Two low-phytate soybean (Glycine max(L.) Merr.) mutant lines- V99-5089 (mipsmutation on chromosome 11) and CX-1834 (mrp-landmrp-nmutations on chromosomes 19 and 3, respectively) have proven to be valuable resources for breeding of low-phytate, high-sucrose, and low-raffinosaccharide soybeans, traits that are highly desirable from a nutritional and environmental standpoint. A recombinant inbred population derived from the cross CX1834 x V99-5089 provides an opportunity to study the effect of different combinations of these three mutations on soybean phytate and oligosaccharides levels. Of the 173 recombinant inbred lines tested, 163 lines were homozygous for various combinations of MIPS and two MRP loci alleles. These individuals were grouped into eight genotypic classes based on the combination of SNP alleles at the three mutant loci. The two genotypic classes that were homozygousmrp-l/mrp-nand either homozygous wild-type or mutant at themipslocus (MIPS/mrp-l/mrp-normips/mrp-l/mrp-n) displayed ...
Abstract The quality of oil determined by the constituents and proportion of fatty acid components, and the understanding of heredity of fatty acid components are of importance to breeding good quality soybean varieties. Embryo, cytoplasmic and maternal effects and genotype × environment interaction effects for quality traits of soybean [Glycine max (L.) Merrill.] seeds were analyzed using a general genetic model for quantitative traits of seeds with parents, F1 and F2, of 20 crosses from a diallel mating design of five parents planted in the field in 2003 and 2004 in Harbin, China. The interaction effects of palmitic, stearic, and linoleic acid contents were larger than the genetic main effects, while the genetic main effects were equal to interaction effects for linolenic and oleic acid content. Among all kinds of genetic main effects, the embryo effects were the largest for palmitic, stearic, and linoleic acids, while the cytoplasm effects were the largest for oleic and linolenic acids. ...
A soybean cultivar designated 1486018 is disclosed. The invention relates to the seeds of soybean cultivar 1486018, to the plants of soybean 1486018, to plant parts of soybean cultivar 1486018 and to methods for producing a soybean plant produced by crossing soybean cultivar 1486018 with itself or with another soybean variety. The invention also relates to methods for producing a soybean plant containing in its genetic material one or more transgenes and to the transgenic soybean plants and plant parts produced by those methods. This invention also relates to soybean cultivars or breeding cultivars and plant parts derived from soybean variety 1486018, to methods for producing other soybean cultivars, lines or plant parts derived from soybean cultivar 1486018 and to the soybean plants, varieties, and their parts derived from use of those methods. The invention further relates to hybrid soybean seeds, plants and plant parts produced by crossing the
A soybean cultivar designated S090130 is disclosed. The invention relates to the seeds of soybean cultivar S090130, to the plants of soybean S090130, to plant parts of soybean cultivar S090130, and to methods for producing a soybean plant produced by crossing soybean cultivar S090130 with itself or with another soybean variety. The invention also relates to methods for producing a soybean plant containing in its genetic material one or more transgenes and to the transgenic soybean plants and plant parts produced by those methods. This invention also relates to soybean cultivars, or breeding cultivars, and plant parts derived from soybean variety S090130, to methods for producing other soybean cultivars, lines or plant parts derived from soybean cultivar S090130, and to the soybean plants, varieties, and their parts derived from use of those methods. The invention further relates to hybrid soybean seeds, plants, and plant parts produced by crossing the
Isoflavone content of soybean [ Glycine max (L). Merr.] cultivars with different nitrogen sources and growing season under dry land conditions
The Use of DNA Microsatellite Markers for Genetic Diversity Identification of Soybean (Glycine max (L) Meriil.) as a Supplementary Method in Reference Collections Management
Recently, we showed that secretion of citrate in an aluminium (Al) tolerant cultivar soybean (Glycine max) (cv. Suzunari) is a specific response to Al stress [Yang et al. (2000) Physiol Plant 110: 72-77]. Here we investigated the intrinsic mechanisms behind the secretion of citrate induced by Al. The amount of citrate secreted during the 24-h Al treatment period increased with increasing concentration of Al (0-70 μM). We analysed citrate secretion basically under 3 conditions: (1) by varying light-exposure, (2) with intact or excised shoots and (3) by using a divided chamber technique. Further, the content of organic acids in the tissue and the activity of enzymes involved in organic acid metabolism were analysed and evaluated. The results indicate that high rate of citrate secretion in soybean requires a 4-h induction period. Al had a continuous effect on the citrate secretion when Al was removed from the treatment solution. Citrate secretion increased steadily under exposure to continuous ...
