FSAP (Factor VII-activating protease) is a novel plasma-derived serine protease that regulates haemostasis as well as vascular cell proliferation. FSAP undergoes autoactivation in the presence of polyanionic macromolecules such as heparin and RNA. Competition experiments suggest that RNA and heparin bind to the same or overlapping interaction sites. A proteolysis approach, where FSAP was hydrolysed into smaller fragments, was used to identify the polyanion-binding site. The EGF (epidermal growth factor)-like domains EGF2 and EGF3 of FSAP are the major interaction domains for RNA. The amino acids Arg170, Arg171, Ser172 and Lys173 within the EGF3 domain were essential for this binding. This is also the region with the highest positive net charge in the protein and is most probably located in an exposed loop. It is also highly conserved across five species. Disruption of disulphide bridges led to the loss of RNA and heparin binding, indicating that the three-dimensional structure of the EGF3 domain ...
Our data also support a role for the E(zip) genes in RhoA signaling. By genetic analyses three of the E(zip) mutants encode known components of the RhoA signaling pathway (RhoGEF211-3, RhoA12-6, and zip33-1). All E(zip) mutations are strongly interactive with RhoA and, with the exception of 31-6, which is a semilethal mutation, exhibit moderate-to-strong interactions with zipEbr (Table 10). However, our interaction data suggest that the unidentified 12-5, 18-5, and 31-6 genes may not act in the same pathway as Sb-sbd during leg morphogenesis. First, weak interactions are observed between the 12-5, 18-5, and 31-6 mutants and RhoA pathway members such as DRhoGEF2, drok, and Df(2R)Jp1. In contrast Sb-sbd mutants exhibit robust interactions with drok and Df(2R)Jp1. Second, while interactions between E(zip) and Sb-sbd mutants are robust (all moderate), they are not as strong as those observed between Sb-sbd and the RhoA signaling pathway. Additional mutants and characterization of the gene products ...
The prolyl oligopeptidase family, which is a group of serine peptidases, can hydrolyze peptides smaller than 30 residues. The prolyl oligopeptidase family in plants includes four members, which are prolyl oligopeptidase (POP, EC3.4.21.26), dipeptidyl peptidase IV (DPPIV, EC3.4.14.5), oligopeptidase B (OPB, EC3.4.21.83), and acylaminoacyl peptidase (ACPH, EC3.4.19.1). POP is found in human and rat, and plays important roles in multiple biological processes, such as protein secretion, maturation and degradation of peptide hormones, and neuropathies, signal transduction and memory and learning. However, the function of POP is unclear in plants. In order to study POP function in plants, we cloned the cDNA of the OsPOP5 gene from rice by nested-PCR. Sequence analysis showed that the cDNA encodes a protein of 596 amino acid residues with Mw ≈ 67.29 kD. In order to analyze the protein function under different abiotic stresses, OsPOP5 was expressed in Escherichia coli. OsPOP5 protein enhanced the
Hepcidin is a liver-derived hormone with a key role in iron homeostasis. In addition to iron, it is regulated by inflammation and hypoxia, although mechanisms of hypoxic regulation remain unclear. In hepatocytes, hepcidin is induced by bone morphogenetic proteins (BMPs) through a receptor complex requiring hemojuvelin (HJV) as a co-receptor. Type II transmembrane serine proteinase (TMPRSS6) antagonizes hepcidin induction by BMPs by cleaving HJV from the cell membrane. Inactivating mutations in TMPRSS6 lead to elevated hepcidin levels and consequent iron deficiency anemia. Here we demonstrate that TMPRSS6 is up-regulated in hepatic cell lines by hypoxia and by other activators of hypoxia-inducible factor (HIF). We show that TMPRSS6 expression is regulated by both HIF-1α and HIF-2α. This HIF-dependent up-regulation of TMPRSS6 increases membrane HJV shedding and decreases hepcidin promoter responsiveness to BMP signaling in hepatocytes. Our results reveal a potential role for TMPRSS6 in hepcidin
Airway Trypsin-like Protease/HAT/TMPRSS11D Lysates available through Novus Biologicals. Browse our Airway Trypsin-like Protease/HAT/TMPRSS11D Lysate catalog backed by our Guarantee+.
