Author(s): Singh, Kanwar; Zhao, Zhiying Jean; Zvenigorodsky, Natasha; Froula, Jeff; Pennacchio, Len; Chen, Feng | Abstract: Next generation DNA sequencing provides new opportunities to efficiently accomplish a variety of genomic tasks such as the de novo assembly of genomes. The newly released 454 FLX Titanium in October 2008 advanced the previous 454 FLX Standard system with nearly double the sequence reads and read lengths. A thorough assessment and optimization of 454 FLX Titanium sequencing system was done by the Technology Development Group at Joint Genome Institute. Currently applications like de novo whole genome shotgun assembly, transcriptome profiling, pyrotag sequencing and sequence capture technology are being optimized on the new 454 FLX Titanium systems.
Massively parallel high throughput sequencing technologies allow us to interrogate the microbial composition of biological samples at unprecedented resolution. The typical approach is to perform high-throughout sequencing of 16S rRNA genes, which are then taxonomically classified based on similarity to known sequences in existing databases. Current technologies cause a predicament though, because although they enable deep coverage of samples, they are limited in the length of sequence they can produce. As a result, high-throughout studies of microbial communities often do not sequence the entire 16S rRNA gene. The challenge is to obtain reliable representation of bacterial communities through taxonomic classification of short 16S rRNA gene sequences. In this study we explored properties of different study designs and developed specific recommendations for effective use of short-read sequencing technologies for the purpose of interrogating bacterial communities, with a focus on classification using
Background Next-generation sequencing platforms have revolutionised our ability to investigate the microbiota composition of complex environments, frequently through 16S rRNA gene sequencing of the bacterial component of the community. Numerous factors, including DNA extraction method, primer sequences and sequencing platform employed, can affect the accuracy of the results achieved. The aim of this study was to determine the impact of these three factors on 16S rRNA gene sequencing results, using mock communities and mock community DNA. Results The use of different primer sequences (V4-V5, V1-V2 and V1-V2 degenerate primers) resulted in differences in the genera and species detected. The V4-V5 primers gave the most comparable results across platforms. The three Ion PGM primer sets detected more of the 20 mock community species than the equivalent MiSeq primer sets. Data generated from DNA extracted using the 2 extraction methods were very similar. Conclusions Microbiota compositional data ...
Recently, many standalone applications have been proposed to correct sequencing errors in Illumina data. The key idea is that downstream analysis tools such as de novo genome assemblers benefit from a reduced error rate in the input data. Surprisingly, a systematic validation of this assumption using state-of-the-art assembly methods is lacking, even for recently published methods. For twelve recent Illumina error correction tools (EC tools) we evaluated both their ability to correct sequencing errors and their ability to improve de novo genome assembly in terms of contig size and accuracy. We confirm that most EC tools reduce the number of errors in sequencing data without introducing many new errors. However, we found that many EC tools suffer from poor performance in certain sequence contexts such as regions with low coverage or regions that contain short repeated or low-complexity sequences. Reads overlapping such regions are often ill-corrected in an inconsistent manner, leading to breakpoints in
Next generation sequencing technologies open exciting new possibilities for genome and transcriptome sequencing. While reads produced by these technologies are relatively short and error-prone compared to the Sanger method, their throughput is several magnitudes higher. We present a novel approach, called QPALMA, for computing accurate spliced alignments of short sequence reads that take advantage of the reads quality information as well as computational splice site predictions. In computational experiments we illustrate that the quality information as well as the splice site predictions [1] help to considerably improve the alignment quality. Our algorithms were optimized and tested using artificially spliced genomic reads produced with the Illumina Genome Analyzer for the model plant Arabidopsis thaliana. ...
First Roche GS-FLX Genome Sequencing System Installed At VBI - read this article along with other careers information, tips and advice on BioSpace
454 Life Sciences, a Roche Company, announced today the launch and immediate availability of the new GS GType HLA Primer Sets for high- and medium-resolution genotyping of class I and class II loci of the Human Leukocyte Antigen (HLA) genes. The primer sets are designed for use with the companys benchtop GS Junior and GS FLX next-generation sequencing systems.
The SK-BR-3 cell line is one of the most important models for HER2+ breast cancers, which affect one in five breast cancer patients. SK-BR-3 is known to be highly rearranged although much of the variation is in complex and repetitive regions that may be underreported. Addressing this, we sequenced SK-BR-3 using long-read single molecule sequencing from Pacific Biosciences, and develop one of the most detailed maps of structural variations (SVs) in a cancer genome available with nearly 20,000 variants present, most of which were missed by short read sequencing. Surrounding the important ERBB2 oncogene (also known as HER2), we discover a complex sequence of nested duplications and translocations, suggesting a punctuated progression. Full-length transcriptome sequencing further revealed several novel gene fusions within the nested genomic variants. Combining long-read genome and transcriptome sequencing enables an in-depth analysis of how SVs disrupt the genome and sheds new light on the complex ...
As one of the most studied genome rearrangements, tandem repeats have a considerable impact on genetic backgrounds of inherited diseases. Many methods designed for tandem repeat detection on reference sequences obtain high quality results. However, in the case of a de novo context, where no reference sequence is available, tandem repeat detection remains a difficult problem. The short reads obtained with the second-generation sequencing methods are not long enough to span regions that contain long repeats. This length limitation was tackled by the long reads obtained with the third-generation sequencing platforms such as Pacific Biosciences technologies. Nevertheless, the gain on the read length came with a significant increase of the error rate. The main objective of nowadays studies on long reads is to handle the high error rate up to 16%. In this paper we present MixTaR, the first de novo method for tandem repeat detection that combines the high-quality of short reads and the large length of long
Complete Genomics Previews Revolocity™ Sequencing System at European Human Genetics Conference 2015 Mater Health Services (Australia) and Radboud University Medical Center (The Netherlands)...
SEOUL, South Korea and SAN DIEGO, Jan. 11, 2016 - Macrogen, a global leader in genome sequencing services, and Edico Genome today announced Macrogen has chosen multiple DRAGEN™ Bio-IT Processors to reinforce its big data processing and analysis capacity for large-scale genome analysis and clinical sequencing services. Macrogen has world-class next-generation sequencing (NGS) facilities, which are equipped with Illuminas HiSeq™ X Ten, HiSeq 2000, HiSeq 2500, HiSeq 4000 and MiSeq® sequencing systems; Thermo Fishers Ion PGM™ and Ion Proton™ systems; Roches GS-FLX system; and PacBio instruments. Macrogens IT infrastructure capacity exceeds 11 petabytes of storage and more than 3,000 core clusters. Using DRAGEN, Macrogen was able to analyze each genome (30x coverage) produced by their HiSeq X Ten sequencing system in only 26 minutes, while maintaining high sensitivity and specificity. This analysis included conversion from BCL, the file that is delivered by the sequencing instrument, to ...
