Genetic interactions regulating seed phytate and oligosaccharides in soybean (Glycine max L.)
Two low-phytate soybean (Glycine max(L.) Merr.) mutant lines- V99-5089 (mipsmutation on chromosome 11) and CX-1834 (mrp-landmrp-nmutations on chromosomes 19 and 3, respectively) have proven to be valuable resources for breeding of low-phytate, high-sucrose, and low-raffinosaccharide soybeans, traits that are highly desirable from a nutritional and environmental standpoint. A recombinant inbred population derived from the cross CX1834 x V99-5089 provides an opportunity to study the effect of different combinations of these three mutations on soybean phytate and oligosaccharides levels. Of the 173 recombinant inbred lines tested, 163 lines were homozygous for various combinations of MIPS and two MRP loci alleles. These individuals were grouped into eight genotypic classes based on the combination of SNP alleles at the three mutant loci. The two genotypic classes that were homozygousmrp-l/mrp-nand either homozygous wild-type or mutant at themipslocus (MIPS/mrp-l/mrp-normips/mrp-l/mrp-n) displayed ...
Comportamiento de seis cultivares de frijol soya (Glycine max L. Merr.), en el sistema maíz (Zea mays L.) + frijol soya, con...
Comportamiento de seis cultivares de frijol soya (Glycine max L. Merr.), en el sistema maíz (Zea mays L.) + frijol soya, con sombra de maíz ...
Phosphorylation of Soybean (Glycine max L.) Nodule Phosphoenolpyruvate Carboxylase in Vitro Decreases Sensitivity to Inhibition...
Phosphoenolpyruvate carboxylase (PEPC) from soybean (Glycine max L.Merr.) nodules was purified 187-fold to a final specific activity of 56 units mg-1 of protein. Sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis (PAGE) revealed one major polypeptide band, with a molecular mass of 110 kD, after the final purification step. Two-dimensional PAGE resolved four isoelectric forms of the purified enzyme. Antibodies raised against the purified enzyme immunoprecipitated PEPC activity from a desalted nodule extract. Two cross-reacting bands were obtained when protein immunoblots of crude nodule extracts subjected to SDS-PAGE were probed with the antiserum. One of these corresponded to the 110-kD subunit of PEPC, and the other had a molecular mass of about 60 kD. PEPC was shown to be activated in a time-dependent manner when desalted soybean nodule extracts were preincubated with Mg.ATP in vitro. Activation was observed when PEPC was assayed at pH 7 in the absence of glycerol but not at pH 8 ...
Analysis of embryo, cytoplasm and maternal effects on fatty acid components in soybean (Glycine max Merill.)
Abstract The quality of oil determined by the constituents and proportion of fatty acid components, and the understanding of heredity of fatty acid components are of importance to breeding good quality soybean varieties. Embryo, cytoplasmic and maternal effects and genotype × environment interaction effects for quality traits of soybean [Glycine max (L.) Merrill.] seeds were analyzed using a general genetic model for quantitative traits of seeds with parents, F1 and F2, of 20 crosses from a diallel mating design of five parents planted in the field in 2003 and 2004 in Harbin, China. The interaction effects of palmitic, stearic, and linoleic acid contents were larger than the genetic main effects, while the genetic main effects were equal to interaction effects for linolenic and oleic acid content. Among all kinds of genetic main effects, the embryo effects were the largest for palmitic, stearic, and linoleic acids, while the cytoplasm effects were the largest for oleic and linolenic acids. ...
Soybean cultivar 1486018 - Patent # 7282628 - PatentGenius
A soybean cultivar designated 1486018 is disclosed. The invention relates to the seeds of soybean cultivar 1486018, to the plants of soybean 1486018, to plant parts of soybean cultivar 1486018 and to methods for producing a soybean plant produced by crossing soybean cultivar 1486018 with itself or with another soybean variety. The invention also relates to methods for producing a soybean plant containing in its genetic material one or more transgenes and to the transgenic soybean plants and plant parts produced by those methods. This invention also relates to soybean cultivars or breeding cultivars and plant parts derived from soybean variety 1486018, to methods for producing other soybean cultivars, lines or plant parts derived from soybean cultivar 1486018 and to the soybean plants, varieties, and their parts derived from use of those methods. The invention further relates to hybrid soybean seeds, plants and plant parts produced by crossing the
Soybean cultivar S090130 - Patent # 8546653 - PatentGenius
A soybean cultivar designated S090130 is disclosed. The invention relates to the seeds of soybean cultivar S090130, to the plants of soybean S090130, to plant parts of soybean cultivar S090130, and to methods for producing a soybean plant produced by crossing soybean cultivar S090130 with itself or with another soybean variety. The invention also relates to methods for producing a soybean plant containing in its genetic material one or more transgenes and to the transgenic soybean plants and plant parts produced by those methods. This invention also relates to soybean cultivars, or breeding cultivars, and plant parts derived from soybean variety S090130, to methods for producing other soybean cultivars, lines or plant parts derived from soybean cultivar S090130, and to the soybean plants, varieties, and their parts derived from use of those methods. The invention further relates to hybrid soybean seeds, plants, and plant parts produced by crossing the
Isoflavone content of soybean [ Glycine max (L). Merr.] cultivars with different nitrogen sources and growing season under...
Isoflavone content of soybean [ Glycine max (L). Merr.] cultivars with different nitrogen sources and growing season under dry land conditions
The Use of DNA Microsatellite Markers for Genetic Diversity Identification of Soybean (Glycine max (L) Meriil.) as a...
The Use of DNA Microsatellite Markers for Genetic Diversity Identification of Soybean (Glycine max (L) Meriil.) as a Supplementary Method in Reference Collections Management
Pathogenesis of Alfalfa mosaic virus in Soybean (Glycine max) and Expression of Chimeric Rabies Peptide in Virus-Infected...
Phytopathology 91:941-947...Phytopathology 91:941-947...Pathogenesis of Alfalfa mosaic virus in Soybean (Glycine max) and Expression of Chimeric Rabies Peptide in Virus-Infected Soybean Plants...Nina Fleysh , Deepali Deka , Maria Drath , Hilary Koprowski , and Vidadi Yusibov...
Characterization of aluminium-induced citrate secretion in aluminium-tolerant soybean (Glycine max) plants - Yang - 2001 -...
Recently, we showed that secretion of citrate in an aluminium (Al) tolerant cultivar soybean (Glycine max) (cv. Suzunari) is a specific response to Al stress [Yang et al. (2000) Physiol Plant 110: 72-77]. Here we investigated the intrinsic mechanisms behind the secretion of citrate induced by Al. The amount of citrate secreted during the 24-h Al treatment period increased with increasing concentration of Al (0-70 μM). We analysed citrate secretion basically under 3 conditions: (1) by varying light-exposure, (2) with intact or excised shoots and (3) by using a divided chamber technique. Further, the content of organic acids in the tissue and the activity of enzymes involved in organic acid metabolism were analysed and evaluated. The results indicate that high rate of citrate secretion in soybean requires a 4-h induction period. Al had a continuous effect on the citrate secretion when Al was removed from the treatment solution. Citrate secretion increased steadily under exposure to continuous ...
Somaclonal variations of Soybeans Glycine Max. L. Merr stimulated by drought stress based on random amplified polymorphic DNAs...
Somaclonal variations of Soybeans Glycine Max. L. Merr stimulated by drought stress based on random amplified polymorphic DNAs RAPDs. . Biblioteca virtual para leer y descargar libros, documentos, trabajos y tesis universitarias en PDF. Material universiario, documentación y tareas realizadas por universitarios en nuestra biblioteca. Para descargar gratis y para leer online.
Get PDF - Monoclonal antibodies directed against protoplasts of soybean glycine max cells generation of hybridomas and...