Nucleosomes may be released during cell death but may also derive from NETs that are released from neutrophils.17 It was previously demonstrated that NETs are cytotoxic when added to human alveolar epithelial cells and that histones, and not DNA, mediate the observed cytotoxic effects.18 Strikingly, anti-histone antibodies only partly neutralized the cytotoxicity of NETs, presumably because other proteins in NETs also conferred cytotoxicity. Instead, in a study by Kumar et al,48 the cytotoxicity of NETs was completely inhibited by an anti-histone antibody. The size of the chromatin fragments, presence of antimicrobial proteins, and different histone modifications that modulate chromatin condensation, and thus histone exposure, may have influenced NET cytotoxicity. Because injection of anti-histone antibodies had beneficial effects in mouse and baboon sepsis,11,49 and our results suggest that histones circulate as nucleosomes that are not cytotoxic in vitro, other mechanisms must be involved in ...
Identification of the molecular nature of the barrier is still under investigation, with the consensus that a protein lipid layer, which is located in the top layers of the epidermis and TJs, plays an essential role in development of the skin barrier function (Tsuruta et al., 2002). Evidence that cornified envelope assembly is necessary for barrier development in skin is obtained from the study of transglutaminase 1-deficient mice that lack confirmed envelopes. These mice suffer from water loss, resulting in neonatal lethality (Matsuki et al., 1998). Alterations of corneocyte morphology have also been described in various mouse models with epidermal permeability barrier defects ranging from near absence in transglutaminase 1-deficient mice (Matsuki et al., 1998) to irregular shaped corneocytes (e.g., Klf4−/− mice; Segre et al., 1999). Our corneocyte phenotype mostly resembled that of matriptase/MT-SP1-deficient mice, a member of the type II transmembrane serine protease family (List et al., ...
A series of substrate analogue inhibitors of the serine protease HAT, containing a 4-amidinobenzylamide moiety as the P1 residue, was prepared. The most potent compounds possess a basic amino acid in the d-configuration as P3 residue. Whereas inhibitor 4 (K(i) 13 nM) containing proline as the P2 residue completely lacks selectivity, incorporation of norvaline leads to a potent inhibitor (15, K(i) 15 nM) with improved selectivity for HAT in comparison to the coagulation proteases thrombin and factor Xa or the fibrinolytic plasmin. Selected inhibitors were able to suppress influenza virus replication in a HAT-expressing MDCK cell model.
1GBF: ALPHA-LYTIC PROTEASE WITH MET 190 REPLACED BY ALA AND GLY 216 REPLACED BY LEU COMPLEX WITH METHOXYSUCCINYL-ALA-ALA-PRO-ALANINE BORONIC ACID
Campylobacter jejuni has emerged as a leading cause of bacterial enterocolitis. The serine protease HtrA has been shown to be a pivotal, novel C. jejuni virulence factor involved in cell invasion and transmigration across polarised epithelial cells in vitro. However, the functional relevance of the htrA gene for the interaction of C. jejuni with the host immune system in the infant mouse infection model has not been investigated so far. Here we studied the role of C. jejuni htrA during infection of 3-weeks-old infant mice. Immediately after weaning, conventional wild-type mice were perorally infected with the NCTC11168∆htrA mutant (∆htrA) or the parental wild-type strain. Approximately one third of infected infant mice suffered from bloody diarrhea until day 7 post infection (p.i.), whereas colonic histopathological changes were rather moderate but comparable between the two strains. Interestingly, parental, but not ∆htrA mutant infected mice, displayed a multifold increase of apoptotic cells in
Purpose : Recent studies have shown a strong association between the serine protease HtrA1 and age-related macular degeneration (AMD). Increased HtrA1 expression in retinal pigment epithelium (RPE) has been shown to cause extracellular matrix degradation and destabilization of the Bruchs membrane. However, little is known about functional effects of HtrA1 overexpression on RPE. To investigate these effects we established an in vitro model of polarized RPE overexpressing HtrA1 where phagocytic activity, a key function of RPE, could be assessed. Methods : Human fetal RPE cells cultured on laminin-coated transwell membranes were infected either with the wild type HtrA1- or the HtrA1 Serine-Alanine mutation (S328A)-GFP IRES construct two weeks after seeding. After five weeks of growth in vitro phagocytosis assay was performed. Thereby, cells were incubated with CY5-labelled photoreceptor outer segments (POS) isolated from porcine retinas for six hours. POS internalization was observed by live cell ...