Progress in genetics and breeding in pea still suffers from the limited availability of molecular resources. SNP markers that can be identified through affordable sequencing processes, without the need for prior genome reduction or a reference genome to assemble sequencing data would allow the discovery and genetic mapping of thousands of molecular markers. Such an approach could significantly speed up genetic studies and marker assisted breeding for non-model species. A total of 419,024 SNPs were discovered using HiSeq whole genome sequencing of four pea lines, followed by direct identification of SNP markers without assembly using the discoSnp tool. Subsequent filtering led to the identification of 131,850 highly designable SNPs, polymorphic between at least two of the four pea lines. A subset of 64,754 SNPs was called and genotyped by short read sequencing on a subpopulation of 48 RILs from the cross Baccara x PI180693. This data was used to construct a WGGBS-derived pea genetic map comprising 64
Author Summary Human individual genome sequencing has recently become affordable, enabling highly detailed genetic sequence comparisons. While the identification and genotyping of single-nucleotide polymorphisms has already been successfully established for different sequencing platforms, the detection, quantification and genotyping of large-scale copy-number variants (CNVs), i.e., losses or gains of long genomic segments, has remained challenging. We present a computational approach that enables detecting CNVs in sequencing data and accurately identifies the actual copy-number at which DNA segments of interest occur in an individual genome. This approach enabled us to obtain novel insights into the largest human gene family - the olfactory receptors (ORs) - involved in smell perception. While previous studies reported an abundance of CNVs in ORs, our approach enabled us to globally identify absolute differences in OR gene counts that exist between humans. While several OR genes have very high gene
New generation DNA sequencing technologies are revolutionizing modern biological research. Scientists can now generate the rough equivalent of an entire human genome (~3 billion base-pairs of DNA) in just a few days with one single sequencing instrument. Until recently, such amounts of data could only be generated at large genome centers using hundreds of sequencers. The analysis of these data is complicated by their size - a single run of a sequencing instrument yields terabytes of information, often requiring a significant scale-up of the existing computational infrastructure. ...
BGI is a recognized leader in De Novo Whole Genome Sequencing and has been involved in the sequencing and assembly of 1000s of De Novo genomes and affiliated research published in the worlds leading journals.. De novo sequencing refers to sequencing a novel genome where there is no reference sequence available for alignment.. The process of de novo genome sequencing involves the sequencing of small DNA fragments, and assembling the reads into longer sequences (contigs) and finally ordering the contigs to obtain the entire genome sequence.. With the advent of rapid, low-cost next-generation sequencing (NGS) technology, researchers can now obtain whole genome data for organisms previously considered too low a priority to sequence. The availability of this whole genome data has allowed large-scale genomic studies to be performed that were unimaginable just a few years ago.. ...
Recent advances in high-throughput sequencing (HTS) technologies have led to orders of magnitude higher throughput compared to classic Sanger sequencing (see [3] for a review). Coupled with continuous
Sometimes the fastest way to get something done is to have an expert do it for you. Were here to help you build a full de novo assembly from scratch.. We first build a draft assembly using PacBio HiFi, the most accurate long-read sequencing platform available today. This assembly is then scaffolded up to chromosome-scale using Omni-C® proximity ligation technology and HiRise® scaffolding software. Unlike traditional Hi-C methods that utilize a restriction enzyme(s), Omni-C digests chromatin using a sequence-independent endonuclease for even, unbiased whole genome coverage. This unique combination of PacBio HiFi (accuracy) plus Omni-C (coverage) enables chromosome-scale phased SNP calling, giving you an enriched assembly dataset. Finally, we annotate your assembly to call and label as many genes as possible.. ...
the sequence that is to be sequenced) on a bead. Solid-State Nanopore-Based DNA Sequencing Technology Zewen Liu, 1 Yifan Wang, 1 Tao Deng, 2 and Qi Chen 1 1 Institute o f Microelectron ics, Ts inghua Uni versity, Bei jing 100084, China It uses 2 base encoding to decode the raw data generated by the sequencing platform into sequence data. SOLiD Sequencing. First, consider the impact of the longer reads, especially for de novo assemblies of novel genomes. Two basic methods for DNA sequencing :-A- Chemical cleavage method (Maxam and Gilbert, 1977) - Base-specific cleavage of DNA by certain chemicals - Four different chemicals, one for each base - A set of DNA fragments of different sizes - DNA fragments contain up to 500 nucleotides B- Enzymatic method (Sanger, 1981) Sequencing methods Based on innovative ligation-based chemistry, the 5500 Series SOLiD™ Sequencers empower scientists and ... SOLiD® Next-Generation Sequencing Systems & … However, the beads are placed on the solid-phase of a flow ...
Plant genomes, and eukaryotic genomes in general, are typically repetitive, polyploid and heterozygous, which complicates genome assembly1. The short read lengths of early Sanger and current next-generation sequencing platforms hinder assembly through complex repeat regions, and many draft and reference genomes are fragmented, lacking skewed GC and repetitive intergenic sequences, which are gaining importance due to projects like the Encyclopedia of DNA Elements (ENCODE)2. Here we report the whole-genome sequencing and assembly of the desiccation-tolerant grass Oropetium thomaeum. Using only single-molecule real-time sequencing, which generates long (,16 kilobases) reads with random errors, we assembled 99% (244 megabases) of the Oropetium genome into 625 contigs with an N50 length of 2.4 megabases. Oropetium is an example of a near-complete draft genome which includes gapless coverage over gene space as well as intergenic sequences such as centromeres, telomeres, transposable elements and ...
The goal of this demonstration project is to develop the capability to express complete biosynthetic pathways for natural products that are usually silent in their native microbial host (i.e. orphan biosynthetic gene clusters). Such a technology will increase our access to new chemical entities for potential use in drug development. By tailoring synthetic genomics techniques to the expression of biosynthetic gene clusters, we believe we will create the capacity to produce small molecules directly using synthetic expression constructs in platform production microorganisms. Publicly available high-throughput DNA sequencing data has already cataloged up to 20,000 orphan clusters; as a result, our approach has the potential to bring about the biological synthesis of a large number of natural products that are currently unavailable for evaluation as potential drugs. The proposed clones and expression constructs can be used as a starting point for evaluating the bioactivities of metabolites whose ...
The multikilobase reads that can be produced by single-molecule sequencing technologies may span complex, repetitive genomic regions but have high error rates. Bashir et al. use these reads to organize contigs assembled from accurate, short-read data, facilitating the analysis of clinically important regions of an outbreak strain of cholera. Advances in DNA sequencing technology have improved our ability to characterize most genomic diversity. However, accurate resolution of large structural events is challenging because of the short read lengths of second-generation technologies. Third-generation sequencing technologies, which can yield longer multikilobase reads, have the potential to address limitations associated with genome assembly. Here we combine sequencing data from second- and third-generation DNA sequencing technologies to assemble the two-chromosome genome of a recent Haitian cholera outbreak strain into two nearly finished contigs at |99.9% accuracy. Complex regions with clinically relevant
SCOTTSDALE, Ariz. - Whole genome sequencing - spelling out a persons entire DNA genetic code - has moved one step closer to being a medical option for direct patient care.. Physicians and researchers at Mayo Clinic in Arizona and the Translational Genomics Research Institute (TGen) successfully completed sequencing both a single patients normal and cancer cells - a tour de force of more than 6 billion DNA chemical bases.. While the whole genomes of several individuals or their cancers have been sequenced in recent years, this is believed to be among the first successful application of whole genome sequencing performed in support of the medical care of a specific cancer patient.. A male patient with pancreatic cancer was the first patient at Mayo Clinic to have whole genome sequencing performed on both his tumor and non-cancerous cells as part of a clinical research project. By comparing the tumor DNA to the patients normal DNA, researchers found genetic changes (mutations) that were important ...