Villanueva, M.A.; Metcalf, T.N.IIi; Wang, J.L., 1986: Monoclonal antibodies directed against protoplasts of soybean glycine max cells generation of hybridomas and characterization of a monoclonal antibody reactive with the cell surface
Glycine Soja (Soybean) Seed Extract - Bellatorra skin care
Glycine Soja, also known as Soybean Seed Extract, is a plant-derived ingredient that is found in skin care products. Soybean Seed Extract functions to add moisture to products. In addition to its moisturizing benefits, it has also been found to deliver amino acids, proteins, vitamins, and minerals into the body.. The Soybean is rich in Vitamin E and the ingredient may be found in hair care products, skin care products, soaps, and lotions. Soybeans have been found to offer several other benefits including reduced cholesterol and improved skin. The ingredient, when included in anti-aging products has been found to reduce the appearance of lines and wrinkles while stimulating collagen production.. Soy extract is a powerful antioxidant that is derived from the phytochemical. The soy extract is naturally able to combat free radicals while improving the appearance of the skin. Research indicates that soy extract is effective in reducing the damaging effects of UVB on the skin cells.. Glycine Soja ...
Frontiers | Organ-Specific Differential NMR-Based Metabonomic Analysis of Soybean [Glycine max (L.) Merr.] Fruit Reveals the...
Prolonged, continuous rainfall is the main climatic characteristic of autumn in Southwest China, and it has been found to cause mildew outbreaks in pre-harvest soybean fields. Low temperature and humidity (LTH) stress during soybean maturation in the field promotes pre-harvest mildew, resulting in damage to different organs of soybean fruits to different extents, but relatively little information on the resistance mechanisms in these fruits is available. Therefore, to understand the metabolic responses of soybean fruits to field mold (FM), the metabonomic variations induced by LTH were characterized using proton nuclear magnetic resonance spectroscopy (1H-NMR), and the primary metabolites from the pod, seed coat and cotyledon of pre-harvest soybean were quantified. Analysis of FM-damaged soybean germplasms with different degrees of resistance to FM showed that extracts were dominated by 66 primary metabolites, including amino acids, organic acids and sugars. Each tissue had a characteristic metabolic
Fine-mapping of QTLs for individual and total isoflavone content in soybean ( Glycine max L.) using a high-density genetic map ...
Key message Fifteen stable QTLs were identified using a high-density soybean genetic map across multiple environments. One major QTL, qIF5- 1, contributing to total isoflavone content explained...
Polyamines as potential regulators of nutrient exchange across the peribacteroid membrane in soybean root nodules<...
TY - JOUR. T1 - Polyamines as potential regulators of nutrient exchange across the peribacteroid membrane in soybean root nodules. AU - Whitehead, Lynne F.. AU - Tyerman, Stephen D.. AU - Day, David A.. PY - 2001. Y1 - 2001. N2 - The effect of cytoplasmic polyamines on peribacteroid membrane transport processes in soybean (Glycine max L.) was investigated. The concentration of free polyamines in soybean nodule cytoplasm has been estimated by others to be in the micromolar range. The H+-ATPase was inhibited by 37 and 54% by 200 μM spermidine and putrescine, respectively. Spermine applied to the cytoplasmic face of the peribacteroid membrane was found to inhibit both inward and outward currents through a non-selective cation channel permeable to ammonium (Kd 2.1 μM at - 100 mV). Malate transport into intact symbiosomes was reduced by 15-30% by 15 mM spermidine, cadaverine and putrescine. A non-specific stimulation of malate transport by polycations was found to occur at concentrations in the ...
Genotypic variations in Soybean genotypes towards salinity, 978-3-659-57708-6, 3659577081 ,9783659577086 by ...
Genotypic variations in Soybean genotypes towards salinity, 978-3-659-57708-6, Since salinization of soil is an important worldwide problem, identification of salt tolerant plants and their underlying mechanism for salt tolerance is an important phenomenon in distinguishing plant salinity relation. The biochemical and molecular study showed that there is variability in salt tolerance behaviour in soybean genotypes. There is clear indication of role of antioxidant defence system in conferring slat-tolerance and sensitiveness in soybean genotypes. Moreover our data suggest that RAPD markers are suitable to assess genetic diversity between different local populations and to examine genetic relationships. Therefore, the present study may aid breeders interested in selecting genetically diverse source for salt tolerant and sensitiveness for broadening the genetic base as well as for development of mapping population of soybean genotypes.
Glycine soya milk
Made from soybeans. I looked in all my books, including The International Cosmetic Ingredient Dictionary and Handbook, and this is not in there. However, they have many pages of Glycine soja in different forms, such as Glycine soja extract (extract from the soybean plant), Glycine soja fiber (the fiber from the soybean) and Glycine soja oil (the oil from soybeans). So Im going to say, until I can find otherwise, but based on the pattern Im seeing in Gottshalck, that his is the milk made from soybeans, or soymilk --T ...
Physiological responses of three soybean species (Glycine soja, G. gracilis, andG. maxcv. Melrose) to salinity stress |...
Understanding the mechanism for salt tolerance in wild soybean (Glycine soja) can help researchers improve that trait in cultivated soybean lines. We analyzed the effects of excess NaCl on the growth,
Comprehensive characterization and RNA-Seq profiling of the HD-Zip transcription factor family in soybean ( Glycine max )...
The homeodomain leucine zipper (HD-Zip) transcription factor family is one of the largest plant specific superfamilies, and includes genes with roles in modulation of plant growth and response to environmental stresses. Many HD-Zip genes are characterized in Arabidopsis (Arabidopsis thaliana), and members of the family are being investigated for abiotic stress responses in rice (Oryza sativa), maize (Zea mays), poplar (Populus trichocarpa) and cucumber (Cucmis sativus). Findings in these species suggest HD-Zip genes as high priority candidates for crop improvement. In this study we have identified members of the HD-Zip gene family in soybean cv. Williams 82, and characterized their expression under dehydration and salt stress. Homology searches with BLASTP and Hidden Markov Model guided sequence alignments identified 101 HD-Zip genes in the soybean genome. Phylogeny reconstruction coupled with domain and gene structure analyses using soybean, Arabidopsis, rice, grape (Vitis vinifera), and Medicago
Expression profiles of GsCML27 in Glycine soja.A. Tissu | Open-i
Expression profiles of GsCML27 in Glycine soja.A. Tissue specific expression of GsCML27 in Glycine soja. Total RNA was extracted from root, young stem, old stem
The effects of dietary soybean hulls, wheat, crystalline amino acids and high protein corn dried distillers grains on nursery...
Six experiments using 3,659 nursery and finishing pigs were conducted to evaluate the effects of dietary soybean hulls and ingredient processing in corn-soybean meal or corn-soybean meal-DDGS diets on nursery and finishing performance. Experiment 1 tested increasing soybean hulls (0, 5, 10, 15, and 20%) and increasing soybean hulls decreased ADG and G:F. Experiment 2 evaluated increasing soybean hulls (0, 10, and 20%) in diets balanced or not for NE and showed reduced performance with increasing soybean hulls. Balancing for NE resulted in G:F similar to pigs fed the control. Experiments 3 and 4 evaluated increasing dietary soybean hulls in corn-soybean meal and corn-soybean meal-DDGS diets. Soybean hulls in either diet worsened G:F and improved caloric efficiency, suggesting current INRA (2004) values for soybean hulls underestimate their energy value. Experiment 5 evaluated 10 and 20% ground or unground soybean hulls in meal and pelleted diets. Caloric efficiency improved with high levels of ...
SOY006 - Disease Resistance in Selected Soybean Varieties
Soybean cyst nematode (SCN) is the most serious soybean pathogen in North Carolina. Since its discovery in North Carolina (and the United States) in 1954, it has spread to all counties in the Coastal Plain, Tidewater, and some Piedmont counties with large soybean acreages. Severe yield loss caused by this pest is especially common in sandy coastal plain soils. SCN, however, is not restricted to any soil type and often causes significant soybean yield losses which may go unnoticed. Races of Soybean Cyst Nematode Field populations of SCN are characterized as races (numbered 1 through 16). A race designation of cyst nematode is an indication of a field populations ability to reproduce on each of several soybean varieties or lines. Knowing the race of cyst nematode in a given field can assist the grower in making decisions about which resistant varieties should be used. For example, if a field has race 1 or 3, then selection of a variety resistant to these races would be the appropriate choice. ...
Genetic variants in root architecture-related genes in a Glycine soja accession, a potential resource to improve cultivated...
Root system architecture is important for water acquisition and nutrient acquisition for all crops. In soybean breeding programs, wild soybean alleles have been used successfully to enhance yield and seed composition traits, but have never been investigated to improve root system architecture. Therefore, in this study, high-density single-feature polymorphic markers and simple sequence repeats were used to map quantitative trait loci (QTLs) governing root system architecture in an inter-specific soybean mapping population developed from a cross between Glycine max and Glycine soja.
