Wardell, JN, Stocks, SM, Thomas, CR and Bushell, ME (2002) Decreasing the hyphal branching rate of Saccharopolyspora erythraea NRRL 2338 leads to increased resistance to breakage and increased antibiotic production ...
The erythromycin A-producing polyketide synthase from the gram-positive bacterium Saccharopolyspora erythraea (formerly Streptomyces erythraeus) has evident structural similarity to fatty acid synthases, particularly to the multifunctional fatty acid synthases found in eukaryotic cells. Fatty acid synthesis in S. erythraea has previously been proposed to involve a discrete acyl carrier protein (ACP), as in most prokaryotic fatty acid synthases. We have cloned and sequenced the structural gene for this ACP and find that it does encode a discrete small protein. The gene lies immediately adjacent to an open reading frame whose gene product shows sequence homology to known beta-ketoacyl-ACP synthases. A convenient expression system for the S. erythraea ACP was obtained by placing the gene in the expression vector pT7-7 in Escherichia coli. In this system the ACP was efficiently expressed at levels 10 to 20% of total cell protein. The recombinant ACP was active in promoting the synthesis of ...
Precursor-directed production of erythromycin analogs by |em|Saccharopolyspora erythraea|/em| | Scott Frykman; Timothy Leaf; Chris Carreras; Peter Licari | download | BookSC. Download books for free. Find books
Purchase Recombinant Saccharopolyspora erythraea Alanine--tRNA ligase(alaS) ,partial. It is produced in Yeast. High purity. Good price.
Erythromycin production by S. erythraea NRRL2338 and derivative rif mutants on R3/1 or YS agar media. (A-B) Strains were grown for 7 days on R3/1 (A) or YS (B)
ID A4F744_SACEN Unreviewed; 656 AA. AC A4F744; DT 17-APR-2007, integrated into UniProtKB/TrEMBL. DT 17-APR-2007, sequence version 1. DT 08-MAY-2019, entry version 62. DE SubName: Full=Zn-dependent protease with chaperone function {ECO:0000313,EMBL:PFG93672.1}; GN OrderedLocusNames=SACE_0522 {ECO:0000313,EMBL:CAL99868.1}; GN ORFNames=A8924_0922 {ECO:0000313,EMBL:PFG93672.1}; OS Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 OS / NBRC 13426 / NCIMB 8594 / NRRL 2338). OC Bacteria; Actinobacteria; Pseudonocardiales; Pseudonocardiaceae; OC Saccharopolyspora. OX NCBI_TaxID=405948 {ECO:0000313,EMBL:CAL99868.1, ECO:0000313,Proteomes:UP000006728}; RN [1] {ECO:0000313,EMBL:CAL99868.1, ECO:0000313,Proteomes:UP000006728} RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA]. RC STRAIN=ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / RC NRRL 2338 {ECO:0000313,Proteomes:UP000006728}, and NRRL 2338 RC {ECO:0000313,EMBL:CAL99868.1}; RX PubMed=17369815; DOI=10.1038/nbt1297; RA ...
ID A4F759_SACEN Unreviewed; 812 AA. AC A4F759; DT 17-APR-2007, integrated into UniProtKB/TrEMBL. DT 17-APR-2007, sequence version 1. DT 11-DEC-2019, entry version 72. DE SubName: Full=Carbon-monoxide dehydrogenase large subunit {ECO:0000313,EMBL:CAL99883.1, ECO:0000313,EMBL:PFG93686.1}; DE EC=1.2.99.2 {ECO:0000313,EMBL:CAL99883.1}; GN OrderedLocusNames=SACE_0537 {ECO:0000313,EMBL:CAL99883.1}; GN ORFNames=A8924_0937 {ECO:0000313,EMBL:PFG93686.1}; OS Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / OS NBRC 13426 / NCIMB 8594 / NRRL 2338). OC Bacteria; Actinobacteria; Pseudonocardiales; Pseudonocardiaceae; OC Saccharopolyspora. OX NCBI_TaxID=405948 {ECO:0000313,EMBL:CAL99883.1, ECO:0000313,Proteomes:UP000006728}; RN [1] {ECO:0000313,EMBL:CAL99883.1, ECO:0000313,Proteomes:UP000006728} RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA]. RC STRAIN=ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / RC NRRL 2338 {ECO:0000313,Proteomes:UP000006728}, and NRRL 2338 RC ...