Somaclonal variations of Soybeans Glycine Max. L. Merr stimulated by drought stress based on random amplified polymorphic DNAs RAPDs. . Biblioteca virtual para leer y descargar libros, documentos, trabajos y tesis universitarias en PDF. Material universiario, documentación y tareas realizadas por universitarios en nuestra biblioteca. Para descargar gratis y para leer online.
Glycine Soja, also known as Soybean Seed Extract, is a plant-derived ingredient that is found in skin care products. Soybean Seed Extract functions to add moisture to products. In addition to its moisturizing benefits, it has also been found to deliver amino acids, proteins, vitamins, and minerals into the body.. The Soybean is rich in Vitamin E and the ingredient may be found in hair care products, skin care products, soaps, and lotions. Soybeans have been found to offer several other benefits including reduced cholesterol and improved skin. The ingredient, when included in anti-aging products has been found to reduce the appearance of lines and wrinkles while stimulating collagen production.. Soy extract is a powerful antioxidant that is derived from the phytochemical. The soy extract is naturally able to combat free radicals while improving the appearance of the skin. Research indicates that soy extract is effective in reducing the damaging effects of UVB on the skin cells.. Glycine Soja ...
Key message Fifteen stable QTLs were identified using a high-density soybean genetic map across multiple environments. One major QTL, qIF5- 1, contributing to total isoflavone content explained...
Made from soybeans. I looked in all my books, including The International Cosmetic Ingredient Dictionary and Handbook, and this is not in there. However, they have many pages of Glycine soja in different forms, such as Glycine soja extract (extract from the soybean plant), Glycine soja fiber (the fiber from the soybean) and Glycine soja oil (the oil from soybeans). So Im going to say, until I can find otherwise, but based on the pattern Im seeing in Gottshalck, that his is the milk made from soybeans, or soymilk --T ...
Understanding the mechanism for salt tolerance in wild soybean (Glycine soja) can help researchers improve that trait in cultivated soybean lines. We analyzed the effects of excess NaCl on the growth,
The homeodomain leucine zipper (HD-Zip) transcription factor family is one of the largest plant specific superfamilies, and includes genes with roles in modulation of plant growth and response to environmental stresses. Many HD-Zip genes are characterized in Arabidopsis (Arabidopsis thaliana), and members of the family are being investigated for abiotic stress responses in rice (Oryza sativa), maize (Zea mays), poplar (Populus trichocarpa) and cucumber (Cucmis sativus). Findings in these species suggest HD-Zip genes as high priority candidates for crop improvement. In this study we have identified members of the HD-Zip gene family in soybean cv. Williams 82, and characterized their expression under dehydration and salt stress. Homology searches with BLASTP and Hidden Markov Model guided sequence alignments identified 101 HD-Zip genes in the soybean genome. Phylogeny reconstruction coupled with domain and gene structure analyses using soybean, Arabidopsis, rice, grape (Vitis vinifera), and Medicago
Expression profiles of GsCML27 in Glycine soja.A. Tissue specific expression of GsCML27 in Glycine soja. Total RNA was extracted from root, young stem, old stem
Six experiments using 3,659 nursery and finishing pigs were conducted to evaluate the effects of dietary soybean hulls and ingredient processing in corn-soybean meal or corn-soybean meal-DDGS diets on nursery and finishing performance. Experiment 1 tested increasing soybean hulls (0, 5, 10, 15, and 20%) and increasing soybean hulls decreased ADG and G:F. Experiment 2 evaluated increasing soybean hulls (0, 10, and 20%) in diets balanced or not for NE and showed reduced performance with increasing soybean hulls. Balancing for NE resulted in G:F similar to pigs fed the control. Experiments 3 and 4 evaluated increasing dietary soybean hulls in corn-soybean meal and corn-soybean meal-DDGS diets. Soybean hulls in either diet worsened G:F and improved caloric efficiency, suggesting current INRA (2004) values for soybean hulls underestimate their energy value. Experiment 5 evaluated 10 and 20% ground or unground soybean hulls in meal and pelleted diets. Caloric efficiency improved with high levels of ...
