of-Hypertonic-Saline-for-Enhancing-Mucociliary-Clearance-in-Cystic-Fibrosis.html
*  An Open Label,Safety Extension of Eurand Study PR-011
Mice, Inbred Cftr. A strain of mice widely studied as a model for cystic fibrosis. These mice are generated from embryonic stem ... As a result, all mice have one copy of this altered gene in all their tissues. Mice homozygous for the disrupted gene exhibit ... Abnormalities in the CFTR gene have been shown to cause cystic fibrosis. (Hum Genet 1994;93(4):364-8) ... Cystic fibrosis is a genetic disease caused by mutation of the cystic fibrosis transmembrane conductance regulator (CFTR). The ...
https://www.bioportfolio.com/resources/trial/64526/An-Open-Label-Safety-Extension-of-Eurand-Study-PR-011.html
*  List of MeSH codes (B01) - Wikipedia
... mice, inbred mdx MeSH B01.050.157.520.440 --- mice, inbred cba MeSH B01.050.157.520.445 --- mice, inbred cftr MeSH B01.050. ... mice, inbred mdx MeSH B01.050.199.520.520.440 --- mice, inbred cba MeSH B01.050.199.520.520.445 --- mice, inbred cftr MeSH ... mice, inbred a MeSH B01.050.157.520.318 --- mice, inbred akr MeSH B01.050.157.520.338 --- mice, inbred balb c MeSH B01.050. ... mice, inbred hrs MeSH B01.050.157.520.510 --- mice, inbred icr MeSH B01.050.157.520.555 --- mice, inbred mrl lpr MeSH B01.050. ...
https://en.wikipedia.org/wiki/List_of_MeSH_codes_(B01)
*  Basal levels of glutathione peroxidase correlate with onset of radiation induced lung disease in inbred mouse strains | Lung...
A sequence upstream of canonical PDZ-binding motif within CFTR COOH-terminus enhances NHERF1 interaction ... Mice.. Female mice of eight inbred strains (C3H/HeJ, C57BL/6, A/J, AKR/J, 129S1/SvlmJ, CBA/J, NZW/LacJ, and KK/HIJ) were ... Pulmonary expression of GPx1, GPx2, GPx3, and GPx4 in unirradiated mice of eight inbred strains. A: the fold change in mRNA ... Inbred strains of mice are thus a resource with which to investigate whether variation in the oxidative stress or antioxidant ...
http://ajplung.physiology.org/content/307/8/L597
*  Development of PEGylated PLGA nanoparticle for controlled and sustained drug delivery in cystic fibrosis | Journal of...
The efficacy of drug release in CF mice (Cftr -/- ) lungs was determined by quantifying the changes in proteasomal activity (~2 ... The ΔF508-CFTR is misfolded, ubiquitinated, and prematurely degraded by proteasome mediated- degradation. We recently ... The most common mutation, ΔF508-CFTR, is a temperature-sensitive, trafficking mutant with reduced chloride transport and ... and administered to C57BL6 mice by intranasal route. Whole-body optical imaging of the treated live animals demonstrates ...
https://jnanobiotechnology.biomedcentral.com/articles/10.1186/1477-3155-8-22
*  All In Vivo Models
Balb/c Mice, Inbred Mouse. TGMBW. Starting at: $15.75 View Bcrp Knockout Rat ...
https://www.horizondiscovery.com/in-vivo-models/all-products-459
*  3.4 STANDARDIZED NOMENCLATURE
Whenever a mouse gene is characterized based on homology to a gene already named in another species, the mouse homolog should ... Thus, the third knockout allele created at Princeton University by gene targeting at the Cftr locus would be designated as Cftr ... New inbred strains can be named freely by their originators as long as certain rules are followed: the name should be brief, ... is used to identify a mouse homolog on Chr 1. This corresponding mouse homolog will now be named D1h17S111. 3.4.4 Alleles. In ...
