AnatomyOrganismsChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesInformation Science
Cathepsin BCathepsinsCathepsin LCathepsin DCathepsin HCathepsin KCathepsin GCathepsin ECathepsin CCysteine EndopeptidasesCathepsin FCystatinsLysosomesCathepsin ZCysteine Proteinase InhibitorsDiazomethaneEndopeptidasesDipeptidesCystatin ACathepsin WCystatin BPapainBenzoylarginine-2-NaphthylamidePepstatinsProtease InhibitorsCysteine ProteasesCathepsin AEnzyme PrecursorsCystatin CHydrogen-Ion ConcentrationExopeptidasesAmino Acid SequenceMolecular Sequence DataSerine EndopeptidasesTrypsinogenPancreatic ElastaseSubstrate SpecificityHydrolysisKineticsLeucineLeukocyte ElastaseReceptors, Urokinase Plasminogen ActivatorElectrophoresis, Polyacrylamide GelPeptide HydrolasesOligopeptides2,2'-DipyridylFasciola hepaticaLiver
Tobin JW[au] - Search Results - PubMedTobin JW[au] - Search Results - PubMed
Cathepsin S Alterations Induce a Tumor-Promoting Immune Microenvironment in Follicular Lymphoma. Bararia D, Hildebrand JA, ...
https://pubmed.ncbi.nlm.nih.gov/?cmd=search&term=Tobin+JW%5Bau%5D&dispmax=50
Search result - BRENDA Enzyme DatabaseSearch result - BRENDA Enzyme Database
Analytical Chemistry | Vol 84, No 20Analytical Chemistry | Vol 84, No 20
LC3-II accumulation and punctiform organization of autophagosomes as well as cathepsin B overactivity). Conversely, the first ...
https://pubs.acs.org/toc/ancham/84/20
Vibeke Orlien - ResultatVibeke Orlien - Resultat
High pressure processing of meat: possible role of myofibrillar protein interactions and cathepsin activity. Publikation: ...
https://forskning.ku.dk/soeg/result/?pure=da%2Fpersons%2Fvibeke-orlien
Verena KohlerVerena Kohler
Taking out the garbage: cathepsin D and calcineurin in neurodegeneration Neural Regeneration Research, Wolters Kluwer 2017, Vol ... The coordinated action of calcineurin and cathepsin d protects against α-synuclein toxicity ...
https://www.umu.se/en/staff/verena-kohler/
BindingDB BDBM50448549 CHEMBL3127106
BindingDB PrimarySearch ki
Perivascular Epithelioid Cell Neoplasms Summary Report | CureHunterPerivascular Epithelioid Cell Neoplasms Summary Report | CureHunter
Cathepsin KIBA 01/01/2012 - "The aim of this study is to evaluate cathepsin K immunohistochemically in the entire spectrum of ... 01/01/2012 - "In all of the renal PEComas, cathepsin K was found to be constantly and strongly expressed and seems to be a more ... 03/01/2013 - "Our aim was to investigate the expression of cathepsin K in a wide spectrum of extrarenal PEComas and evaluate ... 10/01/2010 - "All PEComas with TFE3 genetic alterations immunolabeled strongly for Cathepsin K, similar to other PEComas. ". ...
https://www.curehunter.com/public/keywordSummaryD054973.do
Fluorogenic substratesFluorogenic substrates
Cathepsin L (1) Elastase (3) Kallikrein (1) Luciferase (2) Matrix Metalloproteinase (MMP) (6) ...
https://www.eurogentec.com/en/catalog/c175~fluorogenic-substrates?catalog_product.ProductAttribute.223=20770
HPN hepsin [Homo sapiens (human)] - Gene - NCBIHPN hepsin [Homo sapiens (human)] - Gene - NCBI
Title: Cathepsin D enhances breast cancer invasion and metastasis through promoting hepsin ubiquitin-proteasome degradation. ... Data indicate a critical cathepsin D (CtsD)-hepsin signaling in migration and metastasis, which may contribute to understanding ...