Wild and cultivated soybean both contributed alleles towards significant additive large effect QTLs on chromosome 6 and 7 for a longer total root length and root distribution, respectively. Epistatic effect QTLs were also identified for taproot length, average diameter, and root distribution. These root traits will influence the water and nutrient uptake in soybean. Two cell division-related genes (D type
Occurrences of Soybean Viruses, Fungal Diseases, and Pests in Illinois Soybean Rust Sentinel Plots
After soybean rust, caused by Phakopsora pachyrhizi, was confirmed in the USA in 2004 in soybean (Glycine max) (4), sentinel plots were established in 2005 in 26 soybean-producing states to monitor its spread. Funding for establishing, sampling, and monitoring the plots came from the USDA, national, regional, and state soybean commodity boards, and state departments of agriculture, extension services, and universities. Sentinel plots were a minimum of 8 m × 16 m in size, planted as early as possible for a particular area, and represented either separate plots or marked areas in commercial fields that were monitored regularly by scouts primarily from state universities and extension services for soybean rust.. The presence of sentinel plots for soybean rust monitoring provided the potential for reducing the time and expense of extensive statewide travel for collection of soybean leaf samples for monitoring the incidence of other foliar diseases of soybean in Illinois. In many Midwestern states, ...
J Integr Plant Biol
In order to exploit the genetic resources of wild soybean (Glycine soja) which is the progenitor of cultivated soybean (Glycine max), the genic frequencies of Ti (coding trypsin inhibitors) and Sp1 (coding β-amylase isozymes) for 13 populations of wild soybean in Beijing region were determined. There are 2 alleles (Tia and Tib) in Ti locus of Beijing populations. Calculation of heterozygosity indicates Sp1 is polymorphic, while this monomorphic within a population. Based on the vatiation (from 0 to 50%) for heterozygosity of Sp1 among populations, with special reference to the values of genetic distances among populatious, and no heterozygote has been found in 1300 plants which would be heterozygotes if they were outbreeder, we suggested that wild soybean in natural populations is absolute inbreeder. The frequencies of Ti and Sp1 alleles vary from place to place extremely, however, no correlation exists between allozyme frequencies and ecological factors. Field investigation has shown that ...
Esterase polymorphisms for analysis of genetic diversity and structure of soybean (Glycine max) cultivars | GMR | Genetics and...
We used native polyacrylamide gel electrophoresis to identify polymorphism levels in a- and b-esterase loci from leaf tissues of Brazilian soybean cultivars for the analysis of population genetic diversity and structure, and to investigate relationships between conventional and genetically modified cultivars. The cultivars included lines developed by a soybean-grower cooperative (CD), by EMBRAPA (BR), and “Roundup Ready” (RR) cultivars. Esterase isozymes recorded with α-naphthyl acetate and β-naphthyl acetate were produced from 14 loci. Two to three allelic variants were detected in leaves from 420 plants of 21 CD, BR, and RR cultivars at Est-1, Est-2, Est-3, Est-5, and Est-14 loci. The estimated proportion of polymorphic loci in CD cultivars was 21.4%, and in BR and RR cultivars it was 28.6%. High and low HO and HE values were observed within CD and BR cultivars and a very high cultivar differentiation level was evident in the plants of the 21 CD, BR, and RR cultivars (FST = 0
Effects of Bacteria and Vermicompost on Morphological Characteristics and Yield of Soybean (Glycine max L.) in Sustainable...
Objective:Investigating the microbes and interactions of the beneficial symbiotic relationships between the components of the system ecology in the food chains and life cycles is one of the modern sustainable agriculture topics. In this regard, to evaluate the effects of bacteria and vermicompost on morphological characteristics and yield of soybean an experiment was conducted as split plot in a completely randomized block design with three replications. Methods: Main plots of experiment were at two levels including the non-use and the use of bacteria and the subplots were at three levels including the non-use of vermicompost (control), the use of 5 tons of vermicompost per acre and the use of 10 tons of vermicompost per acre. Results: The results of mean comparison showed that the treatment including 10 tons of vermicompost had the highest amount of oil content (11%) and the lowest amount was obtained from the treatment including use of 5 tons with the amount of 9.77%. Increasing the seed growing and
中国科学院地理科学与资源研究所机构知识库(IGSNRR OpenIR): Clustering Analysis of Soybean Production to Understand its Spatiotemporal Dynamics in the...
The production gap of soybean (Glycine maxL. Merr.) has been expanding in China recently, due to the increasing demand and decreasing production. Identifying soybean production dynamics is contributable to appropriate adjustment of crop rotation system and efficient use of agricultural resources-and thus to ensure food security. Taking the North China plain (NCP) as a case area, this study first analyzed the spatiotemporal dynamics of soybean production during 1998-2015 based on the spatial autocorrelation method, and then calculated contributions to the total production by yield and sown area using the factor decomposition method. The results indicated that total soybean production in the NCP decreased dramatically from 1998 to 2015 and showed a decreasing trend in 80.4% (263) of the counties, mainly (83.9%) contributed by the shrinkage of sown area, largely caused by decreasing benefit. Two regions were found with significantly spatial clustering degree of soybean production. In the south part ...
Data from: Fine mapping of the soybean aphid-resistance genes Rag6 and Rag3c from Glycine soja 85-32 | Ag Data Commons
Rag6 and Rag3c were delimited to a 49-kb interval on chromosome 8 and a 150-kb interval on chromosome 16, respectively. Structural variants in the exons of candidate genes were identified.. The soybean aphid, an invasive species, has significantly threatened soybean production in North America since 2000. Host-plant resistance is known as an ideal management strategy for aphids. Two novel aphid-resistance loci, Rag6 and Rag3c, from Glycine soja 85-32, were previously detected in a 10.5-cM interval on chromosome 8 and a 7.5-cM interval on chromosome 16, respectively. Defining the exact genomic position of these two genes is critical for improving the effectiveness of marker-assisted selection for aphid resistance and for identification of the functional genes. To pinpoint the locations of Rag6 and Rag3c, four populations segregating for Rag6 and Rag3c were used to fine map these two genes. The availability of the Illumina Infinium SoySNP50K/8K iSelect BeadChip, combined with single-nucleotide ...
A Fluorescence in Situ Hybridization System for Karyotyping Soybean | Genetics
The development of a universal soybean (Glycine max [L.] Merr.) cytogenetic map that associates classical genetic linkage groups, molecular linkage groups, and a sequence-based physical map with the karyotype has been impeded due to the soybean chromosomes themselves, which are small and morphologically homogeneous. To overcome this obstacle, we screened soybean repetitive DNA to develop a cocktail of fluorescent in situ hybridization (FISH) probes that could differentially label mitotic chromosomes in root tip preparations. We used genetically anchored BAC clones both to identify individual chromosomes in metaphase spreads and to complete a FISH-based karyotyping cocktail that permitted simultaneous identification of all 20 chromosome pairs. We applied these karyotyping tools to wild soybean, G. soja Sieb. and Zucc., which represents a large gene pool of potentially agronomically valuable traits. These studies led to the identification and characterization of a reciprocal chromosome ...
Evaluation of Soybean Aphid-resistant Soybean Lines by Michael T. McCarville, Matthew E. ONeal et al.
The soybean aphid, Aphis glycines (Hemiptera: Aphididae), is a consistent pest of soybean in Iowa. Current management is heavily reliant on the use of insecticides, which can be expensive and time consuming to apply. Soybean varieties resistant to the aphid are available. These varieties primarily include one resistance gene (Rag1) for soybean aphid control. Varieties incorporating two genes (Rag1 + Rag2) have recently become available. We sought to compare soybean lines susceptible to the soybean aphid with lines carrying a single resistance gene (Rag1 or Rag2) and a line carrying two resistance genes (Rag1 + Rag2). We evaluated the lines based on aphid control and yield protection.
Inheritance of resistance to the Soybean aphid in Soybean PI 200538 on Environmental XPRT
Article Inheritance of resistance to the Soybean aphid in Soybean PI 200538. The soybean aphid (Aphis glycines Matsumura) is a major soybean [Glycine max (L.) Merr.] insect pest. Soybean plant introduction (PI) 200538 has strong resistance to the aph...