http://www.informatics.jax.org/silver/chapters/3-4.shtml
*  Heterozygote advantage - Wikipedia
... mouse had less secretory diarrhea than normal, noncarrier mice. Thus, it appeared for a time that resistance to cholera ... The disorder is caused by the malfunction of the CFTR protein, which controls intermembrane transport of chloride ions, which ... Carr DE, Dudash MR (June 2003). "Recent approaches into the genetic basis of inbreeding depression in plants". Philos. Trans. R ... A mouse model of CF was used to study resistance to cholera, and the results were published in Science in 1994 (Gabriel, et al ...
https://en.wikipedia.org/wiki/Heterozygote_advantage
*  RFA-DK-03-008: GENETIC MODIFIERS OF MENDELIAN DISEASES OF INTEREST TO NIDDK
This approach will become more powerful as the DNA sequences of different inbred mouse strains become available for analysis. ... The predominant mutation, deltaF508, results in the deletion of a single amino acid in the CFTR protein. Approximately 90% of ... In a CF mouse model, a modifier gene was detected on mouse chromosome 7 that contributed to fatal intestinal disease. In humans ... Mouse models of genetic diseases provide a powerful tool to demonstrate the effect of modifier genes. By breeding the main ...
https://grants.nih.gov/grants/guide/rfa-files/RFA-DK-03-008.html
*  JoVE | Peer Reviewed Scientific Video Journal - Methods and Protocols
As inbred mouse strain haplotypes are well characterized it is possible to choose donor and recipient combinations to model ... The Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a unique channel-forming member of the ATP Binding Cassette ( ... We compared ROS generation in wildtype mice and NADPH oxidase-deficient p47phox-/- mice 2 in the following three models: 1) ... Similar to patients with CGD, gp91phox -deficient mice and p47phox-deficient mice have defective phagocyte NADPH oxidase ...
https://www.jove.com/visualize/abstract/26042593/microrna-155-deficiency-attenuates-liver-steatosis-fibrosis-without
*  SERCA2a gene transfer improves electrocardiographic performance in aged mdx mice.
The reverse primer corresponds to the mouse CFTR gene intron 2 (DL1287, 5'- TGCATCACTTTTAAATGGAACCTC). The expected mouse CFTR ... Mice. Mice, Inbred mdx. Myocardium / metabolism, pathology. Sarcoplasmic Reticulum Calcium-Transporting ATPases / genetics*, ... The mouse CFTR gene was used as an internal control. The forward primer corresponds to the mouse cystic fibrosis transmembrane ... The vector genome was detected in all mdx mice that received AAV-9 SERCA2a injection but not in untreated mdx mice (Figure 1B ...
http://www.biomedsearch.com/nih/SERCA2a-gene-transfer-improves-electrocardiographic/21834967.html
*  A novel locus on mouse chromosome 7 that influences survival after infection with tick-borne encephalitis virus | BMC...
We have previously found that BALB/c mice exhibit intermediate susceptibility to the infection of TBE virus (TBEV), STS mice ... These were genotyped in the F2 hybrid mice and their linkage with survival was tested by binary trait interval mapping. We have ... The robust genetic system of recombinant congenic strains of mice enabled detection of a novel suggestive locus on chromosome 7 ... mouse orthologs of human TBE controlling genes Oas1b, Cd209, Tlr3, Ccr5, Ifnl3 and Il10, are in CcS-11 localized on segments ...
https://bmcneurosci.biomedcentral.com/articles/10.1186/s12868-018-0438-8
*  Genomics Market Research Reports - Research and Markets
Mice Model Market By Type (Inbred Mice, Outbred Mice, Genetically Engineered Mice), Service (Breeding, Rederivation), ... Targeted Therapies and CFTR Modulators for Asthma and Cystic Fibrosis Treatment Emerge as Market Growth Drivers * Report ... Therapeutic Area (Oncology, Heart Disease), Technology (CRISPR Cas9, SCNT), Mice Care Product & End User- Global Forecast To ...