Reference quality genomes provide a resource for studying gene structure, function, and evolution. However, often genes of interest are not completely or accurately assembled, leading to unknown errors in analyses or additional cloning efforts for the correct sequences. A promising solution is long-read sequencing. Here we tested PacBio-based long-read sequencing and diploid assembly for potential improvements to the Sanger-based intermediate-read zebra finch reference and Illumina-based short-read Annas hummingbird reference, two vocal learning avian species widely studied in neuroscience and genomics. With DNA of the same individuals used to generate the reference genomes, we generated diploid assemblies with the FALCON-Unzip assembler, resulting in contigs with no gaps in the megabase range, representing 150-fold and 200-fold improvements over the current zebra finch and hummingbird references, respectively. These long-read and phased assemblies corrected and resolved what we discovered to be
The National Food Institute carries out research using whole genome sequencing techniques. As such, the institute is helping to set the international standard for the detection, surveillance and studies of the global spread of disease-causing microorganism and antimicrobial-resistant bacteria. The institute is also working to advance and build next generation sequencing capacity internationally.. As such, researchers from the National Food Institute and DTU Systems Biology head up a large EU project called COMPARE with 28 European partners. In the research project, the partners want to develop a global platform that will enable real time exchange and interpretation of information about disease-causing microorganisms from around the world and to compare this with other relevant information such as clinical and epidemiological data.. The platform will be used to harmonize the way scientists, authorities, doctors and organizations around the world collect samples, generate genome sequencing data ...
AUSTRALIAS capacity to detect, respond to and control infectious threats, and to improve regional health security is hampered by the lack of a national approach to whole genome sequencing resources, and data sharing, according to the authors of a Perspective published in the Medical Journal of Australia.. Whole genome sequencing involves parsing out the entire genome of a pathogen, the data from which can be used to determine the pathogens identity, predict its resistance to antimicrobials and its virulence traits and understand the relationships between pathogens.. University of Melbourne Associate Professor Deborah Williamson, Deputy Director of the Microbiological Diagnostic Unit Public Health Laboratory at the Doherty Institute, and colleagues wrote that the use of whole genome sequencing has the potential to transform the investigation and surveillance of communicable diseases by providing the highest possible characterisation of pathogens, enabling earlier and accurate detection of ...
By M. Thomas P. Gilbert, Lynn P. Tomsho, Snjezana Rendulic, Michael Packard, Daniela I. Drautz, Andrei Sher, Alexei Tikhonov, Love Dalén, Tatyana Kuznetsova, Pavel Kosintsev, Paula F. Campos, Thomas Higham, Matthew J. Collins, Andrew S. Wilson, Fyodor Shidlovskiy, Bernard Buigues, Per G. P. Ericson, Mietje Germonpré, Anders Götherström, Paola Iacumin, Vladimir Nikolaev, Malgosia Nowak-Kemp, Eske Willerslev, James R. Knight, Gerard P. Irzyk, Clotilde S. Perbost, Karin M. Fredrikson, Timothy T. Harkins, Sharon Sheridan, Webb Miller, Stephan C. Schuster. Science ...
The advent of next-generation sequencing (NGS)4 technologies, which grew exponentially in the decade after publication of the first iteration of the human genome sequence (4), has provided substantial insights into new genes and the biological processes that underlie cancer pathogenesis. These insights are outlined below. NGS technologies parallelize sequencing processes via high-throughput means to produce millions of short sequencing reads from amplified DNA clones (5). NGS is also referred to as massively parallel sequencing, because the reaction steps occur in parallel with the detection steps and millions of reactions occur simultaneously (6). This parallelism makes it possible to read the same segment of a DNA sequence repeatedly to increase confidence in the sequence obtained for the targeted genomic segment. This multiple sampling of a genomic segment is referred to as the coverage of the sequencing run.. Before the NGS era, much progress had been made toward identifying mutated ...
CiteSeerX - Document Details (Isaac Councill, Lee Giles, Pradeep Teregowda): The availability of massive amounts of DNA sequence information has begun to revolutionize the practice of biology. As a result, current large-scale sequencing output, while impressive, is not adequate to keep pace with growing demand and, in particular, is far short of what will be required to obtain the 3-billion-base human genome sequence by the target date of 2005. To reach this goal, improved automation will be essential, and it is particularly important that human involvement in sequence data processing be significantly reduced or eliminated. Progress in this respect will require both improved accuracy of the data processing software and reliable accuracy measures to reduce the need for human involvement in error correction and make human review more efficient. Here, we describe one step toward that goal: a base-calling program for automated sequencer traces, phred, with improved accuracy. phred appears to be the first
We have developed and validated a low-coverage whole genome sequencing assay for genome-wide and high-resolution detection of copy number aberrations (CNAs) from inherited disorders. The analytical sensitivity was 0.765 for detecting CNVs of 25-50kb in size and 0.990 for detecting CNVs of over 50kb in size. The smallest detected deletion was 10kb.
The transcriptional architecture is a complex and dynamic aspect of a cells function. Next generation sequencing of steady state RNA (RNA-seq) gives unprecedented detail about the RNA landscape within a cell. Not only can expression levels of genes be interrogated without specific prior knowledge, but comparisons of expression levels between genes within a sample can be made. It has also been demonstrated that splicing variants [1, 2] and single nucleotide polymorphisms [3] can be detected through sequencing the transcriptome, opening up the opportunity to interrogate allele-specific expression and RNA editing.. An important aspect of dealing with the vast amounts of data generated from short read sequencing is the processing methods used to extract and interpret the information. Experience with microarray data has repeatedly shown that normalization is a critical component of the processing pipeline, allowing accurate estimation and detection of differential expression (DE) [4]. The aim of ...
Our Sanger sequencing platform consists of three Applied Biosystems 3730xl DNA Analyzers. This 96-capillary sequencer is the gold standard for high-throughput Sanger sequencing und enables the generation of high-quality data at a low cost per sample.. We offer a sequencing service for our external partners once a week as part of an academic collaboration. Apart from routine sequencing of PCR products and plasmids, the Sanger platform also carries out genotyping of microsatellites, RFLPs (restriction fragment length polymorphism) and MLPA (multiplex ligation-dependent probe amplification) samples. If you are interested in using our service, please contact us and see the specifications and order form below.. Please send the filled order form to seq_ta [at] ikmb.uni-kiel.de.. Specifications Sanger sequencing. Order form Sanger sequencing. ...
Genomic heterogeneity of bacterial species is observed and studied in experimental evolution experiments and clinical diagnostics, and occurs as micro-diversity of natural habitats. The challenge for genome research is to accurately capture this heterogeneity with the currently used short sequencing reads. Recent advances in NGS technologies improved the speed and coverage and thus allowed for deep sequencing of bacterial populations. This facilitates the quantitative assessment of genomic heterogeneity, including low frequency alleles or haplotypes. However, false positive variant predictions due to sequencing errors and mapping artifacts of short reads need to be prevented. We therefore created VarCap, a workflow for the reliable prediction of different types of variants even at low frequencies. In order to predict SNPs, InDels and structural variations, we evaluated the sensitivity and accuracy of different software tools using synthetic read data. The results suggested that the best ...