Coupling Soybean Cyst Nematode Damage to CROPGRO-Soybean by J. Fallick, W. D. Batchelor et al.
The soybean cyst nematode (SCN) Heterodera glycines Ichinohe is responsible for substantial economic losses in soybean (Glycine max L. Merr.) production throughout the U.S. Results from past efforts to quantify the severity of crop damage resulting from SCN are often subject to variable experimental conditions resulting from differences in weather, soil type, and cultivar. Because of the difficulty in accounting for these variables, a process-oriented crop growth simulation model was chosen as a platform for studying the dynamics of SCN damage and for transferring knowledge between crop production scenarios. The objective of this study was to develop and evaluate hypotheses for coupling SCN damage to the process-oriented crop growth model CROPGRO-Soybean. A monomolecular function was used to relate daily SCN damage to initial population density of SCN eggs. The equation was incorporated into the crop model in order to test two hypotheses of how SCN damage occurs. The first hypothesis was that SCN reduce
soybean sesame soybean oil expeller iran trend in nigeria
Soybean Expeller, Soybean Expeller Suppliers There are 13,279 soybean expeller suppliers, mainly located in Asia. The top supplying countries or regions are China, India, and Turkey, which supply 92%, 7%, and 1% of soybean expeller respectively. Soybean expeller products are most popular in Africa, Domestic Market, and Southeast Asia.. soybean in iran, soybean in iran Suppliers and Manufacturers. Oilpress offers 206 soybean in iran products. About 0% of these are Soybeans, 2% are Soybean Oil, and 0% are Fish Meal. A wide variety of soybean in iran options are available to you, such as use, packaging, and cultivation type.. soybean sesame oil press production line sweden. soybean expeller pressing machine sweden Best Oil Expeller China Automatic Oil Screw Press Machine of 6yl Type for screw oil press machine seed oil press best selling heavy duty oil press machine screw oil Coconut Oil Expeller,Oil Expeller China Oil Press (6YL-80, 100) China Oil Press, Oil Expeller 6YL-68 Best Seller Factory ...
Histological investigation of the effect of soybean (Glycine max) extracts on the collagen layer and estrogen receptors in the...
OBJECTIVES: The purpose of this study was to analyze the effects of soybean extracts obtained using different extraction methods on the skin of female rats. ...
Year, region, and temperature effects on the quality of Minnesotas soybean crop<...
TY - JOUR. T1 - Year, region, and temperature effects on the quality of Minnesotas soybean crop. AU - Naeve, Seth L.. AU - Huerd, Sheri C.. PY - 2008/5/1. Y1 - 2008/5/1. N2 - Bulk commodity soybean [Glycine max (L.) Merr.] can now be sourced with great specificity through rail and container purchases. The objective of this study was to determine whether analyses of farmer-grown soybean seed samples could detect significant regional differences in soybean quality traits. Through analysis of 2706 farmer volunteered soybean samples representing harvests from 2003-2005, we found significant year and region effects on seed quality. An independent variable, temperature during seed filling (Tsf) was created for each soybean sample by kriging local daily mean air temperatures from 135 weather stations. A region x year interaction was noted for protein and the sum of protein and oil concentrations, but using Tsf as a covariate eliminated this interaction. The variable Tsf correlated with average ...
Global Soybean Phospholipid Enzyme Hydrolysate Market: By Key Players, Application, Type, Region and Forecast to 2022 -...
The Market.Biz research report on Soybean Phospholipid Enzyme Hydrolysate offers a detailed study of Soybean Phospholipid Enzyme Hydrolysate industry worldwide concentrating on key regions like North America, Europe, and Asia. Various factors which influence the growth of Soybean Phospholipid Enzyme Hydrolysate market has been covered at depth in this report. Initially, the report states the product definition, description, range of applications, supply and demand analysis of Soybean Phospholipid Enzyme Hydrolysate industry.. The major regions present in the continents like United States, Germany, Japan and China and their contribution to global Soybean Phospholipid Enzyme Hydrolysate market is elaborated in this research document. In next section, the report discusses industry policies and plans, cost structures, the outline of Soybean Phospholipid Enzyme Hydrolysate market globally, manufacturing processes. The growth rate exhibited by Soybean Phospholipid Enzyme Hydrolysate market based on ...
Evaluation of Soybean Genotypes for Resistance to Charcoal Rot
Identifying Soybean Genotypes with High Charcoal Rot Resistance. Experimental field plots. Field plots were established from 2006 to 2008 at the West Tennessee Research and Education Center at University of Tennessee in Jackson, TN. The soil was a Dexter fine-silty loam (mixed, active, thermicultic hapludalfs). Soybean genotypes in MG III through V including six plant introductions were selected based on their commercial use, high yield in state variety trials, and performance in breeding trials. A total of 149 soybean genotypes consisting of 27 MG III, 29 Early MG IV, 34 Late MG IV, and 59 MG V were evaluated for reaction to M. phaseolina infection. Seeds were treated with 0.8 ml/kg of mefenoxam + fludioxinal + molybeenum (Apron Maxx + Moly, Syngenta, Greensboro, NC) prior to planting. The experiments were conducted in the same area each year and genotypes were planted in four 6.1-m rows spaced 0.7 m using an Almaco 4-row cone planter (model #AJ4RP2, Almaco, Nevada, IA). Within each MG the ...
Master of Life | Rakuten Global Market: Black soybean diet black soybean soybean milk anthocyanin supplement supplement ◆ black...
Master of Life: Black soybean diet black soybean soybean milk anthocyanin supplement supplement ◆ black soybean 180 ◆ (for approximately three months) for business use [product] - Purchase now to accumulate reedemable points! | Rakuten Global Market
Master of Life | Rakuten Global Market: Black soybean diet black soybean soybean milk anthocyanin supplement supplement ◆ black...
Master of Life: Black soybean diet black soybean soybean milk anthocyanin supplement supplement ◆ black soybean 60 ◆ (for approximately one month) for business use [product] - Purchase now to accumulate reedemable points! | Rakuten Global Market
First Report of Sudden Death Syndrome of Soybean Caused by <i>Fusarium by A. D. Ziems, L. J. Giesler...
During August of 2004, soybean (Glycine max (L.) Merr.) plants exhibiting symptoms typical of sudden death syndrome (SDS) caused by Fusarium solani (Mart.) Sacc. f. sp. glycines (= Fusarium virguliforme Akoi, ODonnell, Homma, & Lattanzi) (1) were observed in Nemaha and Pierce counties in eastern Nebraska. Leaf symptoms ranged from small chlorotic spots to prominent interveinal necrosis on plants at R5-R6 growth stages. Taproots of symptomatic plants were plated on potato dextrose agar (PDA) amended with hymexazol, ampicillin, and rifampicin (HAR). Resulting fungal isolates grew slowly and developed masses of blue macroconidia, characteristic of F. solani f. sp. glycines. Sorghum seed infested with the isolates were placed 1.5 cm below soybean seeds of the susceptible cv. Sloan planted in clay pots (3). Noninfested sorghum seed and sorghum seed infested with F. oxysporum were controls.
Seed Dreams: BEAN, SOYBEAN Glycine max
All Seed Dreams seeds are grown the old-fashioned way without the use of pesticides or chemicals, and through the hard work and dedication of California farmer Shane Murphy, and Seed Curator and farmer at our Port Townsend farm, Tessa Gowans, as well as the time and love of generous volunteers ...
Flavonoid and Isoflavonoid Distribution in Developing Soybean Seedling Tissues and in Seed and Root Exudates | Plant Physiology
The distribution of flavonoids, isoflavonoids, and their conjugates in developing soybean (Glycine max L.) seedling organs and in root and seed exudates has been examined. Conjugates of the isoflavones daidzein and genistein are major metabolites in all embryonic organs within the dry seed and in seedling roots, hypocotyl, and cotyledon tissues at all times after germination. Primary leaf tissues undergo a programmed shift from isoflavonoid to flavonoid metabolism 3 days after germination and become largely predominated by glycosides of the flavonols kampferol, quercetin, and isorhamnetin by 5 days. Cotyledons contain relatively constant and very high levels of conjugates of both daidzein and genistein. Hypocotyl tissues contain a third unidentified compound, P19.3, also present in multiple conjugated forms. Conjugates of daidzein, genistein, and P19.3 are at their highest levels in the hypocotyl hook and fall off progressively down the hypocotyl. These isoflavones also undergo a programmed and ...