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates blood volume and pressure. This protein may also function as a pro-brain-type natriuretic peptide convertase. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013 ...
TMPRSS4 is a novel type II transmembrane serine protease that is highly expressed on the cell surface in pancreatic, thyroid and other cancer tissues, although its oncogenic significance and molecular mechanisms are unknown. Previously, we have shown that TMPRSS4 promotes invasion, migration and metastasis of human tumor cells by facilitating an epithelial-mesenchymal transition (EMT). In this study, we explored the molecular basis underlying TMPRSS4-mediated effects. We show that multiple downstream signaling pathways, including focal adhesion kinase (FAK), extracellular signal-regulated kinase (ERK), Akt, Src and Rac1, are activated by TMPRSS4 expression and that FAK signaling and ERK activation are required for TMPRSS4-induced invasiveness and EMT, including cadherin switch. Inhibition of PI3K or Src reduced invasiveness and actin rearrangement mediated by TMPRSS4 without restoring E-cadherin expression. Downregulation of E-cadherin was required for TMPRSS4-mediated effects but was not ...
In our study, using mice with LKB1-deficient mammary glands, we found evidence that basement membrane may be degraded by type II transmembrane serine proteases (TTSPs) during mammary tumorigenesis [32]. We reported that loss of LKB1 does not induce palpable tumours during the lifetime of the mice but leads to mild abnormalities in the mammary gland, such as hyperbranching, partial disorganization of apical polarity and incomplete basement membrane. However, combining LKB1 deficiency with oncogenic MYC dramatically accelerates the appearance of mammary tumours in comparison with glands exposed to oncogenic MYC alone [32]. The study shows that both MYC+ and MYC+;LKB1− tumours are histopathologically mostly adenocarcinomas and not informative as such regarding the possible mechanisms underlying accelerated tumorigenesis. However, the histology of hyperplastic regions in between tumour areas was particularly interesting, providing a path for follow-up studies. Expression of oncogenic MYC alone, a ...
Protein HtrA2, also known as Omi, is a mitochondrially-located serine protease. The human protein Serine protease HTRA2, mitochondrial is 49kDa in size and composed of 458 amino acids. The peptide fragment of 1-31 amino acid is the mitochondrial transition sequence, fragment 32-133 amino acid is propertied, and 134-458 is the mature protein Serine protease HTRA2, mitochondrial, and its theoretical pI of this protein is 6.12.[10] HtrA2 shows similarities with DegS, a bacterial protease present in the periplasm of gram-negative bacteria. Structurally, HtrA2 is a trimeric molecule with central protease domains and a carboxy-terminal PDZ domain, which is characteristic of the HtrA family. The PDZ domain preferentially binds C-terminus of the protein substrate and modulate the proteolytic activity of the trypsin-like protease domain.[11] ...
BioAssay record AID 210651 submitted by ChEMBL: In vitro inhibitory concentration required to inhibit human serine protease enzyme thrombin (FIIa) by 50%.
1GBH: Kinetic and structural characterization of mutations of glycine 216 in alpha-lytic protease: a new target for engineering substrate specificity.
The typeNII transmembrane serine protease matriptase plays an important role in the integrity of epithelial barriers. However, the molecular mechanisms underlying the role of matriptase are unknown. To study these mechanisms, two variants of MadinNDarby canine kidney (MDCK) cells were used, together with the "calciumNswitch" model of epithelial function with measurements of transepithelial electrical resistance (TEER). Inhibitors of matriptase proteolytic activity delayed the restoration of TEER after calciumNswitch in MDCKNI, which develop high TEER and lack the "leaky" tight junction protein claudinN2, but not MDCKNII. This effect was confirmed in MDCKNI, established to stably express matriptase targeted shRNA. The influence of matriptase inhibition on MDCKNI was shown not to involve altered expression or assembly of relevant components of paracelluar junctions or cytoskeleton. This excluded a role for claudinN2 in the function of matriptase, which had previously been shown in human CacoN2 ...
