A quantitative real time reverse-transcription polymerase chain reaction (qRT-PCR) assay with specific primers recommended by the World Health Organization (WHO) has been widely used successfully for detection and monitoring of the pandemic H1N1/2009 influenza A virus. In this study, we report the design and characterization of a novel set of primers to be used in a qRT-PCR assay for detecting the pandemic H1N1/2009 virus. The newly designed primers target three regions that are highly conserved among the hemagglutinin (HA) genes of the pandemic H1N1/2009 viruses and are different from those targeted by the WHO-recommended primers. The qRT-PCR assays with the newly designed primers are highly specific, and as specific as the WHO-recommended primers for detecting pandemic H1N1/2009 viruses and other influenza viruses including influenza B viruses and influenza A viruses of human, swine, and raccoon dog origin. Furthermore, the qRT-PCR assays with the newly designed primers appeared to be at least 10-fold
PubMedID: 23777485 | Quantitative expression analysis and prognostic significance of the BCL2-associated X gene in nasopharyngeal carcinoma: a retrospective cohort study. | BMC cancer | 1/1/2013
In final result, this analysis implies a surrounding function for coinfecting infections in clients introducing with SARI and highlights the crucial role of viral coinfection. Persisted use of the rRT-PCR multiplex assay in combination with the SARI surveillance program will boost our capability to find blood circulation of respiratory trojans in clients hospitalized for SARI and aid explain the factor of these respiratory system viruses among individuals with SARI in Southwest Photography equipment. Although there happen to be increasing problems about the prospective for A(H1N1)pdm09 to reassort with pre-existing real human influenza infections and give go up to a very transmissible or pathogenic pathogen [22], no blended infections have been noticed with either subtypes in individuals with SARI in this analysis.. A lymphocytic meningitis had been current in 6 of 21 HIV -seropositive people but in zero of the HIV -seronegative patients. Perivascular infiltrates consisting of lymphocytes and ...
ONC201/TIC10 is a first-in-class small molecule inducer of TRAIL that causes early activation of the integrated stress response. Its promising safety profile and broad-spectrum efficacy in vitro have been confirmed in Phase I/II trials in several advanced malignancies. Binding and reporter assays have shown that ONC201 is a selective antagonist of the dopamine D2-like receptors, specifically, DRD2 and DRD3. We hypothesized that ONC201s interaction with DRD2 plays a role in ONC201s anticancer effects. Using cBioportal and quantitative reverse-transcription polymerase chain reaction analyses, we confirmed that DRD2 is expressed in different cancer cell types in a cell type-specific manner ...
Species, Scientific Experts, Genomes and Genes, Publications, Research Topics, Locale about Experts and Doctors on reverse transcriptase polymerase chain reaction in Netherlands
Gentaur molecular products has all kinds of products like :Abbexa , Abbexa \ rno-mir-542-5p RT-PCR Detection Kit \ abx096363 for more molecular products just contact us
How can one calculate the efficiency of isolated total RNA from different tissues treated at the same time, when it comes to doing quantitative real-time RT-PCR analysis afterwards? If one compare the real-time expression of a certain gene in different tissues, using housekeeping genes and an external standard reference gene.. How can one be sure that the possible difference in the expression pattern is not due to difference in the isolation efficiency?. ...
subject: discussion on Quantitative Competitive RT-PCR dear netters, I am busy writing a discussion for a report I hope graduate on. So at the moment I am looking for some additional comments and insights on Quantitative Competitive RT-PCR that will help me getting a more thorough discussion. Here are some of the questions I am taking in account: What are the strong and weak points in the QC RT-PCR system (internal control: insertion of approx. 4bp; 5 fluorescent labeled primer; genescan analysis/ABI 370)? What is the best way to validate the method you are trying to set up. And are the results obtained with this method reliable/reproducible enough to get accepted by reviewers. Is there some strong literature discussing the system including the disadvantages of it. Thanks in advance, David E. Sluijs Pathology, Academic Hospital Utrecht. please mail to: ,paspoort at dds.nl ...
Reverse transcription-polymerase chain reaction: …a laboratory technology known as reverse transcription-polymerase chain reaction (RT-PCR), a powerful tool used in research and in the diagnosis of diseases such as cancer.
