Maringer, Kevin, Julianna Stylianou, and Gillian Elliott. A Network of Protein Interactions around the Herpes Simplex Virus Tegument Protein VP22. Journal of Virology 86.23 (2012): 12971-12982. Web. 06 April. 2020. ...
Herpesvirus maturation requires two different budding steps. First, capsids that were formed in the nucleus bud at the inner leaflet of the nuclear membrane, thereby acquiring a primary envelope which is subsequently lost by fusion with the outer leaflet. In this process, a complex of the UL31 primary tegument and UL34 primary envelope protein, which are conserved throughout the herpesviruses, plays an important role (1, 5, 8, 17, 28, 30, 32). Final maturation of virions then occurs in the cytoplasm by budding of intracytoplasmic capsids into Golgi-derived vesicles (10, 12; reviewed in reference 27). During this maturation process, more than 20 different tegument and envelope proteins are assembled into the mature virion. Recent data indicate that formation of mature virions follows an intricate network of protein-protein interactions with a surprising functional redundancy (reviewed in reference 27). Although the participating tegument and envelope proteins are largely known, knowledge of their ...
Diefenbach, Russel J; Fraefel, Cornel; Cunningham, Anthony L (2014). The interaction of HSV-1 tegument proteins pUL36 and pUL37: a novel target for antivirals that inhibit viral assembly. Future Virology:787-789. ...
4K70: Crystal Structure of the Herpesvirus Inner Tegument Protein UL37 Supports Its Essential Role in Control of Viral Trafficking.
Rabies Virus P Protein Interacts with STAT1 and Inhibits Interferon Signal Transduction Pathways: Rabies virus P protein is a cofactor of RNA polymerase. We inv
Author Summary Bacteriophages are extremely abundant and diverse biological entities. All phage particles are comprised of nucleic acids and structural proteins, with few other packaged proteins. Despite their simplicity and abundance, more than 70% of phage sequences in the viral Reference Sequence database encode proteins with unknown function based on FASTA annotations. As a result, the use of sequence similarity is often insufficient for detecting virus structural proteins among unknown viral sequences. Viral structural protein function is challenging to detect from sequence data because structural proteins possess few known conserved catalytic motifs and sequence domains. To address these issues we investigated the use of Artificial Neural Networks as an alternative means of predicting function. Here, we trained thousands of networks using the amino acid frequency of structural protein sequences and identified the optimal architectures with the highest accuracies. Some hypothetical protein
One amino acid change within a viral structural protein makes the difference between mild cases of brain damage and severe microcephaly in mice.. 0 Comments. ...
One amino acid change within a viral structural protein makes the difference between mild cases of brain damage and severe microcephaly in mice.. 0 Comments. ...
This enabled the expression of a foreign gene in addition to the virus polyhedrin. , 1988). Each foreign sequence was placed under the control of the native or duplicated polyhedrin gene promoter. Similar expression vectors were derived by using a combination of the polyhedrin and p10 gene promoters (Weyer and Possee, 1991). A copy of the p10 gene promoter was inserted upstream of the polyhedrin gene promoter. The influenza virus haernagglutinin o r neuraminidase gene was placed under the control of each promoter and co-synthesis achieved in recombinant virus-infected cells. The influenza virus haernagglutinin o r neuraminidase gene was placed under the control of each promoter and co-synthesis achieved in recombinant virus-infected cells. Baculovirus expression vectors are not limited to the production of two foreign proteins in insect cells. , 1990). Five bluetongue virus structural proteins have been co-expressed within the same cell by coinfection of two dual recombinants and one single ...