Soybean cyst nematode (SCN) is the most serious soybean pathogen in North Carolina. Since its discovery in North Carolina (and the United States) in 1954, it has spread to all counties in the Coastal Plain, Tidewater, and some Piedmont counties with large soybean acreages. Severe yield loss caused by this pest is especially common in sandy coastal plain soils. SCN, however, is not restricted to any soil type and often causes significant soybean yield losses which may go unnoticed. Races of Soybean Cyst Nematode Field populations of SCN are characterized as races (numbered 1 through 16). A race designation of cyst nematode is an indication of a field populations ability to reproduce on each of several soybean varieties or lines. Knowing the race of cyst nematode in a given field can assist the grower in making decisions about which resistant varieties should be used. For example, if a field has race 1 or 3, then selection of a variety resistant to these races would be the appropriate choice. ...
Root system architecture is important for water acquisition and nutrient acquisition for all crops. In soybean breeding programs, wild soybean alleles have been used successfully to enhance yield and seed composition traits, but have never been investigated to improve root system architecture. Therefore, in this study, high-density single-feature polymorphic markers and simple sequence repeats were used to map quantitative trait loci (QTLs) governing root system architecture in an inter-specific soybean mapping population developed from a cross between Glycine max and Glycine soja. Wild and cultivated soybean both contributed alleles towards significant additive large effect QTLs on chromosome 6 and 7 for a longer total root length and root distribution, respectively. Epistatic effect QTLs were also identified for taproot length, average diameter, and root distribution. These root traits will influence the water and nutrient uptake in soybean. Two cell division-related genes (D type
After soybean rust, caused by Phakopsora pachyrhizi, was confirmed in the USA in 2004 in soybean (Glycine max) (4), sentinel plots were established in 2005 in 26 soybean-producing states to monitor its spread. Funding for establishing, sampling, and monitoring the plots came from the USDA, national, regional, and state soybean commodity boards, and state departments of agriculture, extension services, and universities. Sentinel plots were a minimum of 8 m × 16 m in size, planted as early as possible for a particular area, and represented either separate plots or marked areas in commercial fields that were monitored regularly by scouts primarily from state universities and extension services for soybean rust.. The presence of sentinel plots for soybean rust monitoring provided the potential for reducing the time and expense of extensive statewide travel for collection of soybean leaf samples for monitoring the incidence of other foliar diseases of soybean in Illinois. In many Midwestern states, ...
Objective:Investigating the microbes and interactions of the beneficial symbiotic relationships between the components of the system ecology in the food chains and life cycles is one of the modern sustainable agriculture topics. In this regard, to evaluate the effects of bacteria and vermicompost on morphological characteristics and yield of soybean an experiment was conducted as split plot in a completely randomized block design with three replications. Methods: Main plots of experiment were at two levels including the non-use and the use of bacteria and the subplots were at three levels including the non-use of vermicompost (control), the use of 5 tons of vermicompost per acre and the use of 10 tons of vermicompost per acre. Results: The results of mean comparison showed that the treatment including 10 tons of vermicompost had the highest amount of oil content (11%) and the lowest amount was obtained from the treatment including use of 5 tons with the amount of 9.77%. Increasing the seed growing and
Rag6 and Rag3c were delimited to a 49-kb interval on chromosome 8 and a 150-kb interval on chromosome 16, respectively. Structural variants in the exons of candidate genes were identified.. The soybean aphid, an invasive species, has significantly threatened soybean production in North America since 2000. Host-plant resistance is known as an ideal management strategy for aphids. Two novel aphid-resistance loci, Rag6 and Rag3c, from Glycine soja 85-32, were previously detected in a 10.5-cM interval on chromosome 8 and a 7.5-cM interval on chromosome 16, respectively. Defining the exact genomic position of these two genes is critical for improving the effectiveness of marker-assisted selection for aphid resistance and for identification of the functional genes. To pinpoint the locations of Rag6 and Rag3c, four populations segregating for Rag6 and Rag3c were used to fine map these two genes. The availability of the Illumina Infinium SoySNP50K/8K iSelect BeadChip, combined with single-nucleotide ...
The development of a universal soybean (Glycine max [L.] Merr.) cytogenetic map that associates classical genetic linkage groups, molecular linkage groups, and a sequence-based physical map with the karyotype has been impeded due to the soybean chromosomes themselves, which are small and morphologically homogeneous. To overcome this obstacle, we screened soybean repetitive DNA to develop a cocktail of fluorescent in situ hybridization (FISH) probes that could differentially label mitotic chromosomes in root tip preparations. We used genetically anchored BAC clones both to identify individual chromosomes in metaphase spreads and to complete a FISH-based karyotyping cocktail that permitted simultaneous identification of all 20 chromosome pairs. We applied these karyotyping tools to wild soybean, G. soja Sieb. and Zucc., which represents a large gene pool of potentially agronomically valuable traits. These studies led to the identification and characterization of a reciprocal chromosome ...