Nowadays the role of genetic findings in determining the diagnosis, therapy and prognosis of acute myeloid leukemia (AML) has become more valuable. To improve and validate the detection of clonal chromosomal aberrations in leukemia, we designed a combined application of karyotyping with multiplex reverse transcription-polymerase chain reaction (RT-PCR) and fluorescence in situ hybridization (FISH), and addressed the expression and distribution of fusion genes among the subtypes of Chinese adult patients with de novo AML. Multiplex RT-PCR assays were performed on 477 samples from newly diagnosed AML patients, and cytogenetic data were obtained from 373 of them by R or G banding techniques and those in some cases were confirmed by FISH. The PCR products in some suspected cases were tested by two-directional sequencing. The results showed that except unqualified samples, fusion genes were detected by multiplex RT-PCR in 211 of 474 patients (44.51%), including AML1-ETO, CBFβ-MYH11, PML-RARα, ...
Some gene transcripts represented by more than one probe set (each detected similar levels of expression) Cancer Genome Anatoy Project verified expression of many genes Q-RT-PCR -- some of 100 genes selected and measured for transcript levels using Q-RT-PCR --results in agreement with relative levels of microarray gene expression Immunohisotchemical analysis of tumor samples: established protein expression levels of select 100 correlated with mRNA levels from microarray Several genes identified have already been previously shown to be differentially expressed in metastatic prostate cancer ...
Lets set the record straight about DDRT-PCR! This technique recieves an amazing amount of bad press, which I find utterly astonishing given that has major advantages over other methods for identifying differentially expressed genes. It is an extremely powerful tool. I work in a research group of 6 scientists and we all routinely use DDRT-PCR for a variety of different purposes, using RNA extracted from a wide variety of material, ranging from cultured cells, specific tissues to whole embryos. We have been using the technique for the last couple of years with a great deal of success. My particular project is concerned with hunting for brain transcripts up- or down-regulated in developing mouse brain as a direct result of the targeted deletion of a specific gene. This is designed to give us clues as to the function of the encoded protein (the null has no phenotype). For this project I am using whole mouse brains from a variety of wt/null developmental timepoints, which DDRT-PCR allows me to ...
What could be the possible reasons for a RT-PCR experiment that was working fine - posted in PCR, RT-PCR and Real-Time PCR: What could be the possible reasons for a RT-PCR experiment that was working fine to stop working, if nothing was changed? I seem to see quite a few questions about this. And Ive been battling with this problem for quite a few months now.... Thank you! Sakumi
Methods:This study used 63 peripheral blood and bone marrow (PB/BM) samples from children with ALL. Immunophenotyping of PB and BM samples were performed using flow cytometry to illustrate the lineage. Moreover, reverse transcriptase polymerase chain reaction (RT-PCR) technique was used to amplify transcripts of leukemia-specific chromosome fusion gene ETV6/RUNX1 and to monitor the expression levels of the ETV6/RUNX1 in patients according to Van Dongen et al protocol ...
EurobioPlex SARS-CoV-2 is a CE marked test based on real-time reverse-transcription and amplification designed for qualitative determination of absence or…
Fig. 4 Tnnt temporal expression patterns in developing zebrafish embryos as detected by reverse transcriptase-polymerase chain reaction (RT-PCR). Total RNA was isolated from different developmental stages, and primers specific for sMyHC, Tnnt1, Tnnt2, Tnnt3a, and Tnnt3b were used for RT-PCR. β-actin was used as an internal control. Numbers in the right panel indicate the molecular mass of RT-PCR products. ...
In this article explain the finer points of the delta-delta-CT method to calculate up-/down- regulations. The following text is a writeup of a course I gave at a local highschool.
Hepcidin, a peptide hormone that decreases intestinal iron absorption and macrophage iron release, is a potential drug target for patients with iron overload syndromes because its levels are inappropriately low in these individuals. Endogenous stimulants of Hepcidin transcription include bone morphogenic protein 6 (BMP6) and interleukin-6 (IL-6) by effects on mothers against decapentaplegic homolog (Smad)4 or signal transducer and activator of transcription (Stat)3, respectively. We conducted a small-scale chemical screen in zebrafish embryos to identify small molecules that modulate hepcidin expression. We found that treatment with the isoflavone, genistein, from 28-52 hours postfertilization in zebrafish embryos enhanced Hepcidin transcript levels, as assessed by whole-mount in situ hybridization and quantitative real-time reverse-transcriptase polymerase chain reaction. Genisteins stimulatory effect was conserved in human hepatocytes: Genistein treatment of HepG2 cells increased both ...