Glycolysis is the process of converting glucose into pyruvate and generating small amounts of ATP (energy) and NADH (reducing power). It is a central pathway that produces important precursor metabolites: six-carbon compounds of glucose-6P and fructose-6P and three-carbon compounds of glycerone-P, glyceraldehyde-3P, glycerate-3P, phosphoenolpyruvate, and pyruvate [MD:M00001]. Acetyl-CoA, another important precursor metabolite, is produced by oxidative decarboxylation of pyruvate [MD:M00307]. When the enzyme genes of this pathway are examined in completely sequenced genomes, the reaction steps of three-carbon compounds from glycerone-P to pyruvate form a conserved core module [MD:M00002], which is found in almost all organisms and which sometimes contains operon structures in bacterial genomes. Gluconeogenesis is a synthesis pathway of glucose from noncarbohydrate precursors. It is essentially a reversal of glycolysis with minor variations of alternative paths [MD:M00003 ...
Nonhomologous end joining (NHEJ) eliminates DNA double-strand breaks (DSBs) by direct ligation. NHEJ involves binding of the KU heterodimer to double-stranded DNA ends, recruitment of DNA-PKcs (MRX complex in yeast), processing of ends, and recruitment of the DNA ligase IV (LIG4)-XRCC4 complex, which brings about ligation. A recent study shows that bacteria accomplish NHEJ using just two proteins (Ku and DNA ligase), whereas eukaryotes require many factors. NHEJ repairs DSBs at all stages of the cell cycle, bringing about the ligation of two DNA DSBs without the need for sequence homology, and so is error-prone ...
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class="publication">Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href="http://www.nrbook.com/b/bookcpdf.php">Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
Erythromycin A (1) is a macrolide antibiotic produced by the soil bacterium, Saccharopolyspora erythraea. It has been shown that erythromycin is biosynthesised from the sequential condensation of one propionyl and six methylmalonyl units on the polyketide synthase (PKS), to give the first enzyme free intermediate, 6-deoxyerythronolide B(2). The polyketide synthase consists of three large multifunctional proteins, DEBS 1, DEBS 2 and DEBS 3. 6-Deoxyerythronolide B (2) is then elaborated by a series of further tailoring enzymes, culminating with the production of erythromycin A (1). Three organisms capable of producing truncated erythromycin PKSs have been constructed; DEBS 1-TE, which contains a copy of the thioesterase from the end of DEBS 3 at the end of module 2, DEBS 2-TE, which contains a thioesterase at the end of module 4 and ΔDH DEBS 2-TE, another truncated PKS with the thioesterase at the end of DEBS 2, but with a non-functional dehydratase in module 4. In addition, a synthetic route was ...
General Information: Source of the antibiotic erythromycin. Saccharopolyspora erythraea is the soil bacterium that produces the industrially important antibiotic erythromycin A. Erythromycin is a clinically important and potent macrolide antibiotic. It is used to treat infections caused by several prokaryotic pathogens such as Streptococcus, Staphylococcus, Mycoplasma, Ureaplasma, Chlamydia and Legionella. Production of this antibiotic is lower than others in the same class, such as penicillin or cephalosporin, which has led to the development of a genetic system to attempt to enhance the production of erythromycin. ...
Spinosad insecticide is based on a compound found in the bacterial species Saccharopolyspora spinosa (S. spinosa). The genus of Saccharopolyspora was discovered in 1975 by Lacey and Goodfellow, who described isolates from crushed sugar cane which...