The soybean aphid, Aphis glycines (Hemiptera: Aphididae), is a consistent pest of soybean in Iowa. Current management is heavily reliant on the use of insecticides, which can be expensive and time consuming to apply. Soybean varieties resistant to the aphid are available. These varieties primarily include one resistance gene (Rag1) for soybean aphid control. Varieties incorporating two genes (Rag1 + Rag2) have recently become available. We sought to compare soybean lines susceptible to the soybean aphid with lines carrying a single resistance gene (Rag1 or Rag2) and a line carrying two resistance genes (Rag1 + Rag2). We evaluated the lines based on aphid control and yield protection.
Article Inheritance of resistance to the Soybean aphid in Soybean PI 200538. The soybean aphid (Aphis glycines Matsumura) is a major soybean [Glycine max (L.) Merr.] insect pest. Soybean plant introduction (PI) 200538 has strong resistance to the aph...
The soybean cyst nematode (SCN) Heterodera glycines Ichinohe is responsible for substantial economic losses in soybean (Glycine max L. Merr.) production throughout the U.S. Results from past efforts to quantify the severity of crop damage resulting from SCN are often subject to variable experimental conditions resulting from differences in weather, soil type, and cultivar. Because of the difficulty in accounting for these variables, a process-oriented crop growth simulation model was chosen as a platform for studying the dynamics of SCN damage and for transferring knowledge between crop production scenarios. The objective of this study was to develop and evaluate hypotheses for coupling SCN damage to the process-oriented crop growth model CROPGRO-Soybean. A monomolecular function was used to relate daily SCN damage to initial population density of SCN eggs. The equation was incorporated into the crop model in order to test two hypotheses of how SCN damage occurs. The first hypothesis was that SCN reduce
Soybean Expeller, Soybean Expeller Suppliers There are 13,279 soybean expeller suppliers, mainly located in Asia. The top supplying countries or regions are China, India, and Turkey, which supply 92%, 7%, and 1% of soybean expeller respectively. Soybean expeller products are most popular in Africa, Domestic Market, and Southeast Asia.. soybean in iran, soybean in iran Suppliers and Manufacturers. Oilpress offers 206 soybean in iran products. About 0% of these are Soybeans, 2% are Soybean Oil, and 0% are Fish Meal. A wide variety of soybean in iran options are available to you, such as use, packaging, and cultivation type.. soybean sesame oil press production line sweden. soybean expeller pressing machine sweden Best Oil Expeller China Automatic Oil Screw Press Machine of 6yl Type for screw oil press machine seed oil press best selling heavy duty oil press machine screw oil Coconut Oil Expeller,Oil Expeller China Oil Press (6YL-80, 100) China Oil Press, Oil Expeller 6YL-68 Best Seller Factory ...
The Market.Biz research report on Soybean Phospholipid Enzyme Hydrolysate offers a detailed study of Soybean Phospholipid Enzyme Hydrolysate industry worldwide concentrating on key regions like North America, Europe, and Asia. Various factors which influence the growth of Soybean Phospholipid Enzyme Hydrolysate market has been covered at depth in this report. Initially, the report states the product definition, description, range of applications, supply and demand analysis of Soybean Phospholipid Enzyme Hydrolysate industry.. The major regions present in the continents like United States, Germany, Japan and China and their contribution to global Soybean Phospholipid Enzyme Hydrolysate market is elaborated in this research document. In next section, the report discusses industry policies and plans, cost structures, the outline of Soybean Phospholipid Enzyme Hydrolysate market globally, manufacturing processes. The growth rate exhibited by Soybean Phospholipid Enzyme Hydrolysate market based on ...
Identifying Soybean Genotypes with High Charcoal Rot Resistance. Experimental field plots. Field plots were established from 2006 to 2008 at the West Tennessee Research and Education Center at University of Tennessee in Jackson, TN. The soil was a Dexter fine-silty loam (mixed, active, thermicultic hapludalfs). Soybean genotypes in MG III through V including six plant introductions were selected based on their commercial use, high yield in state variety trials, and performance in breeding trials. A total of 149 soybean genotypes consisting of 27 MG III, 29 Early MG IV, 34 Late MG IV, and 59 MG V were evaluated for reaction to M. phaseolina infection. Seeds were treated with 0.8 ml/kg of mefenoxam + fludioxinal + molybeenum (Apron Maxx + Moly, Syngenta, Greensboro, NC) prior to planting. The experiments were conducted in the same area each year and genotypes were planted in four 6.1-m rows spaced 0.7 m using an Almaco 4-row cone planter (model #AJ4RP2, Almaco, Nevada, IA). Within each MG the ...