Serine protease with a variety of targets, including extracellular matrix proteins such as fibronectin. HTRA1-generated fibronectin fragments further induce synovial cells to up-regulate MMP1 and MMP3 production. May also degrade proteoglycans, such as aggrecan, decorin and fibromodulin. Through cleavage of proteoglycans, may release soluble FGF-glycosaminoglycan complexes that promote the range and intensity of FGF signals in the extracellular space. Regulates the availability of insulin-like growth factors (IGFs) by cleaving IGF-binding proteins. Inhibits signaling mediated by TGF-beta family members. This activity requires the integrity of the catalytic site, although it is unclear whether TGF-beta proteins are themselves degraded. By acting on TGF-beta signaling, may regulate many physiological processes, including retinal angiogenesis and neuronal survival and maturation during development. Intracellularly, degrades TSC2, leading to the activation of TSC2 downstream targets ...
... are involved in many aspects of biology from embryonic development to cancer metastasis. For many of these proteases, the cell biology, physiological function and role in disease remain to be defined. The symposium will include sessions to cover topics from cell biology, structure, regulation and roles in health and disease.. ...
The high temperature requirement A1 (HTRA1) is a potent protease involved in many diseases, including rheumatoid arthritis (RA). However, the regulatory mechanisms that control HTRA1 expression need to be determined. In this study, we demonstrated that IFN-γ significantly inhibited the basal and LPS-induced HTRA1 expression in fibroblasts and macrophages, which are two major cells for HTRA1 production in RA. Importantly, the inhibitory effect of IFN-γ on HTRA1 expression was evidenced in collagen-induced arthritis (CIA) mouse models and in human RA synovial cells. In parallel with the enhanced CIA incidence and pathological changes in IFN-γ-deficient mice, HTRA1 expression in the joint tissues was also increased as determined by real-time PCR and Western blots. IFN-γ deficiency increased the incidence of CIA and the pathological severity in mice. Neutralization of HTRA1 by Ab significantly reversed the enhanced CIA frequency and severity in IFN-γ-deficient mice. Mechanistically, IFN-γ ...
Ynm3 is the only budding yeast protein possessing a combination of a serine protease and PDZ domains, a defining feature of the widely conserved HtrA (high temperature requirement A) protein family. The bacterial HtrA/DegP is involved in protective stress response to aid survival at higher temperatures by cleaving irreversibly unfolded proteins in the periplasm. At ambient growth temperatures, it acts as a chaperone and aids maturation of outer membrane proteins that have escaped folding mediated by the primary periplasmic chaperone SurA. Studies involving overexpression of mammalian mitochondrial HtrA2/Omi in cell culture propose a proapoptotic role for the protein. Mice lacking HtrA2/Omi or its protease activity, however, show no evidence of reduced rate of cell death. Instead, these mice suffer loss of a population of neurons in the striatum leading to a Parkinsonian phenotype. Two mutations in the gene encoding human HtrA2/Omi, leading to partial loss of protease activity have been ...
Pneumonia is one of the commonest causes of death worldwide. High‑temperature requirement A2 (HtrA2) is a proapoptotic mitochondrial serine protease involved in caspase‑dependent or caspase‑independent cell apoptosis. UCF‑101 (5‑[5‑(2‑nitrophenyl) furfuryl iodine]‑1,3‑diphenyl‑2‑thiobarbituric acid), an inhibitor of HtrA2, has a protective effect on organs in various diseases by inhibiting cell apoptosis. The aim of the present study was to explore whether UCF‑101 has a protective effect on lungs in pneumonia. A lipopolysaccharide (LPS)‑induced pneumonia model was established in rats. UCF‑101 (2 µmol/kg) was used for treatment. Lung injury was detected by hematoxylin and eosin staining. Pro‑inflammatory cytokines and oxidative stress‑related factors were detected using corresponding test kits. TUNEL staining was used to measure the amount of cell apoptosis. Apoptosis‑associated proteins were detected by western blot assay. The present study indicated pulmonary ...
High temperature requirement A (HtrA) is a widely expressed chaperone and serine protease in bacteria. HtrA proteases assemble and hydrolyze misfolded proteins to enhance bacterial survival under stress condit......
BCX 1470 is a serine protease inhibitor with the IC50 of 96 nM for factor D and 1.6 nM for C1s. Serine proteases are enzymes that cleave peptide bonds in proteins which are found ubiquitously in both eukaryotes and prokaryotes and serine serves as the nucleophilic amino acid at the active site. According to structure, serine proteases are divided into trypsin-like (chymotrypsin-like) family and subtilisin-like family. It is reported that serine proteases play an important role in various physiological functions, including digestion, immune response, blood coagulation and reproduction. BCX 1470 is a potent serine protease inhibitor and functions on the complement enzymes CIs and factor D sites. By determining the ability of enzyme to hydrolyze appropriate synthetic substrates, the result showed that BCX 1470 inhibited the factor D and C1s esterolytic activity which were important in the function of serine protease. In induced dermal RPA reaction rat model, administration of BCX 1470 markedly ...