Laimbacher, A S; Fraefel, C (2014). HSV-1 Amplicon Vectors as Genetic Vaccines. In: Diefenbach, R J; Fraefel, C. Herpes Simplex Virus. New York: Springer, 99-115.. Melendez, M E; Fraefel, C; Epstein, A L (2014). Herpes Simplex Virus Type 1 (HSV-1)-Derived Amplicon Vectors. In: Diefenbach, R J; Fraefel, C. Herpes Simplex Virus. New York: Springer, 81-89.. Kelly, B J; Diefenbach, E; Fraefel, C; Diefenbach, R J (2012). Identification of host cell proteins which interact with herpes simplex virus type 1 tegument protein pUL37. Biochemical and Biophysical Research Communications (BBRC), 417(3):961-965.. Kelly, B J; Mijatov, Branka; Fraefel, C; Cunningham, A L; Diefenbach, R J (2011). Identification of a single amino acid residue which is critical for the interaction between HSV-1 inner tegument proteins pUL36 and pUL37. Virology:1-9.. Kelly, B J; Fraefel, C; Cunningham, A L; Diefenbach, R J (2009). Functional roles of the tegument proteins of herpes simplex virus type 1. Virus Research, ...
Genome map of SSV1. Open reading frames are shown as block arrows and labeled as in Palm et al. (1991). Virus structural protein genes (Reiter et al., 1987a) an
Biochemical properties and processing of the three major structural proteins of PRRS virus expressed by recombinant adenoviruses. Structural, functional and community aspects
Metrick, C.M., Koenigsberg, A.L., Heldwein, E.E. (2020) Conserved outer-tegument component UL11 from herpes simplex virus type 1 is an intrinsically disordered, RNA-binding protein. mBio. ​. Koenigsberg, A.L., Pitts, J.D. and Heldwein, E.E. (2020). Identification of buffer conditions for optimal thermostability and solubility of herpesviral protein UL37 using the Thermofluor assay. Bio-protocol. 10: e3662. doi: 10.21769/BioProtoc.3662. ​. ​​​​. 2019. ​. Hilterbrand, A.T. and Heldwein, E.E. (2019) Go go gadget glycoprotein!: HSV-1 draws on its sizeable glycoprotein tool kit to customize its diverse entry routes. PLoS Pathog. 15(5), e1007660. PMC6508585.. ​. ​. 2018. ​. Koenigsberg, A.L., and Heldwein, E.E. (2018) The dynamic nature of the conserved tegument protein UL37 of herpesviruses. J. Biol Chem. 293(41), 15827-15839. PMC6187633.. ​. Cooper R.S, Georgieva E.R., Borbat P.P., Freed J.H., Heldwein E.E. (2018) Structural basis ...
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class=publication>Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href=>Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
VP12 sequence 7614 bps atatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacat gaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcgg ttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattg acgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgcccc attgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctggtttagtgaaccgt cagatccgctagagatccgcggccgctaatacgactcactatagggagagccgccaccatggataaaaag tattctattggtttagacatcggcactaattccgttggatgggctgtcataaccgatgaatacaaagtac cttcaaagaaatttaaggtgttggggaacacagaccgtcattcgattaaaaagaatcttatcggtgccct cctattcgatagtggcgaaacggcagaggcgactcgcctgaaacgaaccgctcggagaaggtatacacgt cgcaagaaccgaatatgttacttacaagaaatttttagcaatgagatggccaaagttgacgattctttct ttcaccgtttggaagagtccttccttgtcgaagaggacaagaaacatgaacggcaccccatctttggaaa catagtagatgaggtggcatatcatgaaaagtacccaacgatttatcacctcagaaaaaagctagttgac tcaactgataaagcggacctgaggttaatctacttggctcttgcccatatgataaagttccgtgggcact ...
Rabbit haemorrhagic disease virus (RHDV) belongs to the family Caliciviridae and is the etiological agent of the haemorrhagic disease, also known as rabbit plague. Its genome is a linear single-stranded (ss) RNA of 7437 nucleotides and the capsid is built from a single structural protein VP60. In connection with the discovery of new RHDV strains, there is a constant need to investigate the genetic variation of this virus and perform phylogenetic analyses which may show the evolutionary relationships among the RHDV strains. Studies on the divergence of RHDV have shown that it is genetically quite stable, although recent observations indicate that some new RHDV strains, significantly different from the original RHDV subtype and the new RHDVa subtype, are appearing. These latest findings suggest that a new group of RHDV strains has evolved. The present review summarizes the current knowledge on the genetic variation and the latest achievements in phylogenetic analyses of RHDV strains isolated in ...