This dataset contains the digitized treatments in Plazi based on the original journal article Straube, Nicolas, White, William T., Ho, Hsuan-Ching, Rochel, Elisabeth, Corrigan, Shannon, Li, Chenhong, Naylor, Gavin J. P. (2013): A DNA sequence-based identification checklist for Taiwanese chondrichthyans. Zootaxa 3752 (1): 256-278, DOI: http://dx.doi.org/10.11646/zootaxa.3752.1.16 ...
Genome sequencing technologies are improving at a rapid pace. The current challenge is to find ways to extract all of the genetic information from the data. One of the biggest challenges has been the detection of CNVs. Sebat, in collaboration with Seungtai Yoon of CSHL and Kenny Ye, Ph.D., at the Albert Einstein College of Medicine, developed a statistical method to estimate DNA copy number of a genomic region based on the number of sequences that map to that location (or read depth). When the genomes of multiple individuals are compared, regions that differ in copy number between individuals can be identified.. The new method allows the detection of small structural variants that could not be detected using earlier microarray-based methods. This is significant because most of the CNVs the genome are less than 5000 nucleotides in length. The new method is also able to detect certain classes of CNVs that other sequencing-based approaches struggle with, particularly those located in complex ...
Strategies for assembling large, complex genomes have evolved to include a combination of whole-genome shotgun sequencing and hierarchal map-assisted sequencing. Whole-genome maps of all types can aid genome assemblies, generally starting with low-resolution cytogenetic maps and ending with the highest resolution of sequence. Fingerprint clone maps are based upon complete restriction enzyme digests of clones representative of the target genome, and ultimately comprise a near-contiguous path of clones across the genome. Such clone-based maps are used to validate sequence assembly order, supply long-range linking information for assembled sequences, anchor sequences to the genetic map and provide templates for closing gaps. Fingerprint maps are also a critical resource for subsequent functional genomic studies, because they provide a redundant and ordered sampling of the genome with clones. In an accompanying paper we describe the draft genome sequence of the chicken, Gallus gallus, the first ...
We combined conventional fumC-fimH typing with deep amplicon sequencing to assess E. coli clonal diversity in a high-throughput manner. Our method has several advantages over existing protocols. First, our method has high sequencing resolution for target species. Since we sequence only E. coli fumC and fimH, we can generate ≥0.5 million reads per sample, yielding ≥5,000 reads per base. In contrast, metagenomic sequencing, which is nonspecific for target species, yields only 20 reads per base per genome (assuming a 5-Mb genome). Secondly, our method assessed up to 46 samples per sequencing run. In contrast, MLST requires typing ≥100 single colonies per sample to capture the low-prevalence strains that PLAP detects. Finally, while we developed PLAP for E. coli CH typing, PLAP is not limited to E. coli clonotyping and may be generalized to other MLST schemes. For those attempting to use or adapt our approach, we have provided guidelines for both the experimental and algorithm portions on ...
A framework technology comprising file format and toolkit in which we combine highly efficient and tunable reference-based compression of sequence data with a data format that is directly available for computational use. This compression method is tunable: The storage of quality scores and unaligned sequences may be adjusted for different experiments to conserve information or to minimize storage costs, and provides one opportunity to address the threat that increasing DNA sequence volumes will overcome our ability to store the sequences.
An advance online publication in Nature Biotechnology from Michael Snyders lab at Stanford University demonstrates the utility of long-read sequencing for assessing transcribed regions across the human genome. Long PacBio reads were able to completely cover full-length RNA molecules, characterizing genetic regions that have not been previously annotated.. The paper, entitled A single-molecule long-read survey of the human transcriptome, reports the application of Single Molecule, Real-Time (SMRT®) Sequencing to studying RNA, comparing it to results from libraries sequenced with a 454® instrument. The scientists sequenced cDNA synthesized from pooled RNA gathered from 20 human organs and tissues in order to identify as many transcript isoforms as possible.. The purpose of this effort was to find a better alternative to existing RNA-seq approaches, which have so far relied on short-read sequencers. It is difficult to identify full-length transcript iso-forms using short reads, the authors ...
Finds sub-sequence or patterns in the sequence and highlights the matching region. The tool works with standard single letter nucleotide or protein codes including ambiguities and can match Prosite patterns in protein sequences ...
Finds sub-sequence or patterns in the sequence and highlights the matching region. The tool works with standard single letter nucleotide or protein codes including ambiguities and can match Prosite patterns in protein sequences ...
Our facility provides services for DNA/RNA sequencing and oligonucleotide synthesis. Our sequencing technology portfolio includes first-generation sequencing (classic Sanger and fragment analysis), second-generation sequencing (next-generation sequencing) using Illumina instruments, and (…). ...
Whole genome sequencing (WGS), which is the process of determining an organisms complete DNA sequence, can be used to identify DNA anomalies that cause disease. Identifying disease-causing DNA abnormalities allows clinicians to better predict an effective course of treatment for the patient.
Background|br /|Inherited retinal disorders are clinically and genetically heterogeneous with more than 150 gene defects accounting for the diversity of disease phenotypes. So far, mutation detection was mainly performed by APEX technology and direct Sanger sequencing of known genes. However, these methods are time consuming, expensive and unable to provide a result if the patient carries a new gene mutation. In addition, multiplicity of phenotypes associated with the same gene defect may be overlooked.|br /|Methods|br /|To overcome these challenges, we designed an exon sequencing array to target 254 known and candidate genes using Agilent capture. Subsequently, 20 DNA samples from 17 different families, including four patients with known mutations were sequenced using Illumina Genome Analyzer IIx next-generation-sequencing (NGS) platform. Different filtering approaches were applied to identify the genetic defect. The most likely disease causing variants were analyzed by Sanger sequencing. Co
Capillary sequencing PCR tubes and caps are for use with the ABI Prism 310 sequencerThese PCR tubes are made of high-quality virgin polypropylene and feature uniform thin walls for efficient heat transfer. Tubes and caps are compatible with most leading thermal cyclers, and are autoclavable. Caps, available as either flat or domed, fit perfectly and create a uniform, tight seal that prevents sample evaporation in the thermal cycler. Tubes are nonpyrogenic and RNase- and DNase-free. Certain models feature assorted packs of color-coded tubes for easy identification of samples.
Roche Diagnostics Deutschland - The newly discovered arenavirus caused the deaths of four of five infected individuals in South Africa in October, 2008
Over the last few years, several initiatives have described efforts to combine previously invented techniques in molecular biology with parallel detection principles to sequence or genotype DNA signatures. The Infinium (R) system from Illumina and the Affymetrix GeneChips (R) are two systems suitable for whole-genome scoring of variable positions. However, directed candidate-gene approaches are more cost effective and several academic groups and the private sector provide techniques with moderate typing throughput combined with large sample capacity suiting these needs. Recently, whole-genome sequencing platforms based on the sequencing-by-synthesis principle were presented by 454 Life Sciences and Solexa, showing great potential as alternatives to conventional genotyping approaches. In addition to these sequencing initiatives, many efforts are pursuing novel ideas to facilitate fast and cost-effective whole genome sequencing, such as ligation-based sequencing. Reliable methods for routine ...