https://www.researchandmarkets.com/categories/genomics
*  Effect of exercise on the nasal transmucosal potential difference in patients with cystic fibrosis and normal subjects
CFTR) chloride (Cl) ion channel might be involved in the development of chronic sinusitis in the general population. CFTR... ... Characteristics of patients with cystic fibrosis from an inbred family; Overview of nasal epithelial bioelectric properties of ... "knockout mice. In this study we determined... ... Analysis of Cystic Fibrosis Gener Product (CFTR) Function in ... Abnormalities of the cystic fibrosis gene product (CFTR) have been implicated in the genesis of idiopathic chronic pancreatitis ...
http://connection.ebscohost.com/c/articles/66051882/effect-exercise-nasal-transmucosal-potential-difference-patients-cystic-fibrosis-normal-subjects
*  List of best forex trading platform
Companies, the mice Transgenic analysis can prove the equivalence Page 407 Hartwell, et al. Paralyzed (Mot). Holley. 012. 28d ... Within the 250 kb of the CFTR gene, only about 4. Sohel, the semisterility of a heterozygous translocation behaves like a ... The existence of the MDRS in E. Generally speaking, respectively, so by Equation (5) for inbreeding, the expected genotype ... Okada, B. List of best forex trading platform example, the current human and mouse linkage maps contain more than 20,000 and ...
http://retzepti.ru/list-of-best-forex-trading-platform.html
*  An Estimate of the Average Number of Recessive Lethal Mutations Carried by Humans | Genetics
2000 Male-male competition magnifies inbreeding depression in wild house mice. Proc. Natl. Acad. Sci. USA 97: 3324-3329. ... We note that two CFTR mutations have been identified in the Hutterites. Both alleles lead to severe phenotypes such that ... A reduction in mean fitness due to inbreeding ("inbreeding depression") has been demonstrated repeatedly in experimental ... 1988 Inbreeding in human populations: an assessment of the costs, pp. 153-167 in Human Mating Patterns, edited by Mascie-Taylor ...
http://www.genetics.org/content/199/4/1243.full
*  all pediatric l1 2005:2010[pubdate] *count=100 - BioMedLib™ search engine
Mice. Mice, Inbred C57BL. Mice, Knockout. Signal Transduction / drug effects. *MedlinePlus Health Information. consumer health ... In C57Bl/6 mice, inhibition of CFTR with topical application of CFTR inhibitor-172 did not abolish the lubiprostone response, ... Mouse Genome Informatics (MGI). Mouse Genome Informatics (MGI) .. *[Email] Email this result item Email the results to the ... Mouse Genome Informatics (MGI). Mouse Genome Informatics (MGI) .. *[Email] Email this result item Email the results to the ...
http://www.bmlsearch.com/?kwr=all+pediatric+l1+2005:2010%5Bpubdate%5D&cxts=100&stmp=b0
*  Limitations of the murine nose in the development of nonviral airway gene transfer. - Radcliffe Department of Medicine
... pCF1-CFTR), and 62% of mice treated with an ubiquitin C-plasmid. We then assessed whether CFTR gene transfer corrected a panel ... In a study of approximately 400 mice with CF, vector-specific CF transmembrane conductance regulator (CFTR) mRNA was detected ... Importantly, even with the comparatively large number of animals assessed, the CFTR function studies were only powered to ... of CFTR-specific endpoint assays in the murine nose, including ion transport, periciliary liquid height, and ex vivo bacterial ...
https://www.rdm.ox.ac.uk/publications/116955
*  Human disease modifier gene - Wikipedia
By outcrossing, he agued, the breeder selects for modifying factors that attenuate the mutant phenotype, and by inbreeding and ... When analyses of allelic variation in CFTR did not suffice to yield dependable genotype-phenotype correlations or explain the ... showed, by transgenic expression in mice, that sequence polymorphisms in Mtap1a are crucial in causing the hearing-loss ... Research on cystic fibrosis (CF) exhibits a progression from genetic to molecular characterization of the major locus, CFTR. In ...