Aberrant DNA methylation of CpG islands of cancer-related genes is among the earliest and most frequent alterations in cancerogenesis and might be of value for either diagnosing cancer or evaluating recurrent disease. This mechanism usually leads to inactivation of tumour-suppressor genes. We have designed the current study to validate our previous microarray data and to identify novel hypermethylated gene promoters. The validation assay was performed in a different set of 8 patients with colorectal cancer (CRC) by means quantitative reverse-transcriptase polymerase chain reaction analysis. The differential RNA expression profiles of three CRC cell lines before and after 5-aza-2-deoxycytidine treatment were compared to identify the hypermethylated genes. The DNA methylation status of these genes was evaluated by means of bisulphite genomic sequencing and methylation-specific polymerase chain reaction (MSP) in the 3 cell lines and in tumour tissues from 30 patients with CRC. Data from our previous
Aberrant DNA methylation of CpG islands of cancer-related genes is among the earliest and most frequent alterations in cancerogenesis and might be of value for either diagnosing cancer or evaluating recurrent disease. This mechanism usually leads to inactivation of tumour-suppressor genes. We have designed the current study to validate our previous microarray data and to identify novel hypermethylated gene promoters. The validation assay was performed in a different set of 8 patients with colorectal cancer (CRC) by means quantitative reverse-transcriptase polymerase chain reaction analysis. The differential RNA expression profiles of three CRC cell lines before and after 5-aza-2-deoxycytidine treatment were compared to identify the hypermethylated genes. The DNA methylation status of these genes was evaluated by means of bisulphite genomic sequencing and methylation-specific polymerase chain reaction (MSP) in the 3 cell lines and in tumour tissues from 30 patients with CRC. Data from our previous
Cancer stem cells are associated with metastatic potential, treatment resistance, and poor patient prognosis. Distant recurrence remains the major cause of mortality in rectal cancer patients with preoperative chemoradiotherapy (CRT). We investigated the role of three stem cell markers (CD133, OCT4, and SOX2) in rectal cancer and evaluated the association between these gene levels and clinical outcome in rectal cancer patients with preoperative CRT. Thirty-three patients with rectal cancer underwent preoperative CRT. Total RNAs of rectal cancer cells before and after CRT were isolated. Residual cancer cells after CRT were obtained from formalin-fixed paraffin-embedded (FFPE) specimens using microdissection. The expression levels of three stem cell genes were measured using real-time reverse-transcription polymerase chain reaction (RT-PCR). The association between these gene levels and radiation was evaluated using colon cancer cell lines. Immunohistochemical staining of these markers after CRT was also
Among diabetes-susceptibility genes in NOD mice, only Idd-1 has been clearly assigned: Idd-1 could be a gene complex composed of class II major histocompatibility complex (MHC) genes, I-A beta and I-E. Employing restriction fragment length polymorphism (RFLP) analysis and nucleotide sequencing, we revealed that ILI and CTS mice, which are nondiabetic but are derived from the same Jcl-ICR mice as NOD mice, share the same class II MHC genes with NOD mice suggesting that both ILI and CTS mice also possess susceptible Idd-1 genotype. This was supported by a breeding study. To compare the usage of T cell receptor (TCR) V beta genes in NOD mice with that in ILI mice, we employed quantitative reverse-transcriptase polymerase chain reaction (RT-PCR) which revealed that TCR V beta usages of these mice were indistinguishable. RT-PCR method also revealed that the V beta transcript of T cells infiltrating into pancreas of NOD mice was not restricted but was rather diverse. Since NOD and ILI mice share the same
Five potential reference genes for RT-qPCR application, namely histone H3, beta-actin, GAPDH, ubiquitin and 18S rRNA, were evaluated for normalization of gene expression in four selected tissues (liver, kidney, thyroid and abdominal fat). Tissues were derived from fattening pigs exposed to different amounts and type of dietary iodine. Two software applications (geNorm and NormFinder) were used to evaluate the stability of the potential reference genes. All studied genes displayed high expression stability but different stability patterns between the investigated tissues. The results suggest GAPDH and 18S rRNA as reference genes applicable in all tissues investigated. Beta-actin and histone H3 are suitable reference genes for all tissues investigated except fat. In contrast, ubiquitin should be excluded from use as a reference gene in the porcine tissues analyzed due to variations in expression levels, despite the good expression stability.