Soybean (Glycine max) PHYTOCHROME-INTERACTION FACTOR 1 induced skotomorphogenesis and de-etiolation in Arabidopsis
Canadian Journal of Plant Science contains research on plant science relevant to the environmental regions of Canadian agriculture.
Soybean (Glycine max)
TC218173 TC218173 AGCCGGCGAACGGAAGAGAGGAACCATTAAACCATGTTGAAGCAGAGAGACAGAGGAGGG AGAAGCTGAACCAGAGATTCTACGCGCTTCGTGCTGTGGTTCCCAACGTGTCAAAGATGG ACNNNGCGTCGCTTCTGGGCGACGCGATATCTTACATCACCGAGCTGAAGTCCAAGCTTC AGACCCTCGAATCTGATAAAGATGTATTGCATAAGCAGCTTGAAGGAGTGAAGAAGGAAC TCGAGAAAACAACTTATAACGTTTCTTCTAATCACGCGTGTAATAATAACAATAACAACA AGTTGTCGTCGAATCAGCCGGCGTTAATTGACTTGGTTGAGATGGACGTGAAGATCATTG GGTGGGACGCGATGATAACGATCACATGCAGCAAGAAGAACCACCCCGCGGCGACGTTGA TGACGGCATTGATGGAGTTGGACTTGGACGTGCACTACGCCACCGTAACGTTGGTCAACG ATTTGATGATCCAACAAGCAACGGTGAAGATGGGAAGTAGATTTTACACGCAGGAGCAGC TTCGAGCGGTGCTGTCGGCTAAGGTTGGGGATGTACGATGATGTTGGCACTTTGCGGCAG CGTTGAGATTATAAGTGTGTGTTTGTGTCATGTTATTAGCTAGCTATCTCTTTCTAAGTT GTGTGCTGCTCTGGGGTATTTTAAGCCTTCCCGGTAGCTGTTTCTGTAAAATTTTAAGAT TTTATTTTTCTTTATTGGGCAGCTTAGTATTGAATTTTGAGGTAATCAAGCTGGGAAGCT CCATGGAGTAGTAGTATAACTAGCTAGGGACAGTTTNAANNNAATCTGTGGTGGAGTGAA ATAGGGGTAATTTTATCTGTTTAGGTA ...
Study on the Optimum Control of Soybean Aphid
Based on the optimum control theory (1) , integrative effect of 11 controllable factors of soybean field on soybean aphid (Aphis glycines Matsumura), natural enemies and summer soybean yield was studied systematically by the approaching optimum point and Orthogonal design L27 (3)13 from 1993 to 1996. According to the criterion of not only good control of the pest and increase of soybean yield but also protection of natural enemies, the controllable factors were evaluated synthetically and optimum system control of soybean aphid was suggested as follows: soybean sown in the same maize hole (4 soybean plants to 1 maize plant) or soybean interplanted in maize field (9 rows of soybeans to 2 rows of maize), cultivar Lusoybean 4, sowing time about 10 June, dressing seeds with trace fertilizer at 1800 g/ha, dosage of fertilizer N, P2O5 and K2O application at 45, 60 and 150 kg/ha, dosage of solid manure application at 22500 kg/ha, control soybean aphid with Pirmicarb at 60 g/ha. The technologies of ...
TILLING to detect induced mutations in soybean
Abstract Background Soybean (Glycine max L. Merr.) is an important nitrogen-fixing crop that provides much of the worlds protein and oil. However, the available tools for investigation of soybean gene function are limited. Nevertheless, chemical mutagenesis can be applied to soybean followed by screening for mutations in a target of interest using a strategy known as Targeting Induced Local Lesions IN Genomes (TILLING). We have applied TILLING to four mutagenized soybean populations, three of which were treated with ethyl methanesulfonate (EMS) and one with N-nitroso-N-methylurea (NMU). Results We screened seven targets in each population and discovered a total of 116 induced mutations. The NMU-treated population and one EMS mutagenized population had similar mutation density (~1/140 kb), while another EMS population had a mutation density of ~1/250 kb. The remaining population had a mutation density of ~1/550 kb. Because of soybeans polyploid history, PCR amplification of multiple targets ...
Geographic distribution of soybean aphid biotypes in the United States and Canada during 2008-2010. - Agriculture and Agri-Food...
Soybean aphid (Aphis glycines Matsumura) is a native pest of soybean [Glycine max (L.) Merr.] in eastern Asia and was detected on soybeans in North America in 2000. In 2004, the soybean cultivar Dowling was described to be resistant to soybean aphids with the Rag1 gene for resistance. In 2006, a virulent biotype of soybean aphid in Ohio was reported to proliferate on soybeans with the Rag1 gene. The objective was to survey the occurrence of virulent aphid populations on soybean indicator lines across geographies and years. Nine soybean lines were identified on the basis of their degree of aphid resistance and their importance in breeding programs. Naturally occurring soybean aphid populations were collected in 10 states (Kansas, Illinois, Indiana, Iowa, Michigan, Minnesota, North Dakota, Ohio, South Dakota, and Wisconsin) and the Canadian province of Ontario. The reproductive capacity of field-collected soybean aphid populations was tested on soybean lines; growth rates were compared in ...
Using planting date to manage bean pod mottle virus in soybean
Summary:Delayed planting has been suggested to reduce density of the bean leaf beetle Cerotoma trifurcata (Förster), the principal vector of Bean pod mottle virus. Therefore, planting date was explored to determine if it might impact damage caused by the virus. Four planting dates, ranging from mid-March to mid-June, and two soybean Glycine max (L.) cultivars were examined for their effect on the relative damage caused by the virus in central Iowa for the years 2000-2002. Damage was assessed in terms of ...
The Development of an Efficient Multipurpose Bean Pod Mottle Virus Vir by Chunquan Zhang, Jeffrey Bradshaw et al.
Plant viral vectors are valuable tools for heterologous gene expression, and because of virus-induced gene silencing (VIGS), they also have important applications as reverse genetics tools for gene function studies. Viral vectors are especially useful for plants such as soybean (Glycine max) that are recalcitrant to transformation. Previously, two generations of bean pod mottle virus (BPMV; genus Comovirus) vectors have been developed for overexpressing and silencing genes in soybean. However, the design of the previous vectors imposes constraints that limit their utility. For example, VIGS target sequences must be expressed as fusion proteins in the same reading frame as the viral polyprotein. This requirement limits the design of VIGS target sequences to open reading frames. Furthermore, expression of multiple genes or simultaneous silencing of one gene and expression of another was not possible. To overcome these and other issues, a new BPMV-based vector system was developed to facilitate a variety
High-Fiber Soybean Products and Process for the Preparation Thereof - Patent application
0022]More specifically, the inventive process for preparing a whole soybean milk comprises the steps of mechanically milling feed soybeans, e.g., by a mill such as a crusher; micronizing the resulting crude-milled soybeans by a means selected from the group consisting of an enzymatic degradation reaction, mechanical micronization using a rotating micronizer, or a combination thereof; and homogenizing the resulting micronized milled soybean. Optionally, the crude-milled soybeans may be filtered to separate the initially generated soybean milk (first soybean milk) and a solid portion containing curd refuse and soybean peels; the micronization and homogenization of the solid portion is carried out to obtain a second batch of soybean milk (second soybean milk); and the second soybean milk is combined with the first soybean milk to obtain the whole soybean milk. In the optional process, the micronized solid portion may be combined with the first soybean milk, followed by homogenizing the resulting ...
A Phytophthora sojae Glycoside Hydrolase 12 Protein Is a Major Virulence Factor during Soybean Infection and Is Recognized as a...