Read Complete genome sequence of two rabbit hemorrhagic disease virus variant b isolates detected on the Iberian Peninsula, Archives of Virology on DeepDyve, the largest online rental service for scholarly research with thousands of academic publications available at your fingertips.
A veterinary laboratory confirmed the presence of Rabbit Hemorrhagic Disease virus type 2 in a wild black-tailed jackrabbit that was among 10 jackrabbits found dead on a property near Palm Springs, according to Californias Fish and Wildlife Department.
3C-like protease processes the polyprotein: 3CLpro-RdRp (p72) is first released by autocleavage, then all other proteins are cleaved.
UNLABELLED: Herpes simplex virus (HSV) replicates in the skin and mucous membranes, and initiates lytic or latent infections in sensory neurons. Assembly of progeny virions depends on the essential large tegument protein pUL36 of 3,164 amino acid residues that links the capsids to the tegument proteins pUL37 and VP16. Of the 32 tryptophans of HSV-1-pUL36, the tryptophan-acidic motifs (1766)WD(1767) and (1862)WE(1863) are conserved in all HSV-1 and HSV-2 isolates. Here, we characterized the role of these motifs in the HSV life cycle since the rare tryptophans often have unique roles in protein function due to their large hydrophobic surface. The infectivity of the mutants HSV-1(17(+))Lox-pUL36-WD/AA-WE/AA and HSV-1(17(+))Lox-CheVP26-pUL36-WD/AA-WE/AA, in which the capsid has been tagged with the fluorescent protein Cherry, was significantly reduced. Quantitative electron microscopy shows that there were a larger number of cytosolic capsids and fewer enveloped virions compared to their respective ...
Genome replication is a critical step in virus life cycles. Here, we analyzed the role of the infectious bursal disease virus (IBDV) VP3, a major component of ...
22] It is, as the appellant agreed at oral proceedings, common general knowledge that structural proteins of a virus, i.e. the proteins involved in formation of the viral capsid, or in the case of enveloped viruses, additionally those situated in the viral envelope, are potential candidates for the inclusion in subunit vaccines. This is so because structural proteins are present at the outside of the virion and are thus exposed to the immune system. Therefore, it is expected that upon infection with ISAV, antibodies are preferably elicited against these structural proteins and that these antibodies may achieve neutralization of the virus. Therefore, vaccine preparations containing, instead of for example the whole inactivated virus, only one (or more) of the structural proteins, i.e. so-called subunit vaccines, would also be expected to have the same effect, i.e. to elicit neutralizing antibodies ...
购买SV40 VP1兔多克隆抗体(ab53977),SV40 VP1抗体经WB,IP验证,11篇文献引用,2个独立用户反馈。产品出库一年都在质保范围内。中国现货速达。
TY - JOUR. T1 - Molecular epidemiology of rabbit haemorrhagic disease virus in Australia. T2 - When one became many. AU - Kovaliski, John. AU - Sinclair, Ron. AU - Mutze, Greg. AU - Peacock, David. AU - Strive, Tanja. AU - Abrantes, Joana. AU - Esteves, Pedro. AU - Holmes, Edward. PY - 2014/2. Y1 - 2014/2. N2 - Rabbit Haemorrhagic Disease Virus (RHDV) was introduced into Australia in 1995 as a biological control agent against the wild European rabbit (Oryctolagus cuniculus). We evaluated its evolution over a 16-year period (1995-2011) by examining 50 isolates collected throughout Australia, as well as the original inoculum strains. Phylogenetic analysis of capsid protein VP60 sequences of the Australian isolates, compared with those sampled globally, revealed that they form a monophyletic group with the inoculum strains (CAPM V-351 and RHDV351INOC). Strikingly, despite more than 3000 rereleases of RHDV351INOC since 1995, only a single viral lineage has sustained its transmission in the ...