A multiplex reverse transcription polymerase chain reaction (RT-PCR) protocol was evaluated for the simultaneous detection of Potato leaf roll virus (PLRV), Potato virus X (PVX) and Potato Virus Y (PVY). The multiplex RT-PCR detection of viruses was equally efficient whether RNAs were extracted using commercial kits or a sodium sulphite based nucleic acid extraction procedure. cDNAs were prepared either using a common primer (oligo dT) or specific antisense primer followed by specific primer pairs for PCR. The multiplex RT-PCR separation of strains of PVY was accomplished by using a competitive multiplex RT-PCR (with one antisense and two sense primers). The multi virus or multistrain detection approaches described here have potential application to other crop-virus combinations ...
Identification of potential reference genes. Potential reference genes are identified by (A) geNorm and (B) NormFinder. Low M-value or variability represents th
We report on the identification and genomic characterization of DEIN, a novel gene that exhibits a characteristic expression pattern in primary neuroblastoma. With a combined RACE and RT-PCR approach, the full-length sequences of the main transcript variants of this gene were characterized. According to SAGE, Northern blot, and quantitative real-time RT-PCR, variants A and B represent the major transcripts of DEIN in primary neuroblastoma. These isoforms are strongly expressed in stage IVS tumors, whereas lower expression levels were observed in stage IV tumors. In contrast, expression of transcript variant C did not differ in these stages, as determined by quantitative real-time RT-PCR, and seemed to be expressed at lower levels in neuroblastoma because it could not be detected by Northern blot hybridization and Ct values of quantitative real-time RT-PCR analysis were high (data not shown). In addition, low numbers of SAGE tag ATTTGTTACA corresponding to transcript D suggested that this isoform ...
To inform an example calculation, we use publicly published data for analytic specificity of the Quest Diagnostics reverse transcription polymerase chain reaction assay (likely 100%, minimum 95%, maximum 100%) and an informed but pessimistic assumption regarding the clinical sensitivity of the reverse transcription polymerase chain reaction assay (likely 90%, minimum 65%, maximum 99%). Estimation of population prevalence is challenging: the minimum in this scenario is based on a recent measurement of the prevalence of reverse transcription polymerase chain reaction positivity among asymptomatic individuals in Iceland (0.6%), while our maximum is based on a recently published estimate among asymptomatic parturients at a major academic center (13.8%).6,7 As is the case with nearly all measurements of disease prevalence, both of these estimates were measured in unique populations at specific points in time. We chose a "most likely" prevalence estimate of 1.0% based on preliminary, unpublished data ...
צעד אחד RT-PCR assay לגילוי וזיהוי genogroup של מבודד norovirus מ כיסאות ילדים, אשר מנצל primers ו בדיקות TaqMan ספציפיים מסגרת קריאה...
Reverse transcription polymerase chain reaction (RT‐PCR) expression patterns of the genes coding for Laccaria bicolor Zn finger protein and Ser/Threo protein
Quiescent and proliferating leukemia cells accumulate highly lethal DNA double-strand breaks that are repaired by 2 major mechanisms: BRCA-dependent homologous recombination and DNA-dependent protein kinase-mediated (DNA-PK-mediated) nonhomologous end-joining, whereas DNA repair pathways mediated by poly(ADP)ribose polymerase 1 (PARP1) serve as backups. Here we have designed a personalized medicine approach called gene expression and mutation analysis (GEMA) to identify BRCA- and DNA-PK-deficient leukemias either directly, using reverse transcription-quantitative PCR, microarrays, and flow cytometry, or indirectly, by the presence of oncogenes such as BCR-ABL1. DNA-PK-deficient quiescent leukemia cells and BRCA/DNA-PK-deficient proliferating leukemia cells were sensitive to PARP1 inhibitors that were administered alone or in combination with current antileukemic drugs. In conclusion, GEMA-guided targeting of PARP1 resulted in dual cellular synthetic lethality in quiescent and proliferating ...
Tissue RNA PrepMate™ uses a modified guanidium salt-lysis method to optimally extract total RNA from tissue. The amount of extracted total RNA can differ according to the tissue or cell type, so the starting amount should be adjusted to your needs. The extracted viral RNA can be used as a template of the RT-PCR or quantitative real time RT-PCR and cDNA synthesis, cDNA library construction, Microarray ...
Pregnancy in mammals featuring hemochorial placentation introduces a major conflict with the mothers immune system, which is dedicated to repelling invaders bearing foreign DNA and RNA. Numerous and highly sophisticated ...
This is an historical archive of the activities of the MRC Anatomical Neuropharmacology Unit (MRC ANU) that operated at the University of Oxford from 1985 until March 2015. The MRC ANU established a reputation for world-leading research on the brain, for training new generations of scientists, and for engaging the general public in neuroscience. The successes of the MRC ANU are now built upon at the MRC Brain Network Dynamics Unit at the University of Oxford.. ...