Master of Life: Black soybean diet black soybean soybean milk anthocyanin supplement supplement ◆ black soybean 180 ◆ (for approximately three months) for business use [product] - Purchase now to accumulate reedemable points! | Rakuten Global Market
Master of Life: Black soybean diet black soybean soybean milk anthocyanin supplement supplement ◆ black soybean 60 ◆ (for approximately one month) for business use [product] - Purchase now to accumulate reedemable points! | Rakuten Global Market
All Seed Dreams seeds are grown the old-fashioned way without the use of pesticides or chemicals, and through the hard work and dedication of California farmer Shane Murphy, and Seed Curator and farmer at our Port Townsend farm, Tessa Gowans, as well as the time and love of generous volunteers ...
The distribution of flavonoids, isoflavonoids, and their conjugates in developing soybean (Glycine max L.) seedling organs and in root and seed exudates has been examined. Conjugates of the isoflavones daidzein and genistein are major metabolites in all embryonic organs within the dry seed and in seedling roots, hypocotyl, and cotyledon tissues at all times after germination. Primary leaf tissues undergo a programmed shift from isoflavonoid to flavonoid metabolism 3 days after germination and become largely predominated by glycosides of the flavonols kampferol, quercetin, and isorhamnetin by 5 days. Cotyledons contain relatively constant and very high levels of conjugates of both daidzein and genistein. Hypocotyl tissues contain a third unidentified compound, P19.3, also present in multiple conjugated forms. Conjugates of daidzein, genistein, and P19.3 are at their highest levels in the hypocotyl hook and fall off progressively down the hypocotyl. These isoflavones also undergo a programmed and ...
TC218173 TC218173 AGCCGGCGAACGGAAGAGAGGAACCATTAAACCATGTTGAAGCAGAGAGACAGAGGAGGG AGAAGCTGAACCAGAGATTCTACGCGCTTCGTGCTGTGGTTCCCAACGTGTCAAAGATGG ACNNNGCGTCGCTTCTGGGCGACGCGATATCTTACATCACCGAGCTGAAGTCCAAGCTTC AGACCCTCGAATCTGATAAAGATGTATTGCATAAGCAGCTTGAAGGAGTGAAGAAGGAAC TCGAGAAAACAACTTATAACGTTTCTTCTAATCACGCGTGTAATAATAACAATAACAACA AGTTGTCGTCGAATCAGCCGGCGTTAATTGACTTGGTTGAGATGGACGTGAAGATCATTG GGTGGGACGCGATGATAACGATCACATGCAGCAAGAAGAACCACCCCGCGGCGACGTTGA TGACGGCATTGATGGAGTTGGACTTGGACGTGCACTACGCCACCGTAACGTTGGTCAACG ATTTGATGATCCAACAAGCAACGGTGAAGATGGGAAGTAGATTTTACACGCAGGAGCAGC TTCGAGCGGTGCTGTCGGCTAAGGTTGGGGATGTACGATGATGTTGGCACTTTGCGGCAG CGTTGAGATTATAAGTGTGTGTTTGTGTCATGTTATTAGCTAGCTATCTCTTTCTAAGTT GTGTGCTGCTCTGGGGTATTTTAAGCCTTCCCGGTAGCTGTTTCTGTAAAATTTTAAGAT TTTATTTTTCTTTATTGGGCAGCTTAGTATTGAATTTTGAGGTAATCAAGCTGGGAAGCT CCATGGAGTAGTAGTATAACTAGCTAGGGACAGTTTNAANNNAATCTGTGGTGGAGTGAA ATAGGGGTAATTTTATCTGTTTAGGTA ...