TYTU : Changes in expression of serine proteases HtrA1 and HtrA2 during estrogen-induced oxidative stress and nephrocarcinogenesis in male Syrian hamster ...
VHT Copper Gasket Cement has been formulated with the same ingredients as our world-renowned high temperature coatings. VHT Copper Gasket Cement maintains excellent adhesion under severe pressure and heat fluctuations. This high-metallic formula assures tight seals on cork, paper and metal gaskets. VHT Copper Gasket Cement has been extensively tested on racing engines in the field and on dynamometers, where it has met and exceeded the high-compression and high temperature requirements of these mega horsepower engines.. Applications:Head Gaskets, Rubber Hoses, Cork Gaskets, Water Pump Gaskets, Threaded Fittings, AN Fittings, Paper Gaskets, Oil Pan Gaskets, Metal Gaskets ...
The mechanism of a single gene giving rise to greater than one mRNA transcript is referred to as differential splicing. This system is often tightly regulated in a cell-type or developmental stage-specific manner and increases genome complexity by generating different proteins from the same mRNA. The presence of more than one mRNA form for the same gene is common among kallikreins. These variant mRNAs may result from alternative splicing, a retained intronic segment, or use of an alternative.... ...
I think the work by Agard on alpha-lytic protease suggests something , ,like this. , , Isnt that the protein whose folding is catalysed by a part of itself, , the Pro-region? If this is true, then that does not argue against my , statement. I think that the fold, that the protein adopts, is the , global minimum of the molecule _with_ its Pro-region. After the , Pro-region is cleaved, the global minimum is elswhere in the fold , space, but it is kinetically inaccessible. Thus, the native protein , does not adopt its global minimum, but it *folds*to* the global , minimum. From the point of view of someone who wants to do something , with this protein, you may say that this makes no difference. But from , the point of view of someone reasoning about the principles of protein , folding, it does. I completely agree with all of the above. What then about plasminogen activator inhibitor, PAI-1. This protein, AFAIR, has an active (as an inhibitor) state, which is in higher energy than an inactive ...
Reaktivität: Meerschweinchen, Pferd, Human and more. 21 verschiedene TMPRSS11D Antikörper vergleichen. Alle direkt auf antikörper-online bestellbar!
View mouse Tmprss6 Chr15:78439668-78468634 with: phenotypes, sequences, polymorphisms, proteins, references, function, expression
Boucher JC, Martinez-Salazar J, Schurr MJ, Mudd MH, Yu H, Deretic V. Two distinct loci affecting conversion to mucoidy in Pseudomonas aeruginosa in cystic fibrosis encode homologs of the serine protease HtrA. J Bacteriol. 1996 Jan; 178(2):511-23 ...
ProMMP1 has several activators including plasmin (Eeckhout & Vaes 1977, Werb et al. 1977, Santala et al. 1999), trypsin (Grant et al. 1987, Saunders et al. 2005), plasma kallikrein (Nagase et al. 1982, Saunders et al. 2005), chymase (Saarinen et al. 1994, Suzuki et al. 1995, Saunders et al. 2005), tryptase (Gruber et al. 1989, Suzuki et al. 1995, Saunders et al. 2005), neutrophil elastase, cathepsin G (Saunders et al. 2005) and trypsin-2 (Moilanen et al. 2003). Concanavalin A (ConA) was the first cellular treatment that yielded active MMPs in culture, inducing the cellular activation of MMP1 likely through MMP14 activity (Overall and Sodek 1990).Trypsin-like serine proteinases are believed to remove 34-36 residues from the N-terminus of the secreted pro-enzyme, equivalent to positions 53-55 of the UniProt cannonical sequence which includes a signal peptide. Removal of this region is sufficient to destabilize the Cys92-Zn2+ stabilizing bond (numbered according to the Uniprot canonical sequence, ...