We identified a glycoside hydrolase family 12 (GH12) protein, XEG1, produced by the soybean pathogen Phytophthora sojae that exhibits xyloglucanase and β-glucanase activity. It acts as an important virulence factor during P. sojae infection but also acts as a pathogen-associated molecular pattern (PAMP) in soybean (Glycine max) and solanaceous species, where it can trigger defense responses including cell death. GH12 proteins occur widely across microbial taxa, and many of these GH12 proteins induce cell death in Nicotiana benthamiana. The PAMP activity of XEG1 is independent of its xyloglucanase activity. XEG1 can induce plant defense responses in a BAK1-dependent manner. The perception of XEG1 occurs independently of the perception of ethylene-inducing xylanase. XEG1 is strongly induced in P. sojae within 30 min of infection of soybean and then slowly declines. Both silencing and overexpression of XEG1 in P. sojae severely reduced virulence. Many P. sojae RXLR effectors could suppress defense ...
Acidification and starch behaviour during co-fermentation of cassava (Manihot esculenta Crantz) and soybean (Glycine max Merr)...
Changes in acidification and starch behaviour were investigated during co-fermentation of cassava and soybean into gari, an African fermented product. Non-volatile acidity, pH and starch content were evaluated using standard analytical methods. Starch breakdown and pasting characteristics were also analysed using a Brabender viscoamylograph. Fermentation caused significant variations in the pH, non-volatile acidity and starch concentration. The pH decreased with concomitant increases in non-volatile acidity during co-fermentation of the cassava dough. Soy fortification up to 20% caused only minimal effects on the pH, titratable acidity and starch content during the fermentation period. Starch content decreased from 69.8% to 60.4% within the 48 h fermentation time in the unfortified sample, with similar trends noted at all levels of fortification. Starch pasting characteristics showed varied trends in pasting temperature, peak viscosity, viscosity at 95_C and at 50_C-hold with increasing ...
Dynamics of Soybean Rust Epidemics in Sequential Plantings of Soybean Cultivars in Nigeria
Soybean rust, caused by Phakopsora pachyrhizi, is an important foliar disease of soybean. Disease severity is dependent on several environmental factors, although the precise nature of most of these factors under field conditions is not known. To help understand the environmental factors that affect disease development, soybean rust epidemics were studied in Nigeria by sequentially planting an early-maturing, highly susceptible cultivar, TGx 1485-1D, and a late-maturing, moderately susceptible cultivar, TGx 1448-2E, at 30- to 45-day intervals from August 2004 to September 2006. Within each planting date, disease onset occurred earlier on TGx 1485-1D than on TGx 1448-2E, and rust onset was at least 20 days earlier on soybean planted between August and October than on soybean planted between November and April. The logistic model provided a better description of the temporal increase in rust severity than the Gompertz model. Based on the logistic model, the highest absolute rates of disease ...
soybean oil machine manufacurers in south african
South Africa Soybean Oil Press Machine, South African Soybean. Soybean and corn oil, provides healthy cooking oil to south african households. It contains the goodness of natural soybean in light and tasty edib.... Soya Oil , Manufacturers & Suppliers Johannesburg South. At Irwing Soya, we are the leading manufacturers and suppliers of soyabean oil in South Africa. As a result of our highly effective extraction process, our yield has the finest nutritional profile with a long shelf life that is well suited for a wide range of food manufacturing purposes.. Soybean Oil In Africa Wholesale, Soybean Suppliers. There are 1,496 soybean oil in africa suppliers, mainly located in Asia. The top supplying countries or regions are China, South Africa, and United Kingdom, which supply 60%, 35%, and 1% of soybean oil in africa respectively. Soybean oil in africa products are most popular in Africa, Southeast Asia, and Mid East.. South Africa Soybean Oil, South Africa Soybean Oil Manufacturers. South Africa ...
Bean pod mottle virus : Crop Diseases : University of Minnesota Extension
Bean pod mottle virus causes green to yellow mottling of young leaves. In severe infections, leaves may become distorted. Seeds from infected plants may be mottled or discolored, but other factors can also cause mottled seed. Symptoms may not be apparent at high temperatures or after pod set. Pod formation may be reduced when infected plants are under moisture stress. BPMV can interact with the soybean mosaic virus to create severe symptoms in plants infected by both viruses. BPMV may also be related to the development of green stem syndrome, in which plants retain green stems and leaves after pods and most nearby plants have matured.. ...
Role of insecticidal seed treatments and refuge for managing soybean aphid virulence | Graduate Education
Aphid-resistant soybean varieties with Rag (Resistance to Aphis glycines) genes are promising tools for the management of soybean aphid. Intriguingly, there are soybean aphid populations that can overcome such genetic resistance (i.e. virulent aphids) and cause yield losses. Previous research suggests refuge with aphid-susceptible soybean has the potential to control virulent aphid populations, but it is not clear whether it can reverse the proliferation of virulent aphid populations. Seed treatment has shown improvement of soybean aphid control on Rag soybean. To date, however, it is unknown whether refuge strategy and seed treatment combined could improve soybean aphid virulence management. Therefore we evaluated aphid virulence management by planting refuge soybean in a 1:3 aphid-susceptible:Rag-soybean ratio. Seed treatment was applied to either the aphid-susceptible and/or Rag-soybean. All soybean plants were infested with both avirulent (i.e. biotype 1) and virulent (i.e. biotype 4) ...
MINERAL PROFILE OF INFANT-FED COMPOSITE COMPLEMENTARY FOOD PREPARED FROM MIAZE (Zea mays), SOYBEAN (Glycine max) AND Moringa...
free project topics, download complete project material, hire a writer, research topics in nigeria, kenya, ghana, south africa, undergraduate, postgraduate, final year students, free research project, business administration topics, mass communication, accounting, computer science, economics, statistics, education
Malvick Provides Brief Review of Soybean Seedling Diseases | Department of Plant Pathology
Conditions are favorable for soybean seedling disease in many areas. Wet soil, slow emergence, and delayed planting have been favorable for seedling diseases in many areas of southern and central Minnesota. Learn more about soybean seedling diseases from Dean Malvick in Minnesota Crop News.
Isoliquiritigenin, a strong nod gene- and glyceollin resistance-inducing flavonoid from soybean root exudate. | Applied and...
Isoflavonoid signal molecules from soybean (Glycine max (L.) Merr.) seed and root exudate induce the transcription of nodulation (nod) genes in Bradyrhizobium japonicum. In this study, a new compound with symbiotic activity was isolated from soybean root exudate. The isolated 2,4,4-trihydroxychalcone (isoliquiritigenin) is characterized by its strong inducing activity for the nod genes of B. japonicum. These genes are already induced at concentrations 1 order of magnitude below those required of the previously described isoflavonoid inducers genistein and daidzein. Isoliquiritigenin is also a potent inducer of glyceollin resistance in B. japonicum, which renders this bacterium insensitive to potentially bactericidal concentrations of glyceollin, the phytoalexin of G. max. No chemotactic effect of isoliquiritigenin was observed. The highly efficient induction of nod genes and glyceollin resistance by isoliquiritigenin suggests the ecological significance of this compound, although it is not a ...
soybean oil price index
Thursday, as DTNs index of national cash soybean prices closed at $10.06 a bushel, I cant help but think about the old fable of The Dog and His … Amid several bearish concerns for soybeans in 2020, one bright spot is soybean oil. This page contains data on US Soybean Oil. Cofeed provides China soybean oil price today, soybean oil production, soybean oil import and export volume, soybean oil inventory and soybean oil futures price trend. Comprehensive information about the Bloomberg Soybean Oil index. FAO price indices for oilseeds, vegetable oils and oilmeals Last updated in November 2020. Soybean futures and options are an easy, liquid tool for speculating or hedging against price movements for one of the worlds most widely grown crops. More information can be found in other sections, such as historical data, charts and technical analysis. The total business generated in soybean oil category is 254294 USD last month. Palm oil prices rose about 2 1/2 percent (December contract +83 ringgit ...
Portfolio | JEECON FOODS PRIVATE LIMITED, INDIA
soya flour manufacturers , soya flour toasted , high protein soya flour , sonic biochem , soya flour for biscuits ,soya lecithin , soya chunks , soya granules , soya proteins , jeecon , soya flour supplier , soya flour wholesaler , soya flour distributor, soya tvp, soya meal exporters , rich soyabari , mahakali , prestige , vippy industries ...