During the past 50 years two readily distinguishable rabbit-specific diseases caused by Myxoma virus (MYXV) and Rabbit haemorrhagic disease virus (RHDV) respectively, have decimated wild rabbit populations worldwide. Combined with the use of these viruses as biocontrol agents, the consequences for farming, commercial rabbit breeding and rare habitat conservation dependent on rabbit grazing, have been both positive and negative. Moreover, rare predators that rely on rabbits as a food resource, and even hunters, have suffered the consequences of rabbit populations being affected by one or other of these viruses. Rabbit haemorrhagic disease virus was first identified after thousands of domestic rabbits died suddenly in China in 1984. Similar epidemics subsequently occurred in other regions of Asia, the Middle East, Europe and North America, suggesting that the virus had dispersed widely following its emergence in China. However, the discovery that RHDV had circulated apparently harmlessly for many ...
TY - JOUR. T1 - Comparative quantitative monitoring of rabbit haemorrhagic disease viruses in rabbit kittens. AU - Matthaei, Markus. AU - Kerr, Peter AU - READ, Andrew. AU - Hick, Paul. AU - Haboury, Stephanie. AU - Wright, John. AU - STRIVE, Tanja. PY - 2014. Y1 - 2014. N2 - Background: Only one strain (the Czech CAPM-v351) of rabbit haemorrhagic disease virus (RHDV) has been released in Australia and New Zealand to control pest populations of the European rabbit O. cuniculus. Antigenic variants of RHDV known as RHDVa strains are reportedly replacing RHDV strains in other parts of the world, and Australia is currently investigating the usefulness of RHDVa to complement rabbit biocontrol efforts in Australia and New Zealand. RHDV efficiently kills adult rabbits but not rabbit kittens, which are more resistant to RHD the younger they are and which may carry the virus without signs of disease for prolonged periods. These different infection patterns in young rabbits may significantly influence ...
Public, hunters and hikers asked to take precautions to avoid spreading deadly illness. East County News Service. Photo: Creative Commons-S.A. via Bing. May 13, 2020 (Palm Springs) - After 10 dead jackrabbits were found dead on a private property near Palm Springs, a carcass has tested positive for Rabbit Hemorrhagic Disease virus type 2 (RHDV2) which is highly contagious and often lethal to both wild and domestic rabbits, as well as hares and pikas. The virus has been confirmed in state and federal lab tests. ...
Infectious bursal disease virus (IBDV) is a birnavirus that infects the B-cells in the bursa of Fabricius of young chickens, causing Gumboro disease. The IBDV 114 kDa polyprotein (NH2-pVP2-VP4-VP3-COOH) is thought to be processed at 512Ala-Ala513 and 755Ala-Ala756 through the proteolytic activity of VP4, a serine protease which uses a Ser/Lys catalytic dyad, to release pVP2, VP4 and VP3. Precursor VP2 (pVP2) is further processed at its C-terminus to generate VP2 and structural peptides through the cleavage of the 441Ala-Phe442, 487Ala-Ala488, 494Ala-Ala495 and 501Ala-Ala502 peptide bonds to release VP2 and four structural peptides, pep46, pep7a, pep7b and pep11. While the processing at the 441Ala-Phe442 site was shown to be mediated by the endopeptidase activity of VP2, the processing at the other two sites is not well understood. The products resulting from the processing of the IBDV polyprotein were previously identified by anti-VP2 and anti-VP3 antibodies. The present study used anti-VP4 ...
Infectious bursal disease virus (IBDV) is a chicken pathogen that infects the bursa of Fabricius, an organ involved in the development of the immune system in chickens. Infection by the virus leads to destruction of the bursa and immunosuppression. Infection by virulent strains may result in mortality. Current methods to combat the virus involve the use of vaccines. These are usually a mixture of live attenuated and oil inactivated virus. Variant strains of the virus are able to escape the vaccine-generated antibodies. In addition, the vaccines result in damage to the bursa. Identification of a receptor for IBDV could result in the development of either treatment for the virus or superior vaccines by interfering with the attachment of the virus to host cells. Several methods for identifying IBDV binding proteins from the membranes of cells from the bursa of Fabricius were examined. Affinity chromatography of IBDV binding proteins with a matrix consisting of IBDV cross-linked to Sepharose 4B ...