https://www.ncbi.nlm.nih.gov/gene/3249
CTSL ORF clone FXC04676 - KOP/KDRI
pF1KB6402 4112 bp GGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAA TTCCCCACTAGTAATAATTTTCTTTAACTTTAGTAAGGAGCGATCGCCATGAATCCTACA CTCATCCTTGCTGCCTTTTGCCTGGGAATTGCCTCAGCTACTCTAACATTTGATCACAGT TTAGAGGCACAGTGGACCAAGTGGAAGGCGATGCACAACAGATTATACGGCATGAATGAA GAAGGATGGAGGAGAGCAGTGTGGGAGAAGAACATGAAGATGATTGAACTGCACAATCAG GAATACAGGGAAGGGAAACACAGCTTCACAATGGCCATGAACGCCTTTGGAGACATGACC AGTGAAGAATTCAGGCAGGTGATGAATGGCTTTCAAAACCGTAAGCCCAGGAAGGGGAAA GTGTTCCAGGAACCTCTGTTTTATGAGGCCCCCAGATCTGTGGATTGGAGAGAGAAAGGC TACGTGACTCCTGTGAAGAATCAGGGTCAGTGTGGTTCTTGTTGGGCTTTTAGTGCTACT GGTGCTCTTGAAGGACAGATGTTCCGGAAAACTGGGAGGCTTATCTCACTGAGTGAGCAG AATCTGGTAGACTGCTCTGGGCCTCAAGGCAATGAAGGCTGCAATGGTGGCCTAATGGAT TATGCTTTCCAGTATGTTCAGGATAATGGAGGCCTGGACTCTGAGGAATCCTATCCATAT GAGGCAACAGAAGAATCCTGTAAGTACAATCCCAAGTATTCTGTTGCTAATGACACCGGC TTTGTGGACATCCCTAAGCAGGAGAAGGCCCTGATGAAGGCAGTTGCAACTGTGGGGCCC ATTTCTGTTGCTATTGATGCAGGTCATGAGTCCTTCCTGTTCTATAAAGAAGGCATTTAT TTTGAGCCAGACTGTAGCAGTGAAGACATGGATCATGGTGTGCTGGTGGTTGGCTACGGA ...
http://www.kazusa.or.jp/kop/vd/FXC04676/
Bioline International Official Site (site up-dated regularly)Bioline International Official Site (site up-dated regularly)
Cloning and expression analysis of Cathepsin L cDNA of Exopalaemon carinicauda DUAN, Ya-Fei; LIU, Ping; LI, Ji-Tao; LI, Jian; ...
http://www.bioline.org.br/titles?id=zr&year=2013&vol=34&num=01&keys=V34N1
Serine proteaseSerine protease
Cathepsin 3.4.18,21,22,23. A - B - C - K - S. v • d • e ...
https://www.bionity.com/en/encyclopedia/Serine_protease.html
AKR1B10 regulates M2 macrophage polarization to promote the malignant phenotype of gastric cancer | Bioscience Reports |...
Distinct roles for cysteine cathepsin genes in multistage tumorigenesis. . Genes Dev.. 20 ...
https://portlandpress.com/bioscirep/article/43/10/BSR20222007/232873/AKR1B10-regulates-M2-macrophage-polarization-to
Pedram Argani, M.D., Professor of Pathology | Johns Hopkins MedicinePedram Argani, M.D., Professor of Pathology | Johns Hopkins Medicine
Epithelial and stromal cathepsin K and CXCL14 expression in breast tumor progression. Clin Cancer Res. 2008 Sep 1;14(17):5357- ... Cathepsin-K immunoreactivity distinguishes MiTF/TFE family renal translocation carcinomas from other renal carcinomas. Mod ...