TY - GEN. T1 - Inferring intra-tumor heterogeneity from high-throughput DNA sequencing data. AU - Oesper, Layla. AU - Mahmoody, Ahmad. AU - Raphael, Benjamin J.. PY - 2013/4/3. Y1 - 2013/4/3. N2 - Cancer is a disease driven in part by somatic mutations that accumulate during the lifetime of an individual. The clonal theory [1] posits that the cancerous cells in a tumor are descended from a single founder cell and that descendants of this cell acquired multiple mutations beneficial for tumor growth through rounds of selection and clonal expansion. A tumor is thus a heterogeneous population of cells, with different subpopulations of cells containing both clonal mutations from the founder cell or early rounds of clonal expansion, and subclonal mutations that occurred after the most recent clonal expansion. Most cancer sequencing projects sequence a mixture of cells from a tumor sample including admixture by normal (non-cancerous) cells and different subpopulations of cancerous cells. In addition ...
...Next-generation DNA sequencing (NGS) technology has revolutionized bio......,Essential,informatics,methods,and,tools,for,analyzing,the,explosion,of,NGS,data,biological,biology news articles,biology news today,latest biology news,current biology news,biology newsletters
Next-generation DNA sequencing of image-guided biopsy samples collected by multiple sites reveal predictive biomarkers for cancer treatment.
Applied Maths NV today announces that it has released a new version of its flagship software suite BioNumerics that allows de novo assembly to be performed on next generation sequencing data. This new feature, available in version 6.6, consolidates the development of BioNumerics into a complete and fully integrated suite for preprocessing and analysis of NGS data.
Background Recent high throughput sequencing technology can handle generating plenty of data for bacterial genome sequencing tasks. be utilized to compute a design graph that presents the most appealing contig adjacencies to be able to help biologists in completing the entire genomic series. The design graph shows exclusive contig orderings where feasible and the very best alternatives where required. Conclusions Our brand-new algorithm for contig buying uses series similarity aswell as phylogenetic details to estimation adjacencies of contigs. An assessment of our execution implies that it performs much better than latest approaches while getting much faster at the same time. Today the nucleotide sequences of several genomes are known Background. In the initial genome tasks the procedure of acquiring the DNA series by multi-step clone-by-clone sequencing strategies was pricey and Kenpaullone tedious. Currently the most frequent strategy for de-novo genome sequencing is normally = (data files. ...
Sequence analysis of organelle genomes has revealed important aspects of plant cell evolution. The scope of this study was to develop an approach for de novo assembly of the carrot mitochondrial genome using next generation sequence data from total genomic DNA. Sequencing data from a carrot 454 whole genome library were used to develop a de novo assembly of the mitochondrial genome. Development of a new bioinformatic tool allowed visualizing contig connections and elucidation of the de novo assembly. Southern hybridization demonstrated recombination across two large repeats. Genome annotation allowed identification of 44 protein coding genes, three rRNA and 17 tRNA. Identification of the plastid genome sequence allowed organelle genome comparison. Mitochondrial intergenic sequence analysis allowed detection of a fragment of DNA specific to the carrot plastid genome. PCR amplification and sequence analysis across different Apiaceae species revealed consistent conservation of this fragment in the
Roche and Precision System Science, Co., Ltd (PSS) have announced the signing of an exclusive agreement to develop and manufacture a fully automated emulsion PCR instrument for Roches portfolio of next-generation sequencing platforms. It is intended to support Roches GS Junior and GS FLX+ systems as well as the sequencing platforms that Roche is currently developing.
Advancements in Next Generation Sequencing (NGS) technologies regarding throughput, read length and accuracy had a major impact on microbiome research by significantly improving 16S rRNA amplicon sequencing. As rapid improvements in sequencing platforms and new data analysis pipelines are introduced, it is essential to evaluate their capabilities in specific applications. The aim of this study was to assess whether the same project-specific biological conclusions regarding microbiome composition could be reached using different sequencing platforms and bioinformatics pipelines. Chicken cecum microbiome was analyzed by 16S rRNA amplicon sequencing using Illumina MiSeq, Ion Torrent PGM, and Roche 454 GS FLX Titanium platforms, with standard and modified protocols for library preparation. We labeled the bioinformatics pipelines included in our analysis QIIME1 and QIIME2 (de novo OTU picking [not to be confused with QIIME version 2 commonly referred to as QIIME2]), QIIME3 and QIIME4 (open reference OTU
RNA-Sequencing (RNA-Seq) broadly refers to a family of experimental techniques that give researchers the ability to study the transcriptional landscapes of cells and tissues quantitatively by exploiting high throughput sequencing technology. Currently, the most commonly used sequencing platforms are provided by Illumina, which uses a fluorescence-based paradigm for reading the bases in a nucleotide sequence. One alternative option is provided by Ion Torrent, which is built around the use of pH measurements to read nucleotide sequences. In addition to the distinct sequencing technologies used by these two platforms, there are smaller differences in the types of data they generate. In Illumina data all sequence reads generated during a single experiment have the same lengths, while the lengths of Ion Torrent reads vary. Additionally, the current generation of Illumina instruments can generate sequence reads from both ends of a fragment (paired-end reads), while Ion Torrent cannot.. Prior studies ...
The information contained in the genome of an organism, its DNA, is expressed through transcription of its genes to RNA, in quantities determined by many internal and external factors. As such, studying the gene expression can give valuable information for e.g. clinical diagnostics. A common analysis workflow of RNA-sequencing (RNA-seq) data consists of mapping the sequencing reads to a reference genome, followed by the transcript assembly and quantification based on these alignments. The advent of second-generation sequencing revolutionized the field by reducing the sequencing costs by 50,000-fold. Now another revolution is imminent with the third-generation sequencing platforms producing an order of magnitude higher read lengths. However, higher error rate, higher cost and lower throughput compared to the second-generation sequencing bring their own challenges. To compensate for the low throughput and high cost, hybrid approaches using both short second-generation and long third-generation ...
505) 995 4466; [email protected]. Santa Fe, N.M., January 12, 2007 - The New Mexico Institute of Mining and Technology (NMT), Socorro, NM, and the National Center for Genome Resources (NCGR), Santa Fe, NM, announced today that they have established a partnership to create the New Mexico Genome Sequencing Center (NMGSC).. The State of New Mexico has provided $600,000 in funding to establish the Center, which will be located at NCGR in Santa Fe. The NMGSC will be the first in the nation to focus on medical resequencing. Medical resequencing is a new approach for discovery of the genetic basis of common human diseases or important crop traits. It refers to the large scale sequencing of the genome of many individuals affected by a disease or with a trait of interest. Medical sequencing is being made possible by next-generation DNA sequencing instruments and software that are dramatically increasing the speed and throughput of DNA sequencing.. The New Mexico Genome Sequencing Center is being established ...