Testing by the egg and poultry industries, Biosecurity New Zealand and a specialist overseas laboratory confirmed the presence of the chicken virus infectious bursal disease virus type 1 (IBDV-1) in layer hens at a South Island egg farm in September 2019.. The likely presence of the disease was first picked up by Mainland Poultry at its Waikouaiti farm in Otago through its regular, voluntary testing routine. No birds at the farm have shown any signs of sickness due to IBDV-1 infection. Results of testing from Mainland Poultrys Hillgrove site returned positive at this location. No other properties appear to be affected.. IBDV-1 was previously discovered in New Zealand in 1993. An industry-led programme has allowed New Zealand to claim absence from the disease. The virus is present in many other countries and they successfully manage it. ...
Read Efficient rescue of infectious bursal disease virus using a simplified RNA polymerase II-based reverse genetics strategy, Archives of Virology on DeepDyve, the largest online rental service for scholarly research with thousands of academic publications available at your fingertips.
The DNA polymerase genes of human cytomegalovirus (HCMV) and varicella-zoster virus (VZV) were inserted separately into the polyhedrin gene of Autographa californica nuclear polyhedrosis virus (AcNPV) by cotransfection of Spodoptera frugiperda (SF9) cells with baculovirus transfer vectors carrying the genes and AcNPV infectious DNA. Infection of SF9 cells with the recombinant viruses resulted in expression from the polyhedrin promoter of proteins of the expected Mrs. These proteins possessed DNA polymerase activities similar to that of the enzymes induced by the respective herpesvirus in infected cells, and were identified as HCMV and VZV DNA polymerase using inhibitors and specific antisera reactive with each enzyme.
But, with this Rabbit assignment, Ive really struggled. Even with my Pollyanna personality, I fear the light here is very faint, and Im not sure theres an end to the tunnel.
Antivector immunity continues to be recognized as a potential caveat of using virus-based vaccines. ability to stimulate humoral, cellular, and mucosal immune responses. Alphaviruses belong to the family and contain a positive-sense, single-stranded RNA genome of approximately 12 kb encoding four nonstructural proteins in the 5 two-thirds of the genome, followed by a strong subgenomic promoter that directs expression of the viral structural proteins in the 3 one-third of the genome. Upon contamination of a cell, the alphavirus nonstructural proteins are translated to create a polymerase complicated instantly, which initiates replication from the viral genome and high-level transcription through the subgenomic promoter and translation from the downstream structural proteins gene products, that leads to set up of progeny viral contaminants. Vaccine delivery vectors predicated on alphaviruses have already been created from Semliki Forest pathogen (SFV) (27), Sindbis (SIN) pathogen (7, 53), ...
Enveloped viruses enter cells by using their fusion proteins to merge the virus lipid envelope and the cell membrane. While crystal structures of the water-soluble ectodomains of many viral fusion proteins have been determined, the structure and assembly of the C-terminal transmembrane domain (TMD) remains poorly understood. Here we use solid-state NMR to determine the backbone conformation and oligomeric structure of the TMD of the parainfluenza virus 5 (PIV5) fusion protein. 13C chemical shifts indicate that the central leucine-rich segment of the TMD is α-helical in POPC/cholesterol membranes and POPE membranes, while the Ile- and Val-rich termini shift to the β-strand conformation in the POPE membrane ...
ABSTRACT Brachylaima mazzantii (Travassos, 1927) is known only from its original description. Until now, no attempt has been made… Expand ...
If you are a society or association member and require assistance with obtaining online access instructions please contact our Journal Customer Services team ...
We speculate that during the late stages of the viral life cycle when mostly structural proteins such as Gag are expressed, SDF-1 induced CXCR4 downregulation is attenuated resulting in the accumulation of densensitized CXCR4 within intracellular compartments ...
The structural protein that DNA wraps around - something very important if you are a 10 micrometer cheek cell and you need to package over a meter of DN...