Based on the optimum control theory (1) , integrative effect of 11 controllable factors of soybean field on soybean aphid (Aphis glycines Matsumura), natural enemies and summer soybean yield was studied systematically by the approaching optimum point and Orthogonal design L27 (3)13 from 1993 to 1996. According to the criterion of not only good control of the pest and increase of soybean yield but also protection of natural enemies, the controllable factors were evaluated synthetically and optimum system control of soybean aphid was suggested as follows: soybean sown in the same maize hole (4 soybean plants to 1 maize plant) or soybean interplanted in maize field (9 rows of soybeans to 2 rows of maize), cultivar Lusoybean 4, sowing time about 10 June, dressing seeds with trace fertilizer at 1800 g/ha, dosage of fertilizer N, P2O5 and K2O application at 45, 60 and 150 kg/ha, dosage of solid manure application at 22500 kg/ha, control soybean aphid with Pirmicarb at 60 g/ha. The technologies of ...
Abstract Background Soybean (Glycine max L. Merr.) is an important nitrogen-fixing crop that provides much of the worlds protein and oil. However, the available tools for investigation of soybean gene function are limited. Nevertheless, chemical mutagenesis can be applied to soybean followed by screening for mutations in a target of interest using a strategy known as Targeting Induced Local Lesions IN Genomes (TILLING). We have applied TILLING to four mutagenized soybean populations, three of which were treated with ethyl methanesulfonate (EMS) and one with N-nitroso-N-methylurea (NMU). Results We screened seven targets in each population and discovered a total of 116 induced mutations. The NMU-treated population and one EMS mutagenized population had similar mutation density (~1/140 kb), while another EMS population had a mutation density of ~1/250 kb. The remaining population had a mutation density of ~1/550 kb. Because of soybeans polyploid history, PCR amplification of multiple targets ...
Through much of the upper Midwest, soybeans are planted in April to June and harvested in September to November. Soybeans are well adapted to grow in soils similar to corn production. In many cases, soybeans are grown in rotation with corn or wheat to break insect, weed, and disease cycles.. Nutrient requirements are generally less for soybeans than other crops. Major nutrient requirements include nitrogen, phosphorous, and potassium. Much of the nitrogen is gained through a relationship with bacteria. A soil pH in the range of 5.5 to 7.0 will enhance nutrient availability and soybean growth.. Weed control is necessary to achieve optimal yields, and use of biotech seeds has eased the ability to control weeds during the growing season. Currently in the United States, over 90% of soybeans planted are herbicide resistant.. Many insects and diseases are common in soybeans grown in the upper Midwest. The most damaging pest to soybeans is soybean cyst nematode, a soil-borne parasitic roundworm that ...
At the time of this study, the available Affymetrix soybean DNA microarray consisted of 37,641 features derived from over 350,000 EST sequences that were available at the time of the design. The recent release of the soybean genome sequence and prediction of associated genes enabled reexamination of the content and updated curation of this array. Accordingly, we blasted each probe set against the predicted soybean cDNA sequences (http://www.phytozome.net/soybean). A total of 34,015 probe sets (90.5%) matched against soybean cDNA sequences, while 3,578 (9.5%) did not (Supplemental Fig. S1; Supplemental Table S1). These 34,015 probe sets were divided into three categories, associated with one (13,949, 37.1%), two (16,509, 43.9%), and three or more (3,557, 9.5%) predicted soybean genes (Supplemental Fig. S1; Supplemental Table S1). The first category of probe sets targets 11,426 soybean genes (i.e. several probe sets match with the same gene). The second and third categories of probe sets target ...
Lutein and α-tocopherol (α-toc) are antioxidant compounds beneficial for human health. Soybean [Glycine max (L). Merr.] contains relatively high concentrations of these compounds, and increasing them through plant breeding may be beneficial to human nutrition as well as provide a marketable seed trait in food-type soybean. Our objective was to determine if there have been changes in lutein and tocopherol concentrations in short-season soybean cultivars. A historical series of 16 cultivars released from 1934 to 2000 were grown at Ottawa Canada over a 3 yr period in a randomized complete-block design with four replications. Seed was harvested for yield and a sample taken to determine seed weight, and oil, protein, lutein, α-toc, γ-tocopherol (γ-toc), δ-tocopherol (δ-toc), and total-tocopherol concentrations. There were significant differences among cultivars for all traits examined. Seed yield, oil, lutein, α-toc, and δ-toc concentrations have increased significantly since 1934, while ...
Soya Meal - Find complete information about soya bean meal, soybean meal, soya meal suppliers, soya bean meal exporters and soybean meal traders from India and across the globe.