Spinosad is a member of the spinosyns class of insecticides, which are non-antibacterial tetracyclic macrolides. Spinosad contains two major factors, spinosyn A and spinosyn D, derived from the naturally occurring bacterium, Saccharopolyspora spinosa. Spinosyn A and spinosyn D have the chemical compositions 2-[(6-deoxy-2,3,4-tri-O-methyl- -L-mannopyranosyl)oxy]-13-[[5-dimethylamino)-tetrahydro-6-methyl-2H-pyran-2-yl]oxy]-9-ethyl-2,3,3a,5a,5b,6,9,10,11,12,13,14,16a,16b-tetradecahydro-14-methyl-1 H-as-Indaceno[3,2-d]oxacyclododecin-7, 15-dione and 2-[(6-deoxy-2,3,4-tri-O-methyl- -L-mannopyranosyl)oxy]-13-[[5-dimethylamino)-tetrahydro-6-methyl-2H-pyran-2-yl] oxy]-9-ethyl-2,3,3a,5a,5b,6,9,10,11,12,13,14, 16a,16b-tetradecahydro-4,14-dimethyl-1 H-as-Indaceno[3,2-d] oxacyclododecin-7,15-dione, respectively ...
Spinosad is a member of the spinosyns class of insecticides, which are non-antibacterial tetracyclic macrolides. Spinosad contains two major factors, spinosyn A and spinosyn D, derived from the naturally occurring bacterium, Saccharopolyspora spinosa. Spinosyn A and spinosyn D have the chemical compositions 2-[(6-deoxy-2,3,4-tri-O-methyl- -L-mannopyranosyl)oxy]-13-[[5-dimethylamino)-tetrahydro-6-methyl-2H-pyran-2-yl]oxy]-9-ethyl-2,3,3a,5a,5b,6,9,10,11,12,13,14,16a,16b-tetradecahydro-14-methyl-1 H-as-Indaceno[3,2-d]oxacyclododecin-7, 15-dione and 2-[(6-deoxy-2,3,4-tri-O-methyl- -L-mannopyranosyl)oxy]-13-[[5-dimethylamino)-tetrahydro-6-methyl-2H-pyran-2-yl] oxy]-9-ethyl-2,3,3a,5a,5b,6,9,10,11,12,13,14, 16a,16b-tetradecahydro-4,14-dimethyl-1 H-as-Indaceno[3,2-d] oxacyclododecin-7,15-dione, respectively ...
COMFORTIS (spinosad) is obtainable in six sizes of chewable flavored tablets for oral administration to dogs and puppies In keeping with their weight. Just about every chewable tablet is formulated to deliver a minimal spinosad dosage of thirteen.five mg/lb (thirty mg/kg). Spinosad is often a member from the spinosyns course of insecticides, which might be non-antibacterial tetracyclic macrolides. Spinosad contains two major variables, spinosyn A and spinosyn D, derived from the By natural means happening bacterium, Saccharopolyspora spinosa ...
11996558] Functional expression of genes involved in the biosynthesis of the novel polyketide chain extension unit, methoxymalonyl-acyl carrier protein, and engineered biosynthesis of 2-desmethyl-2-methoxy-6-deoxyerythronolide B. (J Am Chem Soc. , 2002 ...
1KEZ: Crystal structure of the macrocycle-forming thioesterase domain of the erythromycin polyketide synthase: versatility from a unique substrate channel.
Actinobacteria, Actinomycetes, Gene, Growth, Habitats, Marine Sediments, Micromonospora, Procedure, Rhodococcus, rRNA Gene, Saccharopolyspora, Streptomyces
Mingji Dai and co-workers at Purdue reported in JACS on the synthesis of spinosyn A through a carbonylative macrolactonization. JACS paper
zuzana o4, enzymy sa hodnotia ucinnostou=aktivitou, nie miligramami. Kto na enzymi neuvadza ucinnost, tak maskuje neucinne zlozenie.. BioCore zo Swansonvitamins uvadza spravne aktivity, lebo su dost vysoke. Ze tomu nerozumies, to sa nedivim, lebo je to dost novy system a dosial neustaleny kompletne, ale tak by sa mali vsetky enzymy uvadzat, podla ucinnosti ich jednotlivych zloziek na potraviny.. Ja osobne pouzivam od Swansona produkt firmy Now, Super multienzymes, lebo obsahuju aj BetainHCl a je to dost velka davka.. Ale vyskusal som aj BioCore, lebo obsahuje niektore nezvykle novsie enzymi, galaktosidazu(travenie komplexnych sacharidov zo zelenin a fazule, proti naduvaniu) a glucoamylazu(rozklada glykogen). ...