Receptors, located on both the cell surface and within the cell, are the molecular targets through which drugs produce their beneficial effects in various disease states
TY - JOUR. T1 - Modulation of macrophages by infectious bursal disease virus. AU - Khatri, M.. AU - Sharma, J. M.. PY - 2007/7/1. Y1 - 2007/7/1. N2 - Infectious bursal disease is one of the most important naturally occurring viral diseases of chickens worldwide. The causative agent, infectious bursal disease virus (IBDV), belongs to the family Birnaviridae. This viruscauses an acute, highly contagious and immunosuppressive disease in chickens. The virus infects and destroys actively dividing IgM-bearing B cells. Although B cells are the principal targets for IBDV, recent data show that the virus also infects macrophages. IBDV-infected macrophages produce various cytokines and chemokines which may play an important role in the protection and/or pathogenesis of IBDV. In this review, the modulatory effects of IBDV on macrophages will be discussed.. AB - Infectious bursal disease is one of the most important naturally occurring viral diseases of chickens worldwide. The causative agent, infectious ...
Autographa californica nuclear polyhedrosis virus Uncharacterized 12.5 kDa protein in VLF1-GP41 intergenic region product for laboratory research available in multiple sizes: 1000ug ; the related gene is: - , please call us for more info about this product catalog number: GEN1174561.Yeast . Gentaur: September 24, 2021, 9:47 pm
The nucleotide sequence of genome segment A cDNA of the STC strain of infectious bursal disease virus (IBDV) was determined and compared with sequences of the homologous genome segment of the 002-73 strain of IBDV and the Jasper strain of infectious pancreatic necrosis virus (IPNV). The STC-IBDV genome segment A was determined to be 3262 base pairs (bp), which is close to the estimated total length of 3300 bp for genome segment A in IBDV, although there is no proof that it is the real length of this genome segment. The STC-IBDV genome segment A contains two major overlapping open reading frames (ORFs). The large ORF of 3036 bp predicts a polyprotein of M r 109358, whereas the small ORF is 435 bp and predicts a protein of M r 16550 in STC-IBDV. STC-IBDV and 002-73-IBDV polyproteins are closely related (97.4% amino acid homology). Most of the amino acid mismatches are in VP2 sequences, mainly within the area of the conformation-dependent epitope. Comparison with the Jasper-IPNV polyprotein reveals levels
Infectious bursal disease (IBD) is a highly contagious disease of young chickens between 3 and 6 weeks of age. It is caused by infectious bursal disease virus(IBDV) which occursworldwide affecting livelihoods of resource - compromised poor communities. In Zambia, there is scantily documented information on the epidemiology of IBD. In-depth knowledge on the epidemiology of IBD is needed for effective control measures. This study aimed at molecular detection of circulating IBDV strains, andknowledge assessment of farmers about the disease in Ndola, Kitwe, Kalulushi, Luanshya and Mufulira districts of the Copperbelt province. A cross-sectional purposive study was carried out in the Copperbelt province from February to March, 2015 to determine the occurrence of IBD. The identification of IBDV was done by reverse transcription polymerase chain reaction (RT-PCR) targeting the hypervariable domain (VP2-HVR). A semi-structured questionnaire was administered to 77 respondents who presented poultry ...
詹明才。1992。農桿菌轉殖水稻系統的建立。國立台灣大學農藝學研究所博士論文。 Alvarez, M.L., Pinyerd, H.L., Topal, E. and Cardineau, G.A. 2008. P19-dependent and P19-independent reversion of F1-V gene silencing in tomato.Plant Molecular Biology 68:61-79. Angel, C.A., Hsieh, Y.C., Schoelz, J.E. 2011. Comparative analysis of the capacity of tombusvirus P22 and P19 proteins to function as avirulence determinants in Nicotiana species. Molecular Plant-Microbe Interactions 24:91-99. Arnold, M., Durairaj, V., Mundt, E., Schulze, K., Breunig, K.D., Behrens, S.E.2012. Protective vaccination against infectious bursal disease virus with whole recombinant Kluyveromyces lactis yeast expressing the viral VP2 subunit. PLoS ONE 7:e42870. Azad, A. A. Mckern, N. M., Macreadie, I. G., Failla, P., Heine, H. G., Chapman, A., Ward, C. W., Fahey, K. J. 1991. Physicochemical and immunological characterization of recombinant host-protective antigen (VP2) of infectious bursal disease ...