Koide Y, Nakamura A, Uozumi T, Beppu T (1986) Cloning and sequencing of the major intracellular serine protease gene of Bacillus subtilis. J Bacteriol 167:110-6.[PMID:3087947 ...
In this work, we have performed an exhaustive bioinformatic analysis of the human genome to try to identify new serine proteases that could contain different catalytic domains within the same polypeptide chain. These bioinformatic searches led us to find a region in chromosome 16p11.2 putatively encoding a new polyprotease. After completing the cloning process using liver cDNA as template, we confirmed that the identified sequence was a new polyserine proteinase that we called polyserase-3 to underline its structural relationship with the previously described polyserases-1 and -2 [3, 9]. However, the polyserase-3 architecture is less complex than the exhibited by the two other human polyproteases. Thus, this new polyserase is composed of two serine protease domains preceded by a signal peptide, whereas both polyserase-1 and polyserase-2 contain three catalytic domains in a single polypeptide chain.. A comparative structural analysis also revealed that polyserase-3 is more closely related to ...
Serine proteases play an important role in processes such as blood clotting, digestion and in some pathways of cell development [1]. Serine proteases can hydrolyze either peptide bonds or esters. Proteases digest proteins by hydrolyzing the peptide bonds which are responsible for keeping amino acids together [2, 3]. The cleavage specificity of elastase, trypsin, chymotrypsin and other serine proteases depends on the volume/size, form/shape, and polarity/charge/hydrophobicity of the specific part of a protein surface where a substrate will be docking - the specificity pocket [4, 5]. There are three amino acid residues responsible for the enzymatic activity that are present in all serine proteases, which are denominated as the catalytic triad: His 57, Asp 102 and Ser 195 (chymotrypsin numbering system is used throughout - see [6]). Interestingly, out of those three amino acids, only Asp 102 does not make part of the interface (the definition of which is based on decreased solvent accessible area ...
TMPRSS2 - TMPRSS2 (untagged)-Human transmembrane protease serine 2 (TMPRSS2) transcript variant 1 available for purchase from OriGene - Your Gene Company.
Gentaur molecular products has all kinds of products like :search , Sceti K.K. \ E.coli LexA repressor \ 01-006 for more molecular products just contact us
Complete information for TMPRSS4 gene (Protein Coding), Transmembrane Protease, Serine 4, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
Complete information for TMPRSS2 gene (Protein Coding), Transmembrane Protease, Serine 2, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
Spinesin antibody [N3C3] (transmembrane protease, serine 5) for ICC/IF, IHC-P, WB. Anti-Spinesin pAb (GTX119497) is tested in Human, Mouse samples. 100% Ab-Assurance.
The assembly and activation of the early components of complement, after their interaction with antibody-antigen complexes, are described in terms of the structures of the different proteins taking part. C1q, a molecule of unique half collagen-half globular structure, binds to the second constant domain of the antibody molecules through its six globular heads. A tetrameric complex of C1r2-C1s2 binds to the collagenous tails and leads to formation of the serine-type proteases C1¯r and C1¯s. C1¯s activates C4, which forms a covalent bond between its α chain and the Fab section of the antibody. C2 is also activated by C1¯s and associates with the bound C4¯ molecule to form C42¯, a labile protease that activates C3, but which loses activity as the C2¯ peptide chains dissociate from C4¯. C2, by analogy with factor B, the equivalent component of the alternative pathway of activation, appears to be a novel type of serine protease with a similar catalytic site but different activation ...
Many serine proteases are targets for therapeutic intervention because they often play key roles in disease. Small molecule inhibitors of serine proteases with high affinity are especially interesting as they could be used as scaffolds from which to develop drugs selective for protease targets. One such inhibitor is bis(5-amidino-2-benzimidazolyl)methane (BABIM), standing out as the best inhibitor of trypsin (by a factor of over 100) in a series of over 60 relatively closely related analogues. By probing the structural basis of inhibition, we discovered, using crystallographic methods, a new mode of high-affinity binding in which a Zn2+ ion is tetrahedrally coordinated between two chelating nitrogens of BABIM and two active site residues, His57 and Ser 195. Zn2+, at subphysiological levels, enhances inhibition by over 10(3)-fold. The distinct Zn2+ coordination geometry implies a strong dependence of affinity on substituents. This unique structural paradigm has enabled development of potent, ...