M1 is mainly associated with symptoms and indications-The International Classification of Diseases (ICD)- A09AA02-Multienzymes (lipase, protease etc ...
AHAVA Dermud barojošs ķermeņa krēms 200ml . • Ķermeņa krēmi, losjoni • Personīgās higiēnas ierīces • Parfimērija un kosmētika, cenas tiešsaistē lētāk.
libreoffice-officebean (1:3.5.4+dfsg2-0+deb7u10 [amd64, armel, armhf, i386], 1:3.5.4+dfsg2-0+deb7u6 [kfreebsd-amd64, kfreebsd-i386, s390x], 1:3.5.4+dfsg2-0+deb7u5 [powerpc, s390], 1:3.5.4+dfsg2-0+deb7u4 [mipsel, sparc], 1:3.5.4+dfsg2-0+deb7u3 [mips], 1:3.5.4+dfsg2-0+deb7u2 [ia64]) [security ...
In QEMU 1:4.1-1, 1:2.1+dfsg-12+deb8u6, 1:2.8+dfsg-6+deb9u8, 1:3.1+dfsg-8~deb10u1, 1:3.1+dfsg-8+deb10u2, and 1:2.1+dfsg-12+deb8u12 (fixed), when ...
Do you really want to delete this prezi? Neither you, nor the coeditors you shared it with will be able to recover it again. DeleteCancel ...
Cytotoxic and antimicrobial potential of actinomycete species Saccharopolyspora salina VITSDK4 isolated from the Bay of Bengal Coast of India.
... is an acid degradation product produced by selective hydrolysis of the more labile forosamine saccharide in the 17-position in spinosyn D, the minor component of commercial product, Spinosad. Spinosyn D 17-pseudoaglycone is only weakly active as an insecticide as the forosamine moiety is considered essential for potent activity. Despite the importance of spinosyns as agro-chemical insecticides and more recently as animal health products, there are few published reports of the biological activity or the levels of spinosyn D 17-pseudoaglycone in animals or in the environment ...
1MO2: Insights into channel architecture and substrate specificity from crystal structures of two macrocycle-forming thioesterases of modular polyketide synthases
polyketide synthase [modular polyketide synthase] ATGGCCAATGCCAATGAGGAAAAGCTTCGGGACTACCTCAAGCGGGCGACCGCCGAACTC GTCCAGGTGCGCCGCCGCCTGGCGGAGATCGAGGCGGGGGAGCAGGAGCCGATCGCCGTG GTGGGGATGGCCTGCCGCTTTCCCGGCGGTGTGGGGTCGCCCGCGGAATTCTGGGAGTTG CTGGCCTCCGACGGCGACGCCATTTCGGGATTTCCGGTGGACCGGGGGTGGAATGTCGAG GCGCTGTACGACCCGAATCCGGACCGAGCGCGGACCGGGACGTCTTACACCCGCCACGGC GGCTTTCTCCACGACGCGGCGGACTTCGACGCGGGGTTCTTCGGGATCAGCCCGCGTGAG GCGCTGGCGATGGACCCGCAGCAGCGGCTGCTGCTGGAGACCTCCTGGGAGGCGCTGGAA GGCGCCGGAATCGACCCGGCCACGCTGCGCGGGAGCCGCACCGGCGTCTTCGCCGGGATG ATGTACCACGACTACGCCACGCGCCTGCTCGAACTCCCCGATGGCCTCGAAGGGCTCGTC GGTAACGGCAACGCCGGCGGGGTGCTGTCGGGTCGGTTGGCGTACAGCTTTGGTTTTGAG GGTCCTGCGGTGACGGTGGATACGGCGTGTTCGTCGTCGTTGGTGGCGTTGCATTTGGCG TGTCAGTCGTTGCGGTCGGGGGAGTGTTCGCTGGCGTTGGCGGGTGGGGTGACGGTGATG TCGACGCCGGGGGTGTTTGTGGAGTTCTCCCGTCAGCGCGGTCTGGCGGCGGATGGGCGG TGCAAGCCGTACGCGGCCGCCGCGGATGGCGTTGGCATGTCCGAGGGCGTGGCCGTCTTG TTGGTGGAGCGGTTGTCTGATGCGCGGCGGTTGGGGCATCGGGTGTTGGCGGTGGTGCGG ...