The study aimed to identify putative virulence determinants for the exotic poultry pathogen infectious bursal disease virus. Results suggest that three specific amino acids in viral protein 2 influence viral pathogenicity, and as a consequence these were exploited for the development of two new molecular diagnostic assays that are currently undergoing evaluation ...
Yousif AA, Mohammad WA, Khodeir MH, Zeid AZ, el-Sanousi AA, Saber MS, Reda IM. 2006, Egypt J Immunol. 13(2):85-94.Department of Virology, Faculty of Veterinary Medicine, Cairo University, Giza, Egypt.Infectious bursal disease (IBD) is one of the most
The present invention relates to a non pathogenic vaccine comprising a recombinant Infectious Bursal Disease virus that includes a recombinant Segment A, designated as rD78GLSNSΔ, that includes sequences from D78 and GLS strains and wherein the NS protein is not expressed.
Aspartyl-Prolyl bonds in proteins could be selectively hydrolyzed with 75% formic aeid. The in situ aeidie cleavage procedure based on acid lability of Asp-Pro bonds is very important in sequence analysis of proteins and comparative studies of related or similar proteins, Limited cleavage of polyhedrin and virion 31k polypeptide which have the same molecalar weights in SDS-PAGE of Buzura suppresaria nuclear polyhedrosis virus by above method produced 4 and 8 bands, respectively. The results suggest that the...
Discussion. The level of MDA is high for chicks derived from immune hens at an early age, but it decreases rapidly after day 21. It is noteworthy that antibodies were present in the blood of the chicks until the end of the experiment, that is, day 28. Similar observations were reported by Zaheer, Naeem and Malik (2003). Wisniewska and Stosik (1999) demonstrated traces of MDA in the blood of chicks until days 11-19 and later at day 23 after hatching. Other researchers claimed that the antibodies persist up to day 28 (Hitchner 1971), day 29 (Wyeth & Cullen 1979), day 30 (Iordanides, Koumpate & Artopois 1991) and day 20 after hatching (Al Mayah & Al Mayah 2013; Chansiripornchai & Sasipreeyajan 2009). These substantial differences could be ascribed to the amount of antibodies transferred from hen to chick through the egg (Hamal et al. 2006; Rai et al. 2005). Rao et al. (1987) concluded that the MDA depends on the quantity of egg yolk.. Lukert and Saif (1997) noticed that the half-life of MDA to IBDV ...
The invention relates to a modified baculovirus wherein one of the two strong late promoters of the wild baculovirus is inactive, as well as to a method for obtaining such a modified baculovirus and to its application for obtaining vectors for the expression of exogenous genes. Said modified baculovirus is particularly deprived of the polyhedrin gene promoter and contains the protein P10 gene promoter.
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
Rabbit Hemorrhagic Disease virus type 2 is believed to have spread to the U.S. from Europe, and was first reported to have killed wild rabbits in New Mexico back in March.
Elastin is an important component in our skin, providing it with elasticity. It is a structural protein found throughout our bodies, even in our organs.
면역혈소판감소자색반병으로 진단되면 생명에 위험을 줄 수 있는 출혈이 있을 때 응급으로 혈소판 수혈을 하며 만성면역혈소판감소자색반병에서 혈소판 수가 20,000/uL 이하이거나 출혈이 있으면서 혈소판 수가 50,000/uL 이하인 경우 스테로이드 투여, 비장절제, 면역글로불린 투여, 면역억제제투여 등의 치료를 한다. 20년 전 혈소판감소증으로 내원하여 말초혈액도말 검사, 거대세포바이러스, 엡스타인-바바이러스, 인간 면역결핍 바이러스, 간염 혈청 검사, 항핵항체 검사에서 모두 음성으로 확인되었으며 골수 검사에서 거대핵세포 수가 약간 증가된 것을 포함하여 특이 소견이 없었고 수차례 확인하였으나 가족력도 없어 면역혈소판감소자색반병으로 진단하였고 출혈 소견이 있으며 혈소판 수가 20,000/uL미만이었기 때문에 스테로이드, 면역글로불린, 다나졸을 ...