Many serine proteases are targets for therapeutic intervention because they often play key roles in disease. Small molecule inhibitors of serine proteases with high affinity are especially interesting as they could be used as scaffolds from which to develop drugs selective for protease targets. One such inhibitor is bis(5-amidino-2-benzimidazolyl)methane (BABIM), standing out as the best inhibitor of trypsin (by a factor of over 100) in a series of over 60 relatively closely related analogues. By probing the structural basis of inhibition, we discovered, using crystallographic methods, a new mode of high-affinity binding in which a Zn2+ ion is tetrahedrally coordinated between two chelating nitrogens of BABIM and two active site residues, His57 and Ser 195. Zn2+, at subphysiological levels, enhances inhibition by over 10(3)-fold. The distinct Zn2+ coordination geometry implies a strong dependence of affinity on substituents. This unique structural paradigm has enabled development of potent, ...
antibody-antibodies.com is the marketplace for research antibodies. Find the right antibody for your research needs. Cleavage specificity of cucumisin, a plant serine protease.
Shop Lysyl endopeptidase ELISA Kit, Recombinant Protein and Lysyl endopeptidase Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
hypothetical protein [putative trypsin-like serine protease] ATGACGCACTTCGTGGACCGAGTTCCCTTCCAGTGGGATGCGCCCGGCGCCCTGGAACTG CGTGATCTGCTGGCCGGGGTGTACACCCGATCCGCCCCGGCCGAGCAACTGGCGAAGCGG GCCGGTGTGGCGACGGGATACATCAACTGGGAACAGCCCATGATGACCGTCTGGTTCGAA CTCATGGAGAAAGCGGCCAACCAGAAGTGTCTGCGCCCCCTTTTGGAGGCGGTCACCGAG GGGCCTGACCAGGCTGTCGCCGACCGGGTCCGTGAACTCCTCGCCGCGCAGCCTGTCGTG GAGGCACCGGACAGGCCCACGGGGCCGCAAGATTTCGCGGAGTTCGACGATCCCGACCAA CTGGAGCGGCAGATCTTCCGCTCCCACACGCTCCAGGACGTGGCCTTCCTGCGCCGGGGA ACCGAACTGGCCACTTCCGTGTGCCGGTTGCGCGTCACAGCCGCCGACGGCAGTCAATAC CACGGCACGGCCTTCCGTATCACGGACGATCTTCTACTGACCAATCACCATGTGCTGTTC GACGGCAACGGAAGCGCACCGCTCGGGGTCGAGGCGTGGTTCGGTTACGAGGCCGAGCTG AACGGGCGGACGCGCGAGCATCAAGTGGTGCTCTGTGACGTGGAGTCGGCTGTGGGAGAG CCCGAGCTGGACTGGGCGGTCGTCCGGAGCGCCGAGCCGCTGCCCGGTGACGCCCTTCGT GTCGCCCTGCCCAGCGCTGTCCACGTGTCCCTGAACGACAGGGTGTACATCATCCAGCAC CCGCACGGCGGGGTGAAGAAGCTCGCCGCCCGCCACAATGTCGTACGCCATGTCGACGAC ACTGTGGTGCAGTACTGGACCGACACGGAACAGGGATCGTCCGGGTCGCCCGTCTTCGAC ...
Prior to this study, scientists believed that proteases primarily cleave in unstructured loops, unstable parts of proteins that are readily accessible. The discovery that caspase-3 also cleaves α-helices contradicts a current dogma and offers new insights into protein signaling pathways.. "This was a big surprise because there shouldnt be anything for a protease to grab onto in a helix," said Dr. Salvesen. "We found that the basic concept that they dont cleave to helices is wrong. However, though weve found that proteases can cleave helices, we dont believe thats their biological function.". In addition to determining cleavage sites, the team also determined which interactions were "biologically significant." In other words which cleavages altered the function of the target protein and which ones had little impact.. The team tested the human caspase-3 and the Staphylococcal protease glutamyl endopeptidase (GluC) against the Escherichia coli (E. coli) proteosome. In a second set, the human ...
Cleaves peptide bonds on the C-terminal side of prolyl residues within peptides that are up to approximately 30 amino acids long.
Reaktivität: Rind (Kuh), Säugetier, Maus and more. 6 verschiedene PREP ELISA Kits vergleichen. Alle direkt auf antikoerper-online.de bestellbar!