Abstract. The chain extension of carboxylic acids developed by Arndt and Eistert was applied to the construction of peptides containing β-amino acids. The method may be used for the generation of new types of peptide-containing combinatorial libraries.. ...
Investigating the Structural Plasticity of a Cytochrome P450: Three-Dimensional Structures of P450 Eryk and Binding to its Physiological Substrate ...
Northland Deb Webber Live Shows. Then Deb Webber will walk through the audience, giving spontaneous readings – connecting those chosen with loved ones in spiri
Bay of Plenty Deb Webber Live Shows. Then Deb Webber will walk through the audience, giving spontaneous readings – connecting those chosen with loved ones in spiri
libreoffice-ogltrans (1:3.5.4+dfsg2-0+deb7u9 [amd64, armhf, i386], 1:3.5.4+dfsg2-0+deb7u6 [kfreebsd-amd64, kfreebsd-i386, s390x], 1:3.5.4+dfsg2-0+deb7u5 [powerpc, s390], 1:3.5.4+dfsg2-0+deb7u4 [sparc], 1:3.5.4+dfsg2-0+deb7u2 [ia64]) [security ...
A Review Of oxytocin factor side effects http://oxytocinreviews.com/oxytocin-side-effects/oxytocin-side-effects-a-comprehensive-view/ ...
All of the 52 evolved populations (Fig. 1) were tested against 10 antibiotics from different classes, yielding 520 drug-population combinations. A substantial number of the lineages showed a significant increase (2 to ,32-fold) in their MIC of different antibiotic classes. Thus, decreased susceptibility was observed against three different antibiotics (erythromycin, rifampin, and streptomycin) in 10 E. coli populations and against three different antibiotics (erythromycin, fosfomycin, and amdinocillin) in 8 S. enterica populations (Fig. 2). In total, 3.5% (18/520) of all tested combinations showed decreased susceptibility, whereas only 0.6% (3/520) showed increased susceptibility (three E. coli populations had a 2.3-fold reduction in the MIC of erythromycin). In all populations with decreased susceptibility, the putative resistance mutations (see below) showed signatures of selection, as the mutations had either gone to near-fixation or reached high frequencies in the population.. In all ...
Crude extracts of three actinomycetes species belonging to Saccharopolyspora (TR 046 and TR 039) and Actinosynnema (TR 024) genera were screened for antibacterial activities against a panel of several bacterial strains. The extracts showed antibacterial activities against both gram-negative and gram-positive test bacteria with inhibition zones ranging from 8 to 28 mm (TR 046); 8 to15 mm (TR 039); and 10 to 13 mm (TR 024). The minimum inhibitory concentrations ranged from 0.078 to 10 mg/mL (TR 046); 5 to |10 mg/mL (TR 039); and 1.25 to 5 mg/mL (TR 024). Time-kill studies revealed that crude extract of TR 046 showed strong bactericidal activity against Bacillus pumilus (ATCC14884), reducing the bacterial load by 104 cfu/mL and 102 cfu/mL at 4× MIC and 2× MIC, respectively, after 6 h of exposure. Similarly, against Proteus vulgaris (CSIR 0030), crude extract of TR 046 achieved a 0.9log10 and 0.13log10 cfu/mL reduction at 5 mg/mL (4× MIC) and 1.25 mg/mL (2× MIC) after 12 h of exposure. The extract was
0036] According to another embodiment, spinosyns may be included in a conventional paint composition as the sole antifouling agent, or added in combination with other microbicides, antifouling agents, fungicides, herbicides, insecticides, antibiotics, non toxic antifoulants, and natural products or extracts to produce an additive or synergistic effect on attachment of biofouling organisms. Suitable microbicides which may be added in combination with the spinosyn of the present invention include, but are not limited to: 5-chloro-2-methyl-3-isothiazolone; 2-methyl-3-isothiazolone; 2-n-octyl-3-isothiazolone; 4,5-dichloro-2-n-octyl-3-isothiazolone; 3-iodo-2-propynyl butyl carbamate; 1,2-dibromo-2,4-dicyanobutane; methylene-bis-thiocyanate; 2-thiocyanomethylthiobenzothiazole; tetrachloroisophthalonitrile; 5-bromo-5-nitro-1,3-dioxane; 2-bromo-2-nitopropanediol; 2,2-dibromo-3-nitrilopropionamide; N,N-dimethylhydroxyl-5,5-dimethylhydantoin; bromochlorodimethylhydantoin; 1,2-benzisothiazolin-3-one; ...