505) 995 4466; [email protected]. Santa Fe, N.M., January 12, 2007 - The New Mexico Institute of Mining and Technology (NMT), Socorro, NM, and the National Center for Genome Resources (NCGR), Santa Fe, NM, announced today that they have established a partnership to create the New Mexico Genome Sequencing Center (NMGSC).. The State of New Mexico has provided $600,000 in funding to establish the Center, which will be located at NCGR in Santa Fe. The NMGSC will be the first in the nation to focus on medical resequencing. Medical resequencing is a new approach for discovery of the genetic basis of common human diseases or important crop traits. It refers to the large scale sequencing of the genome of many individuals affected by a disease or with a trait of interest. Medical sequencing is being made possible by next-generation DNA sequencing instruments and software that are dramatically increasing the speed and throughput of DNA sequencing.. The New Mexico Genome Sequencing Center is being established ...
Next Generation Sequencing Market - (Technology Type - Whole Genome Sequencing, Targeted Resequencing, RNA Sequencing, Whole Exome Sequencing, and De Novo Sequencing); (Application - Oncology, Genetic Screening, Infectious Diseases, Drug and Biomarker Discovery, Agriculture & Animal Research, Idiopathic Diseases and others): Market Growth, Future Prospects and Competitive Analysis, 2017-2025 the market was valued at USD 3.7 Bn in 2017, and is expected to reach USD 20.6 Bn by 2025, expanding at a CAGR of 21.5% from 2017 to 2025.. Browse Full Report Click Here: http://www.acutemarketreports.com/report/next-generation-sequencing-market. Market Insights. Next generation sequencing is a high-throughput sequencing that enables sequencing and assembling of number of short DNA reads at a small period of time and with a better accuracy. The introduction of next generation sequencing technologies has ensured massive changes in the sequencing process by providing better output, higher speed, flexibility ...
Unlock the full value of your next-generation sequencing (NGS) data sets from Illumina HiSeq/MiSeq/NextSeq/HiSeq X Ten, Roche 454 GS-FLX, LifeTechnologies Solid and Iontorrent /IonProton PGM, and PacBio platforms.. Bespoke NGS data analysis: QFAB provides tailored bioinformatics services to biologists across the spectrum of computational techniques and services applicable to molecular biology and next generation sequencing. QFAB researchers design and implement custom bioinformatics approaches that are developed in consultation with researchers for specific questions in molecular biology.. We can also integrate your genomics data with other -omics, microarrays and clinical datasets.. Our NGS data analysis services include:. Whole genome sequencing data analysis. ...
Next-generation sequencing technologies are rapidly generating whole-genome datasets for an increasing number of organisms. However, phylogenetic reconstruction of genomic data remains difficult because de novo assembly for non-model genomes and multi-genome alignment are challenging. To greatly simplify the analysis, we present an Assembly and Alignment-Free (AAF) method ( https://sourceforge.net/projects/aaf-phylogeny ) that constructs phylogenies directly from unassembled genome sequence data, bypassing both genome assembly and alignment. Using mathematical calculations, models of sequence evolution, and simulated sequencing of published genomes, we address both evolutionary and sampling issues caused by direct reconstruction, including homoplasy, sequencing errors, and incomplete sequencing coverage. From these results, we calculate the statistical properties of the pairwise distances between genomes, allowing us to optimize parameter
Dramatic advances in sequencing technologies have opened new possibilities for whole genome analysis. The increasing read length of next-generation sequencing platforms, as well as the promising perspectives of third generation sequencing platforms, will inevitably lead to better assemblies and represent genomes in large stretches of DNA. Also, third generation technologies (such as the PacBio and IonTorrent systems) will be capable of outputting sequencing reads with large undefined inserts, thus providing valuable paired read information for the assembly and scaffolding process. Concurrently, the development of genome closure software should also receive attention to overcome difficult genomic regions that cannot be covered by draft assemblies.. Our results with GapFiller indicate that gapped genomics regions can be reliably closed through an automatic protocol that uses only short sequencing reads. Costly Sanger sequencing can therefore be limited to a few difficult repeat areas. Also, we ...
The development of next-generation massively parallel sequencing technologies (NGS), including the Roche 454™ Genome Sequencer FLX Instrument, the Illumina Genome Analyzer, Life Technologys Ion Torrent™ Personal Genome Machine, and the Pacific Biosciences RS have revolutionized genomic and genetic research, significantly improved sequencing throughput, reduced costs for data production, and advanced research from weeks to hours.
Next-generation DNA sequencing (NGS) offers a promising way to obtain massive numbers of orthologous loci to understand phylogenetic relationships among organisms. Of particular interest are old museum specimens and other samples with degraded DNA, where traditional sequencing methods have proven to be challenging. Low coverage shotgun sequencing and sequence capture are two widely used NGS approaches for degraded DNA. Sequence capture can yield sequence data for large numbers of orthologous loci, but it can only be used to sequence genomic regions near conserved sequences that can be used as probes. Low coverage shotgun sequencing has the potential to yield different data types throughout the genome. However, many studies using this method have often generated mitochondrial sequences, and few nuclear sequences, suggesting orthologous nuclear sequences are likely harder to recover. To determine the phylogenetic position of the galliform genus Tropicoperdix, whose phylogenetic position is currently
Full genomes of several organisms have been sequenced in the past fifteen years, including the human genome in 2004. These studies were completed using Sanger DNA sequencing, which has a limited throughput and high cost meaning the human genome took fifteen years to sequence and cost nearly three billion dollars
A novel smartphone-based microscope could make DNA sequence analysis much easier, faster and more readily accessible in remote locations. The dev
The scientific revolution that started with the human-genome sequencing project, carried out with first-generation sequencing technology, has initiated other sequencing projects, including those for plant species. Different technologies have been developed together with the second- and third-generation sequencing platforms called next-generation sequencing. This review deals with the most relevant second-generation sequencing platforms, advanced analysis tools, and sequenced plant genomes. To date, a number of plant genomes have been sequenced, with many more projected for the near future. Using the new techniques and developed advanced bioinformatics tools, several studies including both plant genomics and transcriptomics were carried out. Likewise, completion of reference genome sequences and high-throughput resequencing projects presented opportunities to better understand the genomic nature of plants and accelerated the process of crop improvement. Modern sequencing and bioinformatics ...
Since few studies have been focused on the RNA profile of the liquid fraction of synovial fluid (SF) from osteoarthritis (OA) patients, we determined whether it contains enough RNA for profiling. We removed cells from SF and extract RNA for building a cDNA library, followed by the second-generation sequencing and bioinformatic analyses. From one SF sample of an OA patient, we obtained 0.096 µg RNA for building a cDNA library. From this library the second-generation sequencing produced 66,154,562 clean reads, 91.28% of which were matched to the reference with 2,682 genes identified. From another patients SF sample, 0.24 µg RNA was obtained and sequencing of the established cDNA library produced 64,463,162 clean reads but, unexpectedly, only 22.40% of the reads were matched to the human genome, although 5,081 genes were identified. Some of the unmatchable reads matched RNAs of bacteria, mainly pseudomonas, likely derived from previous infections since the patients had no obvious systemic ...