Genome analysis of soybean (Glycine max L.) has been complicated by its paleo-autopolyploid nature and conserved homeologous regions. Landmarks of expressed sequence tags (ESTs) located within a minimum tile path (MTP) of contiguous (contig) bacterial artificial chromosome (BAC) clones or radiation hybrid set can identify stress and defense related gene rich regions in the genome. A physical map of about 2,800 contigs and MTPs of 8,064 BAC clones encompass the soybean genome. That genome is being sequenced by whole genome shotgun methods so that reliable estimates of gene family size and gene locations will provide a useful tool for finishing. The aims here were to develop methods to anchor plant defense- and stress-related gene paralogues on the MTP derived from the soybean physical map, to identify gene rich regions and to correlate those with QTL for disease resistance. The probes included 143 ESTs from a root library selected by subtractive hybridization from a multiply disease resistant soybean
KEY MESSAGE : Asian soybean rust (ASR) resistance gene Rpp2 has been fine mapped into a 188.1 kb interval on Glyma.Wm82.a2, which contains a series of plant resistance (R) genes. Asian soybean rust (ASR), caused by the fungus Phakopsora pachyrihizi Syd. & P. Syd., is a serious disease in major soybean [Glycine max (L.) Merr.] production countries worldwide and causes yield losses up to 75 %. Defin ...
0156] Soybean is the worlds leading source of vegetable oil and protein meal. The oil extracted from soybeans is used for cooking oil, margarine, and salad dressings. Soybean oil is composed of saturated, monounsaturated and polyunsaturated fatty acids. It has a typical composition of 11% palmitic, 4% stearic, 25% oleic, 50% linoleic and 9% linolenic fatty acid content ("Economic Implications of Modified Soybean Traits Summary Report", Iowa Soybean Promotion Board & American Soybean Association Special Report 92S, May 1990.) Changes in fatty acid composition for improved oxidative stability and nutrition are constantly sought after. (U.S. Pat. No. 5,714,670 Soybeans Having Low Linolenic Acid and Low Palmitic Acid Contents; U.S. Pat. No. 5,763,745 Soybeans Having Low Linolenic Acid Content and Palmitic Acid Content of at Least Eleven Percent; U.S. Pat. No. 5,714,668 Soybeans Having Low Linolenic Acid And Elevated Stearic Acid Content; U.S. Pat. No. 5,714,669 A17 Soybeans Having Low Linolenic ...
Field resistance to cyst nematode (SCN) race 3 (Heterodera glycines I.) in soybean [Glycine max (L.) Merr.] cv Forrest is conditioned by two QTLs: the underlying genes are presumed to include Rhg1 on linkage group G and Rhg4 on linkage group A2. A population of recombinant inbred lines (RILs) and two populations of near-isogenic lines (NILs) derived from a cross of Forrest × Essex were used to map the loci affecting resistance to SCN. Bulked segregant analysis, with 512 AFLP primer combinations and microsatellite markers, produced a high-density genetic map for the intervals carrying Rhg1 and Rhg4. The two QTLs involved in resistance to SCN were strongly associated with the AFLP marker EATGMCGA87 (P = 0.0001, R2 = 24.5%) on linkage group G, and the AFLP marker ECCGMAAC405 (P = 0.0001, R2 = 26.2%) on linkage group A2. Two-way analysis of variance showed epistasic interaction (P = 0.0001, R2 =16%) between the two loci controlling SCN resistance in Essex × Forrest recombinant inbred lines. Considering
Meryas. Get Free PDF Sample [email protected] https://market.biz/report/global-soybean-phospholipid-market-sp/103607/#request-sample. Global Soybean PhospholipidRegions:-. Geographically this report covers all the significant businesses from India, China, USA, UK, and Japan. The present, past and forecast overview of Soybean Phospholipid market is represented in this report.. Scope & Benefits :. Soybean Phospholipid: Global Market Analysis and Opportunities will provide a detailed independent appraisal of the deep market and explore business events and difficulties for companies and marketers of Soybean Phospholipid, worldwide. Key insights provided in the report will include the following:. **Global demand for Soybean Phospholipid and five-year forecasts.. **Detailed characterizations of key country markets.. **Detailed profiles of Soybean Phospholipid products.. **Supplier market share by outcome variety and region markets.. **Analysis of market demand majority operators and constraints, trends, and ...
Business Directory for Soybean Seed Suppliers in Indore - Get contact details of Soybean Seed Manufacturers, Wholesale Soybean Seed Exporters, Best Soybean Seed Traders & Distributors Across the Indore.