Hypersensitivity pneumonitis (HP) refers to a group of disorders caused by a nonatopic immunologic response to an inhaled agent. In its acute or subacute form, hypersensitivity pneumonitis may be a cause of recurrent pneumonitis.
What is Hypersensitivity Pneumonitis? "Umm... excuse me, did you say Supercalifragilisticexpialidocious...???" Nope! We said Hypersensitivity Pneumonitis (HP) [click here for pronunciation], but we completely understand your confusion. So, what is ...
Buy Dalacin and Doxycycline with no prescription needed. Antibiotics and antibacterial drugs. Also, the cephalosporins Distaclor and Duricef and macrolide antibiotic Erythromycin, delivered worldwide without prescription
A lung disease thought to affect only people from Japan, China and Korea has been identified in five people in the United States who have never been to the Far East and are not of Asian descent. Panbronchiolitis, diagnosed in its early stages, is stopped easily with long-term use of the antibiotic erythromycin.
Acute hypersensitivity pneumonitis (a.k.a. acute extrinsic allergic alveolitis) refers to the episodic form of this condition usually happening in just a few hours after the antigen exposure and often recurring with the re-exposure. It represents...
Familial hypersensitivity pneumonitis information including symptoms, diagnosis, misdiagnosis, treatment, causes, patient stories, videos, forums, prevention, and prognosis.
Objective To estimate the reported incidence of occupational hypersensitivity pneumonitis (OHP) in the UK and to consider whether the pattern of attributed causation has changed over time. Methods All cases of OHP reported to the SWORD scheme between January 1996 and December 2015 were classified into 1 of 10 categories of the suspected agent. Cases were grouped into four 5-year time periods to examine any changing pattern in incidence or suspected causation. For each time period, the annual incidence was calculated using the estimated number of reported cases and the working population of the UK. Results Between 1996 and 2015, there were 202 actual cases of OHP reported to SWORD, equating to an estimated 818 cases, when adjusting for the sampling ratio. Over this period, the annual UK incidence was 1.4 per million workers. The mean (SD) age of reported cases was 52 (13) years, and cases were four-times more likely to be men than women. Over the study period, there was a fall in the proportion ...
Native: indigenous.. Non-native: introduced (intentionally or unintentionally); has become naturalized.. County documented: documented to exist in the county by evidence (herbarium specimen, photograph). Also covers those considered historical (not seen in 20 years). State documented: documented to exist in the state, but not documented to a county within the state. Also covers those considered historical (not seen in 20 years).. Note: when native and non-native populations both exist in a county, only native status is shown on the map.. ...
Ononis spinosa is a biological ingredient used in cosmetics. Its derived from a small prickly shrub (Spiny Restharrow) that offers pink-to-white flowers in the summer followed by seedpods.
The proportion of subjects who achieve a clinical response, defined as at least a 50% reduction in composite FLEET CAP score from baseline in each treatment group ...
The present invention relates to stereolithographic compositions containing an actinic radiation-curable and cationically polymerizable organic substance, a cationic initiator, a radical photoinitiator, and at least one cationic reactive modifier containing at least two reactive groups per molecule or at least one polyether polyol or mixtures thereof. The cationic reactive modifier has at least one chain extension segment with a molecular weight of at least about 100 and not more than about 2,000. The polyether polyol has a molecular weight greater than or equal to about 4,000. The use of the cationically reactive modifiers and polyether polyol modifiers substantially increases the flexibility and toughness of the cured articles without compromising photospeed, accuracy and wetting-recoatability of the compositions. The present invention further relates to a method of producing a cured product, particularly three-dimensional shaped articles by treating the composition described above with actinic