https://en.wikipedia.org/wiki/Human_disease_modifier_gene
*  Carol Linder - NMHU
Appendix X: commonly-used inbred strains and substrains of JAX® mice-genes and research applications. In: Handbook on ... CFTR expression is regulated during both the cycle of the seminiferous epithelium and the oestrous cycle of rodents. Nat Genet ... Relationship of a mouse Sertoli cell line (MSC-1) to normal mouse Sertoli cells. Biol Reprod 51:116-124. PMID: 7918865. ... Chapter 5: selecting a mouse model for research. In: Handbook on Genetically Standardized JAX® Mice, 6th edition. Currer JM and ...
http://www.nmhu.edu/our-faculty/carol-linder/
*  dict.md | M
Mouse, Inbred C3H. Mouse, Inbred C57BL. Mouse, Inbred CBA. Mouse, Inbred CFTR. ... Mouse serum proteins Antibody.immunoglobulin E.RAST class. Mouse serum proteins Antibody.immunoglobulin E.RAST class:Arbitrary ... Mouse urine proteins Antibody.immunoglobulin E.RAST class. Mouse urine proteins Antibody.immunoglobulin E.RAST class:Arbitrary ... Mouse hair Antibody.immunoglobulin E. Mouse hair Antibody.immunoglobulin E:Arbitrary Concentration:Point in time:Serum: ...
http://en.dict.md/M/621
*  A/PROF Michael Hildebrand - The University of Melbourne
Characterisation of DRASIC in the mouse inner ear. Hearing Research. 2004 * Characterisation of DRASIC in the mouse inner ear. ... CFTR-deficient pigs display peripheral nervous system defects at birth. Proceedings of the National Academy of Sciences of the ... Evidence of linkage to chromosome 5p13.2-q11.1 in a large inbred family with genetic generalized epilepsy. Epilepsia. 59. 2018 ... A Mutation in the Srrm4 Gene Causes Alternative Splicing Defects and Deafness in the Bronx Waltzer Mouse. PLoS Genetics. 8. ...
https://findanexpert.unimelb.edu.au/display/person5791
*  Gene Expression Literature Summary - MGI
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Tumor Biology (MTB), Gene Ontology (GO), MouseCyc ... Cftr cystic fibrosis transmembrane conductance regulator. MGI:88388 12 matching records from 12 references.. Summary by Age and ... J:216308 Ruan YC, Wang Y, Da Silva N, Kim B, Diao RY, Hill E, Brown D, Chan HC, Breton S, CFTR interacts with ZO-1 to regulate ... J:122989 Visel A, Thaller C, Eichele G, GenePaint.org: an atlas of gene expression patterns in the mouse embryo. Nucleic Acids ...
http://www.informatics.jax.org/gxdlit/marker/MGI:88388
*  Casein Kinase 1
Actually, organic mutations in as well as the locus that abolish function can be found in a few inbred mouse strains12, 13. ... exchanger and it is accelerated by inhibition of CFTR. This research demonstrates useful coupling between Cftr and Slc26a6-like ... Likewise, mice with organic or manufactured mutations in mouse or genes will also be practical but are even more sensitive for ... Guinea pig Cftr cDNA was amplified for 35 cycles with feeling primer 5-CTTCTTGGTAGCCCTGTC and antisense primer 5- ...
http://www.sunolmolecular.com/category/casein-kinase-1/
*  Diarrhea as a cause of mortality in a mouse model of infectious colitis | Genome Biology | Full Text
C. rodentium infection in adult susceptible inbred FVB mice and resistant outbred SW mice. (a) Significant weight loss was ... 35], who reported subtle changes in Cftr expression in whole distal colon from SW mice infected with C. rodentium. Although ... Each subset represents the comparison of resistant outbred SW mice to susceptible inbred FVB mice at the indicated time point. ... Inbred FVB mice are derived from outbred Swiss Webster (SW) mice and, since SW are known to be resistant, comparative studies ...
https://genomebiology.biomedcentral.com/articles/10.1186/gb-2008-9-8-r122