Modern biology operates with a large amount of data and investigates very complex systems. Scientists use complicated algorithms and very sophisticated software, which is impossible to run, without access to significant computing resources. In addition, modern biology requires efficient large data volumes processing, such as DNA sequences, proteins structure, Genome Scale Modeling, and molecular dynamics simulation. Recent advances in Next Generation Genome Sequencing technology led to significant increase in amount of sequencing data that has to be processed, analysed and made available for bioinformaticians worldwide. The ancient DNA analysis is one of the most challenging and CPU consuming scientific problems.. It can take a couple of months on super-computer at NRC KI to run widely used package PALEOMIX to analyse ancient genome sequencing data. The issue of data processing at a large scale has been addressed in the past by the LHC experiments at CERN and in our studies we have evaluated and ...
Define Primer walking. Primer walking synonyms, Primer walking pronunciation, Primer walking translation, English dictionary definition of Primer walking. n. 1. An elementary textbook for teaching children to read. 2. A book that covers the basic elements of a subject. n. 1. A cap or tube containing a small...
We were prompted to develop the BisPCR2 method by our need for a high-throughput, cost-effective method for interrogating multiple CpGs at base resolution within multiple target loci of interest. Fluorescence-based approaches to targeted bisulfite sequencing are limited by the number of CpGs that can be measured at one time, the inability to multiplex, and the reliance of measurements on a secondary enzymatic reaction. Next-generation sequencing techniques for targeted bisulfite sequencing employ the same strategy of bisulfite conversion and amplification of target loci, but result in a far more robust output by directly measuring base content of each CpG within an amplicon. Further, the ability to multiplex means that a single sequencing reaction can yield information about multiple target loci for multiple biological samples. One impediment of NGS approaches is the additional step of DNA sequencing library preparation following target enrichment, which can be expensive and time consuming. We ...
Microorganisms widely exist in nature and are closely related to human life and production. They are generally divided into fungi, actinomycetes, bacteria, spirulina, rickettsia, chlamydia, mycoplasma and viruses. Microbial whole genome sequencing is an important tool for mapping genomes of novel organisms, finishing genomes of known organisms, or comparing genomes across multiple samples. Sequencing the entire microbial genome is important for construction of accurate reference genomes, microbial identification, and other comparative genomic studies. Comparative genomic analysis based on whole genome sequencing plays an irreplaceable role in studying pathogenic mechanisms of pathogenic microorganism, evolution of pathogenic genes and screening of novel, efficient drug targets. Microbial whole genome sequencing can be widely used in various fields.. Diseases Pathogenic microorganism includes all kinds of microorganisms that cause human diseases, food corruption, animal infection in animal ...
New sequencing system (2017-07-12) The NovaSeq6000 sequencing system (Illumina Inc.) is now installed at the NGI facilities in Uppsala and Stockholm.. The NovaSeq, launched by Illumina early 2017, offers high-throughput sequencing across the full range of DNA- and RNA-sequencing applications including transcriptome profiling, target re-sequencing, low coverage genome sequencing and single cell applications. By acquiring the NovaSeq6000 NGI will continue to offer the most cost efficient sequencing service to our users. Whole genome sequencing at a coverage of at least 15x will continue to be run on HiSeqX as the most cost efficient approach. During the summer and beginning of the fall, the NovaSeq systems will be validated and NGI aims to accept projects from users from September 2017. Projects already submitted and scheduled for HiSeq2500 may be transferred to the NovaSeq, in those cases the NGI project coordinators will contact the user for a discussion. You can read more about the NovaSeq ...
The Vironomics Core facilitates research long-read length next generation sequencing. The sequencers in the core are ideal for longer DNA fragment sequencing with instrument run times of only 24 hours. This is accomplished using Ion GeneStudio S5 Prime System, and companion Ion Torrent Chef. The Ion GeneStudio S5 capable of up to 600bp read lengths and has a maximal output of 130 Million 200 bp reads in 12 hours or 4 human exomes per day. Many clients use the longer reads for large genomes, de novo sequencing, 16S sequencing, long amplicons, etc. Customization is available or take advantage of the current expertise in: whole genome sequencing (WGS), de novo assembly, STR cell line verification, targeted amplicon sequencing, plasmid verification, strand-specific RNAseq, and exome sequencing.. ...
CSHL Press publishes monographs, technical manuals, handbooks, review volumes, conference proceedings, scholarly journals and videotapes. These examine important topics in molecular biology, genetics, development, virology, neurobiology, immunology and cancer biology. Manuscripts for books and for journal publication are invited from scientists world wide.
CSHL Press publishes monographs, technical manuals, handbooks, review volumes, conference proceedings, scholarly journals and videotapes. These examine important topics in molecular biology, genetics, development, virology, neurobiology, immunology and cancer biology. Manuscripts for books and for journal publication are invited from scientists world wide.
CREST. The accurate identification of structural variations using whole-genome DNA sequencing data generated by next-generation sequencing technology is extremely difficult. To address this challenge, we have developed CREST, an algorithm that uses sequencing reads with partial alignments to the reference human genome (so-called soft-clipped reads) to directly map the breakpoints of somatic structural variations. We applied CREST to paired tumor/normal whole genome sequencing data from five cases of T-lineage acute lymphoblastic leukemia (T-ALL). A total of 110 somatic structural variants were identified, ,80% of which were validated by genomic PCR and Sanger sequencing. The validated structural variants included 31 inter-chromosomal translocations, 19 intra-chromosomal translocations, one inversion, 22 deletions and 16 insertions. A comparison of the results generated with CREST to those obtained using the traditional paired-end discordant mapping methods demonstrate CREST to have a much higher ...
Long Read Sequencing (Third Generation) and Next Generation Sequencing (Second Generation). DNA and RNA sequencing is the process of determining the nucleotide order of a given DNA fragment. The nucleotide sequence encodes the necessary information that allows living things to survive and reproduce. Determining the sequence is therefore useful in researching into how organisms live. Our core facility provides many sequencing options to meet your individual needs, utilizing (a) Oxford NanoPore GridIONx5 Long-Read Sequencing (by reading the nucleotide sequences at the single molecule level), and (b) Illumina Short-Read Sequencing (by massive parallel sequencing of millions of DNA fragments and yielding substantially more throughput reads quickly).. ...
Short-read sequencing technologies have long been the work-horse of microbiome analysis. Continuing technological advances are making the application of long-read sequencing to metagenomic samples increasingly feasible. We demonstrate that whole bacterial chromosomes can be obtained from an enriched community, by application of MinION sequencing to a sample from an EBPR bioreactor, producing 6 Gb of sequence that assembles into multiple closed bacterial chromosomes. We provide a simple pipeline for processing such data, which includes a new approach to correcting erroneous frame-shifts. Advances in long-read sequencing technology and corresponding algorithms will allow the routine extraction of whole chromosomes from environmental samples, providing a more detailed picture of individual members of a microbiome.
Exome Sequencing is fast, cost effective and generates a smaller sized data for quick analysis. For whole exome sequencing cost and SNP genotyping visit 1010Genome.
This is the first evaluation of a novel fast broad-range 16S rDNA PCR/sequencing assay in a Canadian patient population, and the first study of the clinical utility of DPO primers for the routine molecular analysis of heart valve tissue in consecutive patients with and without infective IE. Additionally, our study had the advantage of extensive clinical information to better delineate the Dukes minor criteria for all patients. Our study confirms the higher sensitivity of molecular heart valve testing compared to tissue culture [35-38]. However, our novel assay has one of the highest reported sensitivities of a user-developed broad-range 16S rDNA PCR to date. Although pre-operative blood cultures make a microbiologic diagnosis in approximately two-thirds of patients suspected of having IE, subsequent molecular analysis of heart valve tissue contributed to the microbiologic diagnosis of 31 % of our patients. However, the change in diagnosis would only be expected to contribute to the clinical ...