Genome-wide transcriptional analysis of two soybean genotypes under dehydration and rehydration conditions | Read by QxMD
BACKGROUND: Soybean is an important crop that provides valuable proteins and oils for human use. Because soybean growth and development is extremely sensitive to water deficit, quality and crop yields are severely impacted by drought stress. In the face of limited water resources, drought-responsive genes are therefore of interest. Identification and analysis of dehydration- and rehydration-inducible differentially expressed genes (DEGs) would not only aid elucidation of molecular mechanisms of stress response, but also enable improvement of crop stress tolerance via gene transfer. Using Digital Gene Expression Tag profiling (DGE), a new technique based on Illumina sequencing, we analyzed expression profiles between two soybean genotypes to identify drought-responsive genes.. RESULTS: Two soybean genotypes - drought-tolerant Jindou21 and drought-sensitive Zhongdou33 - were subjected to dehydration and rehydration conditions. For analysis of DEGs under dehydration conditions, 20 cDNA libraries ...
Bean Pod Mottle Virus - WISCONSIN FIELD CROPS PATHOLOGY
Bean pod mottle virus (BPMV) is a virus disease spread primarily by the bean leaf beetle, Cerotoma trifurcata. Seed transmission is al
Soybean Cyst Nematode Field Guide
Soybean cyst nematode is the most economically significant pest of soybeans in Iowa and has been found in 98 of the 99 Iowa counties. Infested soybean plants often show no symptoms other than reduced yield. The 62-page field guide is designed as a resource for agronomists and farmers to manage soybean cyst nematode. ...
soybean lecithin soft gel - china soybean lecithin soft gel manufacturers and suppliers
soybean lecithin soft gel manufacturers soybean lecithin soft gel suppliers Directory - Browse soybean lecithin soft gel products,Choose Quality soybean lecithin soft gel manufacturers, suppliers, factory at B2BAGE
Soybean Cyst Nematode Management in 2013: Take the Test: Beat the Pest - Blogs - The Rolla Daily News - Rolla, MO - Rolla, MO
Here is the situation: Soybean cyst nematode (SCN) is the worst pest of soybeans in the U. S. A. including Missouri.Fortunately, this pest can be managed, but farmers must take steps before planting soybean this year to protect against soybean cyst nematode.The first step is to test the soil for SCN.
Soybean Cyst Nematode Management in 2013: Take the Test: Beat the Pest - Blogs - Moberly Monitor-Index - Moberly, MO - Moberly,...
Here is the situation: Soybean cyst nematode (SCN) is the worst pest of soybeans in the U. S. A. including Missouri.Fortunately, this pest can be managed, but farmers must take steps before planting soybean this year to protect against soybean cyst nematode.The first step is to test the soil for SCN.
Biological and molecular characterization of an isolate of Tobacco streak virus obtained from soybeans in Brazil
INTRODUCTION A recent outbreak of soybean [Glycine max (L.) Merril] bud blight in Wenscelau Braz County, State of Paraná, Brazil, may be an indication of the occurrence of a virus disease. The outbreak occurred in an area close to a region where the presence of Tobacco streak virus (TSV), family Bromoviridae, genus Ilarvirus, is historical. Preliminary evaluations using electron microscopy of infected leaves showed the presence of spherical particles. Additional studies proved that TSV was responsible for the problem. Although no resistance to this virus has been found in the soybean germplasm the disease has been controlled by delaying the sowing date (Almeida & Corso, 1991; Almeida et al., 1994). The TSV was identified in tobacco (Nicotiana tabaccum L.) plants in Brazil in 1940 (Costa, 1945), and it is currently known to infect several cash crops such as cotton (Gossypium hirsutum L.), tomato (Lycopersicon esculentum Mill.), tobacco (Nicotiana tabacum L.), soybean, peanut (Arachis hypogaea ...
Feeding Edible Beans and Soybeans to Cattle | Manitoba Agriculture | Province of Manitoba
Producers are currently reporting that this years soybeans are very immature and have a high level of sclerotinia. Reports indicate that very green samples (80-90% green) have a nutrient content similar to mature soybeans - about 41% crude protein and 18% fat. Due to the high fat content, the amount of soybeans in the diet needs to be limited to keep the total fat content in the ration to less than 5%. Higher levels of fat can decrease fibre digestion in the rumen. In dairy diets, raw soybeans should be limited to about 4 lbs/day. Roasting soybeans increases the bypass value of the protein and decreases anti-nutritional factors. Roasted soybeans can be fed to dairy cows at a higher rate - up to 6 lbs/day. Raw soybeans can be fed to beef cattle at 10 % of the diet - approximately 1.5 lbs/day for 600 lb growing cattle and 3 lbs/day for bred cows. Soybeans can be fed whole or just broken into halves or quarters. Avoid fine grinding. Sclerotinia is not associated with health problems in cattle ...
Genomic insights into plant growth promoting rhizobia capable of enhancing soybean germination under drought stress | BMC...
The role of soil microorganisms in plant growth, nutrient utilization, drought tolerance as well as biocontrol activity cannot be over-emphasized, especially in this era when food crisis is a global challenge. This research was therefore designed to gain genomic insights into plant growth promoting (PGP) Rhizobium species capable of enhancing soybean (Glycine max L.) seeds germination under drought condition. Rhizobium sp. strain R1, Rhizobium tropici strain R2, Rhizobium cellulosilyticum strain R3, Rhizobium taibaishanense strain R4 and Ensifer meliloti strain R5 were found to possess the entire PGP traits tested. Specifically, these rhizobial strains were able to solubilize phosphate, produce exopolysaccharide (EPS), 1-aminocyclopropane-1-carboxylate (ACC), siderophore and indole-acetic-acid (IAA). These strains also survived and grew at a temperature of 45 °C and in an acidic condition with a pH 4. Consequently, all the Rhizobium strains enhanced the germination of soybean seeds (PAN 1532 R) under
Longan Professional Soybean Oil Processing Plant
Soybean Oil Production LineSoyoil Solvent Extracting Plant Professional Soybean Oil Manufacturing Process oilmillplant Oil Mill Plant Manufacture with Soybean YouTube Professional Process of Soybean Oil Production Oil mill Professional Soybean Oil Extraction Process oilmillplant High Quality Factory Price Professional Soybean Oil 12 Best Cooking oil refining machine images in 2019 56 Best Palm oil processing machine images Palm fruit oil Soybean Processing Crown Iron Works Successfully Installed Soybean Oil Processing Plant in Nigeria Cooking oil Manufacturers Suppliers, China cooking oil How to set up a soybean oil making factory in the United States Watersaving technologies AOCS ALSO INSIDE: 3MCPD in modified oils Biobased AOCS A Prophecy Misread That Could Have Been: Regulatory MANUFACTURING Staley Museum
Fungicide Efficacy for Control of Soybean Seedling Diseases
This publication contains information about how well fungicide seed treatments control soybean seedling diseases in the United States. Information was developed by members of the North Central Regional Committee on Soybean Diseases (NCERA-137). This publication was created by the Crop Protection Network, which includes authors from Land Grant universities across the North Central Region and Ontario. CSI ...
Marker Development for Marker Assisted Breeding of Resistance to Phytophthora sojae in Soybean
One of the most destructive diseases of soybean is Phytophthora root and stem rot, caused by the oomycete pathogen Phytophthora sojae, which thrives in wet conditions and poorly drained soils. This disease can cause major damage to soybean yields resulting in economic losses. P. sojae has been successfully controlled by genetic resistance in soybean cultivars. Breeding for this resistance is critical to Ohio agriculture and business because of soybeans importance as an export, animal feed, and industrial product. Current methods for breeding for resistance to P. sojae involve time-consuming disease assays requiring a relatively large number of seed. Alternatively, molecular markers can be efficiently applied to an earlier generation of a single plant from large numbers of breeding lines. In addition, molecular markers can be used for the combination of multiple resistance genes that will provide a full spectrum of resistance against virulent P. sojae strains. Designing these markers begin with ...
Leci Impex - sunrise soya lecithin Manufacturer from Indore India
Send Inquiry to Leci Impex - We are leading Manufacturer of sunrise soya lecithin, soya lecithin ink grade, industrial grade lecithin, sunrise soya lecithin oil, Soya Lecithin Feed Grade from Indore Madhya Pradesh India.