https://www.hopkinsmedicine.org/profiles/details/pedram-argani
US10729160B1 - MTOR pathway optimized nutritional compositions - Google Patents
102000005572 Cathepsin A Human genes 0.000 description 2 * 108010059081 Cathepsin A Proteins 0.000 description 2 ...
https://patents.google.com/patent/US10729160B1/en?oq=10729160
American Society of Nephrology | Kidney Week - [Session] Glomerular Diseases: Inflammation and Fibrosis (2022)American Society of Nephrology | Kidney Week - [Session] Glomerular Diseases: Inflammation and Fibrosis (2022)
Glomerular Annexin A3 and Cathepsin C Staining in COVID-19-Associated and HIV-Associated Nephropathy (HIVAN)-Associated ... Glomerular Annexin A3 and Cathepsin C Staining in COVID-19-Associated and HIV-Associated Nephropathy (HIVAN)-Associated ...
https://www.asn-online.org/education/kidneyweek/2022/program-session-details.aspx
Mutation in Spike Protein Cleavage Site and Pathogenesis of Feline Coronavirus - Volume 19, Number 7-July 2013 - Emerging...
These could be pro-protein convertases, cathepsins, or other macrophage-specific proteases. In particular, cathepsin B, matrix ...
https://wwwnc.cdc.gov/eid/article/19/7/12-1094_article
Emerging Roles of Impaired Autophagy in Fatty Liver Disease and Hepatocellular CarcinomaEmerging Roles of Impaired Autophagy in Fatty Liver Disease and Hepatocellular Carcinoma
Y. Fukuo, S. Yamashina, H. Sonoue et al., "Abnormality of autophagic function and cathepsin expression in the liver from ... The study further pointed out that ethanol administration also increased the level of cathepsin L precursor (39 kDa) compared ... HFD/obesity decreases the expression and activities of cathepsin family enzymes and downregulates autolysosomal proteolysis. ... The study further pointed out that autosomal and liver cathepsin B and L proteinase activities were suppressed in ob/ob mice, ...
https://www.hindawi.com/journals/ijh/2021/6675762/
SMART: Pfam domain TrypsinSMART: Pfam domain Trypsin
prof. Björn Heindryckxprof. Björn Heindryckx
Cathepsin-L secreted by high-quality bovine embryos exerts an embryotrophic effect in vitro Annelies Raes (UGent) , Eline ...
https://biblio.ugent.be/person/001994280792
Anetta Härtlova | Göteborgs universitetAnetta Härtlova | Göteborgs universitet
Lung macrophages utilize unique cathepsin K-dependent phagosomal machinery to degrade intracellular collagen ...
https://www.gu.se/om-universitetet/hitta-person/anettahartlova
The role of c-Myb and Cox-2 proteins in colon carcinogenesis | Masaryk UniversityThe role of c-Myb and Cox-2 proteins in colon carcinogenesis | Masaryk University
Regulation of cathepsin D and MMP1/9 by c-Myb is a novel mechanism of the matrix-specific breast cancer cell invasion KNOPFOVÁ ... c-Myb regulates matrix metalloproteinases 1/9, and cathepsin D: implications for matrix-dependent breast cancer cell invasion ...
https://www.muni.cz/en/research/projects/5423
Research capsuleResearch capsule
Cathepsin L levels were significantly lower. No differences between the control and astaxanthin groups were observesd in soleus ... Tibialis anterior levels of cathepsin L, especially, and caspase-3 tended to be lower in the astaxanthin group than in the ...
https://www.newhope.com/food-and-beverage/research-capsule-1144
Bashir, Khalid | Creighton University
Bashir, Khalid, Bashir AZ, Khalid Bashir, Cathepsin L expression in the carotid arteries of atherosclerotic swine. Arch Med Sci ...
http://www.creighton.edu/campus-directory/bashir-khalid
Eurexpress - eurexpress.orgEurexpress - eurexpress.org
cathepsin S (Ctss). Gene Aliases. MGI ID. MGI:107341. Entrez Gene ID. 13040. ...
https://eurexpress.org/index.php/2008/09/14/eurexpress-1683/
SCR 1q41-1q43 GenesSCR 1q41-1q43 Genes
cathepsin B pseudogene. LOC100421606. 100421606. -. 227786131. 227786834. 703. INFERRED. family with sequence similarity 133, ...
http://compgen.rutgers.edu/scr1q41-1q43_genes.shtml