Seed yield in soybean (Glycine max L.) is a function of moisture availability and is highly related to environmental conditions such as rainfall and irrigation. This study aimed to investigate differences among soybean lines and varieties in terms of phenology, above ground dry matter, seed yield, and yield components under different moisture regimes conditions, and to analyze the relationship between phenological characteristics and seed yield. Forty soybean genotypes were grown in two field experiments exposed to different irrigation regimes for three growing seasons (2010-2012). Results showed that variation in the duration of phenological stages was a determinant factor in increasing seed yield. There was a positive linear relationship between days to flowering and number of pods per plant, explaining 79 and 74% of the variation in seed yield under control and stress conditions, respectively. For both control and stress conditions, number of seeds m-2 was correlated with days to flowering and pod
THE gene space of soybean [Glycine max (L.) Merr.] is as yet undefined. Mudge et al. (2004) estimated that most genes in soybean are clustered in ∼25% of the genome (275 Mbp). One suggestion for providing information relating to gene space was to place 2000-3000 cDNA sequences onto the physical map (Stacey et al. 2004). Another approach would be to genetically map coding sequences onto the existing simple sequence repeat (SSR)-based map (Song et al. 2004). The resulting genetic map would not only indicate the positions of coding sequences, but also answer questions about relationships of coding sequences with existing SSR and RFLP markers. These relationships are important in map-based cloning, quantitative trait locus discovery, and marker-assisted plant improvement. While a fairly extensive set of ,1000 genetically mapped SSR markers is available to soybean breeders and geneticists (Cregan et al. 1999; Song et al. 2004) the current map has 138 gaps of ,5 cM in which no SSR marker is present. ...
Soybean (Glycine max (L.) Merrill) is an important component of the human diet and animal feed, but soybean production is limited by abiotic stresses especially salinity. We recently found that rhizobia inoculation enhances soybean tolerance to salt stress, but the underlying mechanisms are unaddressed. Here, we used quantitative phosphoproteomic and metabonomic approaches to identify changes in phosphoproteins and metabolites in soybean roots treated with rhizobia inoculation and salt. Results revealed differential regulation of 800 phosphopeptides, at least 32 of these phosphoproteins or their homologous were reported be involved in flavonoid synthesis or trafficking, and 27 out of 32 are transcription factors. We surveyed the functional impacts of all these 27 transcription factors by expressing their phospho-mimetic/ablative mutants in the roots of composite soybean plants and found that phosphorylation of GmMYB183 could affect the salt tolerance of the transgenic roots. Using data mining, ...
Article Soybean seed yield response to planting date and seeding rate in the upper Midwest. Planting date and seeding rate are agronomic decisions that producers can use to maximize soybean [Glycine max (L) Merr.] seed yield and economic return. Curr...
There were more than one thousand soybean(Glycine max(L.) Merr)germplasms in Hubei province.In order to evaluate the genetic diversity of summer sowing soybean landraces from different agricultural divisions of Hubei,we analyzed allelic profiles at 28 simple-sequence repeat(SSR) loci of 92 accessions.The SSR loci produced 134 alleles,and each SSR loci could detect 2 to 9 alleles with an average of 4.78 alleles per loci.The highest averages of both genetic diversity index and alleles were all occurred in southwest division,and second one was Jianghan Plain division.More than 83.6% of total variation was produced by geographical differentiation.By using the cluster analysis with Within-groups Linkage method,92 landraces were classified into three major groups at DNA level.Many landraces from southwest division and Jianghan Plain were clustered in Ⅰand Ⅲ group respectively.It was suggested that the diversity level of soybean landrace from both southwest and Jianghan Plain division were higher than
Profiling small RNAs in soybean Williams 82 (rsv), susceptible to Soybean mosaic virus (SMV, the genus Potyvirus, family Potyviridae) strains G2 and G7, and soybean PI96983 (Rsv1), resistant to G2 but susceptible to G7, identified the microRNA miR168 that was highly overexpressed only in G7-infected PI96983 showing a lethal systemic hypersensitive response (LSHR). Overexpression of miR168 was in parallel with the high-level expression of {I}AGO1{/I} mRNA, high-level accumulation of miR168-mediated {I}AGO1{/I} mRNA cleavage products but with severely repressed AGO1 protein. In contrast, AGO1 mRNA, degradation products and protein remained without significant changes in G2- and G7-infected Williams 82. Moreover, knock-down of {I}SGS3{/I}, an essential component in RNA silencing, suppressed {I}AGO1{/I} siRNA, partially recovered repressed AGO1 protein, and alleviated LSHR severity in G7-infected Rsv1 soybean. These results suggest that both miRNA and siRNA pathways are involved in G7 infection of ...