Following the completion of the human genome project, the high demand for low-cost sequencing has given rise to a number of high-throughput, next-generation sequencing (NGS) technologies. These new sequencing platforms allow high-throughput sequencing for a wide range of applications such as: |br /> |ul> |li>Whole genome sequencing as de novo or resequencing|/li> |li>Targeted resequencing|/li> |li>Transcriptome profiling|/li> |li>Microbiome research|/li> |li>Gene regulation studies |/li> |/ul>
Following the completion of the human genome project, the high demand for low-cost sequencing has given rise to a number of high-throughput, next-generation sequencing (NGS) technologies. These new sequencing platforms allow high-throughput sequencing for a wide range of applications such as: |br /> |ul> |li>Whole genome sequencing as de novo or resequencing|/li> |li>Targeted resequencing|/li> |li>Transcriptome profiling|/li> |li>Microbiome research|/li> |li>Gene regulation studies |/li> |/ul>
The Illumina MiSeq uses the same established reversible-terminator sequencing by synthesis chemistry as the HiSeq2000. Researchers have a wide range of sequencing read options ranging from 36 bp singleton to 150 bp paired-end reads. The system is capable of generating over 2 Gb data per run with a high percentage of bases over Q30. The high data yield and superior quality allows scientists to conduct a wide variety of sequencing applications including: highly multiplexed PCR amplicon sequencing, small genome sequencing and de novo sequencing, small RNA sequencing, targeted resequencing and 16S metagenomics.. The addition of numerous Illumina MiSeqs adds another level of sequencing for our clients, said Ardy Arianpour, Vice President of Business Development at Ambry Genetics. Our scientists have spent the last couple months validating sequencing runs and getting amazing results so we can deliver and work with multiple types of samples that fit on the MiSeq.. The MiSeq is a fully integrated ...
http://lifetech-it.hosted.jivesoftware.com/community/torrent_dev/blog/2011/11/08/leveraging-flow-order-and-flow-signals. A major strength of the Ion Torrent semiconductor sequencing system is that a SNP is not equivalent to an error, or more precisely single base substitutions are not equivalent to a single sequencing error. While the base calls that are provided are accurate, even greater levels of performance are available by taking into account flow orders and flow signals.. Homopolymers are observed one-at-a-time during sequencing, with the given homopolymer base determined by the flow order. For example, a flow order of ACGT would cycle through each base one a time. More intricate flow orders, like TACGTACGTCTGAGCATCGATCGATGTACAGC, can yield significant advantages to overcome carry-forward (signals from out-of-phase templates) and incomplete extension (templates that do not fully extend). Furthermore, flow orders also imply something about the likelihood of an error versus a variant (more ...
Hosted by the International Society for Computational Biology (ISCB) and the Centre for Genomic Regulation (CRG), the Next Generation Sequencing Conference 2014 (NGS 2014) is a dedicated meeting on cutting-edge approaches to the processing and analysis of Next Generation Sequencing data. The goal of this conference is to bring together bioinformatics researchers and biologists facing new high-throughput sequencing challenges. The conference will feature presentations showing how current platforms can be used to address key biological questions and what is the current state of the art for data analysis. Sizeable space will also be dedicated to emerging and future trends in high-throughput sequencing and their associated computational challenges.. see more at http://www.iscb.org/ngs2014. ...
Mycobacterium tuberculosis is characterised by limited genomic diversity, which makes the application of whole genome sequencing particularly attractive for clinical and epidemiological investigation. However, in order to confidently infer transmission events, an accurate knowledge of the rate of change in the genome over relevant timescales is required. We attempted to estimate a molecular clock by sequencing 199 isolates from epidemiologically linked tuberculosis cases, collected in the Netherlands spanning almost 16 years. Multiple analyses support an average mutation rate of ~0.3 SNPs per genome per year. However, all analyses revealed a very high degree of variation around this mean, making the confirmation of links proposed by epidemiology, and inference of novel links, difficult. Despite this, in some cases, the phylogenetic context of other strains provided evidence supporting the confident exclusion of previously inferred epidemiological links. This in-depth analysis of the molecular clock
The introduction of new sequencing technologies whole-genome sequencing (WGS) and whole-exome sequencing (WES) that are much less finely targeted than previous genetic tests has resulted in ethical debate about what should be done with clinically significant findings that may arise during the sequencing process. In this piece we argue that, in addition to whether the finding has been intentionally sought or arises incidentally, the ethical issues concerning what should be done with WES and WGS findings are also influenced by whether sequencing occurs in a clinical or research setting. We argue that decisions about the disclosure of WGS and WES findings generated in the clinical context are much less ethically contentious than decision making about the feedback of research results. We conclude by calling for greater transparency about the purpose of sample collection, more explicit protocols for transitioning between research and clinical contexts and patients and research participants to be warned of
The one consistent finding among viral metagenomics studies has been the high proportion of sequences having no significant homology to a known sequence within one of the large sequence databases (e.g., GenBank, UniRef etc.). Those viral metagenome libraries having the highest frequency of hits to known sequences typically come from marine environments where the hit frequency for longer Sanger reads is around 30% (at a BLAST e-score of ≤0.001) [12]. Sanger libraries from soils show even lower hit rates at ~20%. The lack of homology to known sequences is only exacerbated by the shorter read lengths of next-generation sequencing technology [33] where libraries sequenced using the longest average read length next generation sequencing technology (i.e., 450 bp for the 454 pyrosequencing Ti FLX chemistry) yield hit rates to known sequence databases of less than 20%. In contrast, microbial shotgun metagenome libraries analyzed using the same databases and approaches will yield hit frequencies of ca. ...
Researchers funded by the National Institutes of Health have used a rapid DNA sequencing technique to identify gene variants in roughly a third of cases of nonimmune Hydrops fetalis (NIHF), a serious condition in which a fetus develops fluid buildup inside the abdominal cavity, lungs, or other parts of the body. The findings suggest that the DNA sequencing technique, known as exome sequencing, could be used to provide information unavailable with current genetic testing methods.
The proliferation of large-scale DNA-sequencing projects in recent years has driven a search for alternative methods to reduce time and cost. Here we describe a scalable, highly parallel sequencing system with raw throughput significantly greater than that of state-of-the-art capillary electrophoresis instruments. The apparatus uses a novel fibre-optic slide of individual wells and is able to sequence 25 million bases, at 99% or better accuracy, in one four-hour run. To achieve an approximately 100-fold increase in throughput over current Sanger sequencing technology, we have developed an emulsion method for DNA amplification and an instrument for sequencing by synthesis using a pyrosequencing protocol optimized for solid support and picolitre-scale volumes. Here we show the utility, throughput, accuracy and robustness of this system by shotgun sequencing and de novo assembly of the Mycoplasma genitalium genome with 96% coverage at 99.96% accuracy in one run of the machine. The race is on for a big