GeneCards.org - AHCY Gene - Adenosylhomocysteinase NLM - AHCY adenosylhomocysteinase Chicco, Davide; Sanavia, Tiziana; Jurman, ... Adenosylhomocysteinase at the U.S. National Library of Medicine Medical Subject Headings (MeSH) Vizán, Pedro; Di Croce, Luciano ... Palmer JL, Abeles RH (February 1979). "The mechanism of action of S-adenosylhomocysteinase". The Journal of Biological ... Adenosylhomocysteinase (EC 3.3.1.1, S-adenosylhomocysteine synthase, S-adenosylhomocysteine hydrolase, adenosylhomocysteine ...
2.85 Angstrom Crystal Structure of S-adenosylhomocysteinase from Cryptosporidium parvum in Complex with Adenosine and NAD. ... 2.85 Angstrom Crystal Structure of S-adenosylhomocysteinase from Cryptosporidium parvum in Complex with Adenosine and NAD.. * ... 2.85 Angstrom Crystal Structure of S-adenosylhomocysteinase from Cryptosporidium parvum in Complex with Adenosine and NAD.. ...
Recombinant Triticum Aestivum Adenosylhomocysteinase (SAHH) (Recombinant Протеини) Recombinant Triticum aestivum ... Gene Name : SAHH; SH6.2; SHH; Ado Hcyase.Syn Name : Adenosylhomocysteinase; S-adenosyl-L-homocysteine hydrolase.Видови : ...
adenosylhomocysteinase To use the sharing features on this page, please enable JavaScript.. ...
adenosylhomocysteinase. acts_upstream_of_or_within. IDA. ISO. (MGI:2183618,PMID:12023972). RGD. PMID:12023972 PMID:11741948. ...
Adenosylhomocysteinase - Epoxide hydrolase - Leukotriene A4 hydrolase. Categories: Genes on chromosome 1 , Genes on chromosome ...
Adenosylhomocysteinase (EC 3.3.1.1)(S-adenosyl-L-homocysteine hydrolase) (AdoHcyase). 8e-171. At4g13940. MEE58 (MATERNAL EFFECT ...
Full Name: Adenosylhomocysteinase O-GlcNAc Score: 13 References 2 O-GlcNAc sites ...
Adenosylhomocysteinase. Methylation ALCAM. CD166 antigen. Required for normal hematopoietic stem cell engraftment in the bone ...
adenosylhomocysteinase. Image. Gene Ontology Annotations. Cellular Component. *Chromosome, Telomeric Region. *Nuclear Telomere ...
... is used for the treatment of hairy cell leukemia and multiple sclerosis (MS). As a purine analog, it is a synthetic anti-cancer agent that also suppresses the immune system. Chemically, it mimics the nucleoside adenosine and thus inhibits the enzyme adenosine deaminase, which interferes with the cells ability to process DNA. It can be distinguished from other chemotherapeutic agents affecting purine metabolism in that it is cytotoxic to both actively dividing and quiescent lymphocytes and monocytes, inhibiting both DNA synthesis and repair. Cladribine injection is a potent antineoplastic agent with potentially significant toxic side effects. In MS, the novel mechanism of action of cladribine is expected to reduce inflammation, autoimmune effects and autoreactive cell damage, thereby improving the integrity of the blood-brain barrier. Thus, the effects of cladribine may target some of the key events that are central to the pathophysiology of MS ...
This project is supported by the Canadian Institutes of Health Research, Canada Foundation for Innovation, and by The Metabolomics Innovation Centre (TMIC), a nationally-funded research and core facility that supports a wide range of cutting-edge metabolomic studies. TMIC is funded by Genome Canada, Genome Alberta, and Genome British Columbia, a not-for-profit organization that is leading Canadas national genomics strategy with $900 million in funding from the federal government ...
Powered by Pure, Scopus & Elsevier Fingerprint Engine™ © 2023 Elsevier B.V. We use cookies to help provide and enhance our service and tailor content. By continuing you agree to the use of cookies. ...
adenosylhomocysteinase (NCBI). 20, 46. GSU1966. GSU1966. conserved hypothetical protein (VIMSS). 77, 90. ...
A knowledge graph of biological entities such as genes, gene functions, diseases, phenotypes and chemicals. Embeddings are generated with Walking RDF and OWL method ...
Purcell, R. H., Sefik, E., Werner, E., King, A. T., Mosley, T. J., Merritt-Garza, M. E., Chopra, P., McEachin, Z. T., Karne, S., Raj, N., Vaglio, B. J., Sullivan, D., Firestein, B. L., Tilahun, K., Robinette, M. I., Warren, S. T., Wen, Z., Faundez, V., Sloan, S. A., Bassell, G. J., & 1 othersMulle, J. G., Aug 2023, In: Science Advances. 9, 33, eadh0558.. Research output: Contribution to journal › Article › peer-review ...
adenosylhomocysteinase like 2 [.... AMD1. 262. AMD1. adenosylmethionine decarboxylas.... AP2B1. 163. AP2B1. adaptor related ...
Adenosylhomocysteinase. A, B. 494. Burkholderia pseudomallei 1710b. Mutation(s): 0 Gene Names: ahcY, BURPS1710b_0057. EC: 3.3. ...
Adenosylhomocysteinase (EC 3.3.1.1). Position: -93. Score: 6.6. Sequence: ATATAAAGATATATTTATGT Locus tag: NGR_c00480. Name: ...
adenosylhomocysteinase [Source:HGNC Sy.... AKR1C2. 1646. AKR1C2. aldo-keto reductase family 1 member C2.... ...
Adenosylhomocysteinase Medicine & Life Sciences 19% * Oxidative Stress Medicine & Life Sciences 16% * Cystathionine beta- ...
S-ADENOSYL-L-HOMOCYSTEINE (SAH) HYDROLASE 2 (SAHH2); FUNCTIONS IN: adenosylhomocysteinase activity, binding, catalytic activity ... adenosylhomocysteinase/ copper ion binding (TAIR:AT4G13940.1); Has 6533 Blast hits to 6529 proteins in 950 species: Archae - ...
Adenosylhomocysteinase [Source:UniProtKB/Swiss-Prot;Acc:P27604]. 98.. F11C3.3. unc-54. 516.00. 1647.86. Myosin-4 [Source: ...
F:adenosylhomocysteinase activity, binding, catalytic activity;P:one-carbon compound metabolic process, metabolic process;C: ...
Adenosylhomocysteinase AdoHcyase ahcY S adenosyl L homocysteine hydrolase S adenosylhomocysteine hydrolase S-adenosyl-L- ...
中文名稱:AHCY (Adenosylhomocysteinase, AdoHcyase, S-adenosyl-L-homocysteine hydrolase, SAHH) BioAssay ELISA Kit (Human) ... 英文名稱:AHCY (Adenosylhomocysteinase, AdoHcyase, S-adenosyl-L-homocysteine hydrolase, SAHH) BioAssay ELISA Kit (Human) ...
","Adenosylhomocysteinase-like; S-adenosyl-L-homocysteine hydrolase, NAD binding domain [Interproscan].","protein_coding" " ...
Here, we show that 3-deazaadenosine (3DA), an S-adenosyl homocysteinase (AHCY) inhibitor, alleviates replicative and oncogene- ...