CN202340740U - Automatic soybean milk boiling device - Google Patents
An automatic soybean milk boiling device comprises an electric heating bottle and a filtering screen structure. The electric heating bottle is provided with a bottle body capable of containing a quantitative amount of water. A heating controller is arranged on the bottle body. The filtering screen structure is provided with a filtering screen drum, a quantitative amount of smashed soybean can be loaded in the filtering screen drum, and the filtering screen structure is arranged in the bottle body. When a soybean milk boiling function is operated, a heating mode preset for the crashed soybean and water in the bottle body can be conducted through the heating controller. The heating mode is mainly used for controlling temperature and time for heating the smashed soybean and water so as to remove trypsin of the soybean milk and avoid phenomena that soybean milk foam overflows or the soybean milk is overheated to be burned and the soybean milk has burnt flavor.
Industrial Soya Lecithin Manufacturers, Suppliers & Exporters in India
Search Indian Industrial Soya Lecithin Manufacturers and Suppliers Details - Contact to Industrial Soya Lecithin Exporters in India, Industrial Soya Lecithin Wholesalers, Industrial Soya Lecithin Distributors and Traders from India.
Publication : USDA ARS
Citation: Qi, M., Link, T.I., Muller, M., Hirschburger, D., Pedley, K.F., Braun, E., Voegele, R.T., Baum, T., Whitham, S.A. 2016. A small cysteine-rich protein from the Asian soybean rust fungus, Phakopsora pachyrhizi, suppresses plant immunity. PLoS Pathogens. 12(9): e1005827. doi:10.1371/journal.ppat.1005827. Interpretive Summary: The Asian soybean rust fungus, Phakopsora pachyrhizi, is an obligate pathogen capable of causing explosive disease epidemics that drastically reduce the yield of soybean. Currently, the mechanisms by which P. pachyrhizi and other related fungi cause disease are poorly understood. The genome sequences and other data obtained from these fungi indicate that a variety of small proteins play essential roles that enable them to cause disease. These proteins, called effectors, are released by the pathogen and interfere with a plants ability to fight the disease. Here, we identify an effector protein produced by P. pachyrhizi and demonstrate that it is capable of ...
Think genetically modified soybean oil is healthy? Scientists have bad news for you
Cooking oils and their health properties have long since been a topic of debate for scientists all over the world. With numerous varieties of oils in the markets, it doesnt come as a surprise that the diet conscious get confused and argue about which oil is healthier.
Soybean oil and genetically modified (GM) soybean oil are two such products whose health properties are highly debated, with the latter often getting the upper hand.
However, a study has now busted the myth that GM soybean oil is healthier than normal soybean oil, warning that its harmful to liver function.
According to University Of California Riverside researchers, while soybean oil induces less obesity and insulin resistance than soybean oil, but its effects on
diabetes and fatty liver are similar to those of soybean oil.
The team tested Plenish®, a genetically-modified (GM) soybean oil released by DuPont in 2014.
Plenish is engineered to have low linoleic acid, resulting in an oil similar in composition to olive oil, the
best price profession soybean oil press machine ethiopia small | Soybean Oil Extraction Machine | China Manufacturer
ethiopia machines for soybean oil extraction | edible oilethiopia best buy soybean oil closed loop extractor. High quality soybean oil processing machine, soybean oil. Soybean oil press machine in soybean oil processing plant. Soybean oil solvent extraction plant: Solvent extraction is to use N-hexane to extract the oil from the processed oil seeds or cakes.Good […]
Manufacturer, supplier of Complete set of soybean oil making machine, factory price for sale, low investment cost Soybean oil...
Complete set of soybean oil making machine for sale, Soybean oil making machine is the main machine to produce soybean oil.The full set of soybean oil making machine mainly includes: soybean oil pretreatment machine, soybean oil extraction machine and soybean oil refinery plant.
Agronomy Journal Abstract - Effect of the Hydrogenase System in Rhizobium japonicum on the Nitrogen Fixation and Growth of...
The process of N fixation is energy consuming and inefficient. In most cases 20 to 40% of the energy that is supplied to nitrogenase for the reduction of N2 is utilized for the reduction of protons to H2. Some strains of R. japonicum contain a membrane-bound hydrogenase that is capable of oxidizing all of the H2 that is produced during N2 fixation. This study was conducted to evaluate the effects of inoculation of soybeans [Glycine max (L.) Merr.] with Rhizobium japonicum containing H2 recycling capability on N fixation efficiency and soybean yield at various physiological stages of growth.. In these experiments, a H2-oxidizing strain SR (Hup+) and SR3 (Hup−), a mutant derived from SR which is unable to oxidize H2, were utilized. Soybeans cv. Wilkin were grown under bacteriological conditions utilizing a drip-irrigated nutriculture system. Nodules from plants inoculated with SR evolved no measurable amount of H2, while nodules from plants innoculated with SR3 evolved between 2.7 and 10 ...
HM09-W150; Glycine max; Soybean | Corporate Engagement Office, The Ohio State University
HM09-W150 is a type of Soybean (Glycine Max), released by The Ohio State University in late April of 2015. It has a relative maturity of 3.0.
South Carolina Soybeans
The South Carolina Soybean Board (SCSB) collects checkoff dollars when soybean farmers sell their soybeans. Each farmer contributes to the soy checkoff one-half of 1 percent of the price of each bushel at the first point of sale. These funds are used for research, promotional and educational interests as they pertain to soybeans and the soybean industry. The volunteer directors decide how to invest the funds of the soybean checkoff. Half of the soybean checkoff funds are kept in the state where they originated and the other half goes to the United Soybean Board (USB) to invest in projects at the national level.. The SCSB is dedicated to using the checkoff dollars we receive from you each year to keep your operation growing forward. As we move into each year, we conduct in-depth research on the latest cutting-edge technology that can be used to benefit you, the farmer. Checkoff programs allow us to further strengthen the industry in which we work. Year after year, your checkoff dollars are ...
Nebraska Soybeans: Is Nitrogen Limiting High Yields? - AgFax
Soybean response to N is, however, more likely to occur in high-yielding environments (, 80 bu/ac) and in certain conditions such as soil pH , 5.5, organic matter , 1.5 %, or poor nodulation.. When it comes to applications of compost, manure and other specialty products (micronutrients, foliar products, etc.), more research is needed to identify specific environmental conditions and soybean varieties where those applications might be warranted.. Soil pH was found to be the main factor influencing soybean yield and grain protein content. Significant decline in soybean yield and grain protein was observed at pH , 7.5., which is outside the optimal soil pH range (5.5-7.0) for soybean nutrient uptake and biological N-fixation.. Recent advances in on-the-go field mapping for various soil properties and areal/satellite imagery can help farmers identify areas of the field with high soil pH and treat them as site-specific zones.. Improving soybean management when soil is calcareous with pH , 7.5, ...
Guidance for insecticide rotations for pyrethroid-resistant soybean aphid
As folks consider spraying fields for soybean aphid, we want to remind everyone that soybean aphid has developed resistance to pyrethroid (Group 3A) insecticides. Currently, any populations of soybean aphid in Minnesota should be considered potentially resistant to pyrethroids. Insecticide rotations are an important part of insecticide resistance management and may help reduce the chances of further development of insecticide resistance in soybean aphid. If a field needs to be sprayed more than once, it is important to rotate to a different insecticide group for the follow-up spray. On a new webpage, we provide some guidance for insecticide rotations for pyrethroid-resistant soybean aphid ...
Soybean Aphid Update
Since the most recent issue (No. 17, July 18, 2003) of the Bulletin was printed and mailed, there has been considerable telephone and e-mail traffic regarding soybean aphids in northern Illinois. We have received numerous reports regarding insecticide applications to control the aphids in soybean fields. Although some fields still do not have densities of aphids large enough to warrant control, the densities in a fairly large number of fields have exceeded economic thresholds. In addition, some people are finding very few natural enemies in some fields, so aphid population densities have increased rapidly.. Drs. David Voegtlin (Illinois Natural History Survey) and David Onstad (Department of Natural Resources and Environmental Sciences) recently visited several soybean fields in Kendall County. They have studying soybean aphid populations there since 2001. In fact, one of the first fields of soybeans Dave Voegtlin visited in 2000 was in Kendall County. They have provided an overview of the ...