Recently we have reported that intermediate-frequency magnetic field (IF-MF) exposure transiently altered the mRNA expression levels of memory function-related genes in the hippocampi of adult male mice. However, the effects of IF-MF exposure during brain development on neurological biomarkers have not yet been clarified. In the present study, we investigated the effect of IF-MF exposure during development on neurological and immunological markers in the mouse hippocampus in 3- and 7-week-old male mice. Pregnant C57BL/6J mice were exposed to IF-MF (21 kHz, 3.8 mT) for one hour per day from organogenesis period day 7 to 17. At adolescence, some IF-MF-exposed mice were further divided into exposure, recovery, and sham-exposure groups. The adolescent-exposure groups were exposed again to IF-MF from postnatal day 27 to 48. The expression of mRNA in the hippocampi was examined using a real-time RT-PCR method, and microglia activation was examined by immunohistochemical analysis. The expression levels of NR1
Using the laboratory RT-PCR method, we detect the presence of SARS-CoV-2 virus in the body. A negative result can be used to end the quarantine and is required for travelling to and from abroad. The test will take place in a general practitioner's office in Prague. You will usually find out the result the next day after collection. The result will be sent to you by e-mail.
Molecular Cytogenetics and Multiplex Reverse-Transcriptase Polymerase Chain Reaction for Risk Stratification in Acute Myeloid Leukemia ...
Background: Current methodology of gene expression analysis limits the possibilities of comparison between cells/tissues of organs in which cell size and/or number changes as a consequence of the study (e.g. starvation). A method relating the abundance of specific mRNA copies per cell may allow direct comparison or different organs and/or changing physiological conditions. Methods: With a number of selected genes, we analysed the relationship of the number of bases and the fluorescence recorded at a present level using cDNA standards. A lineal relationship was found between the final number of bases and the length of the transcript. The constants of this equation and those of the relationship between fluorescence and number of bases in cDNA were determined and a general equation linking the length of the transcript and the initial number of copies of mRNA was deduced for a given pre-established fluorescence setting. This allowed the calculation of the concentration of the corresponding mRNAs per ...
There are currently no tests available over the counter or at a doctors office that can quickly detect and distinguish between the H7N9 virus and other flu viruses. However, a more sophisticated test that specifically detects H7N9 virus has been developed by CDC for use by qualified public health laboratories in the United States and internationally. This test involves collecting a respiratory tract (i.e., nose, throat, lung) sample from a sick patient. The sample is then sent to a public health laboratory where a procedure known as rRT-PCR (real-time reverse transcriptase polymerase chain reaction) is conducted. rRT-PCR is very accurate and sensitive at detecting flu viruses. This procedure typically provides results within 4 hours; however, the time involved in processing and reporting results may vary depending on the laboratory ...
Main focus of GENE QUANTIFICATION web page is to describe and summarize all technical aspects involved in quantitative gene expression analysis using real-time RT-PCR and competitive RT-PCR. It illustrates the usefulness of absolute and relative quantification assays in real-time PCR and real-time RT-PCR.
In order to identify biomarkers to predict the progression of Type 1 Diabetic Kidney Disease (DKD), we profiled the transcriptome (the set of RNA molecules produced) of leukocytes from 33 type 1 diabetic patients at the time of their enrollment in the study. Patients were followed for a minimum of five years and data were collected including information about the progression of DKD. We will identify genes that correlate to various outcomes with a focus on the decline of kidney function. To validate the expression, we will use a quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR,) a laboratory method that is used to quantify RNA. Validated genes will be further studied in the future with more patients.. ...
ELISA and real-time qRT-PCR analyses demonstrated an increase of VEGF protein and mRNA levels in the inner ear after local EP2 or EP4 agonist application, indicating that the stimulation of EP2 and/or EP4 activates VEGF production in the inner ear ...
Cancer cells. (A) Relative expression levels of Nox1, 2, 3, 4, and 5 mRNAs in A549 cells were determined by real-time RT-PCR and are presented as mean delta Ct
assignmenthelp.net provides the best solution. Our online tutors are available to help you with Polymerase Chain Reaction home work problems.
Test with Confidence. Test with ZEUS. Clinical Performance Studies Four separate cohorts of clinically characterized specimens were tested: COVID-19 RT-PCR Positive Patient Specimens (n=35). The date between EUA-approved PCR test result and specimen draw was 3 to 37 days, with an average of 15.97 days and a median of 14 days.COVID-19 RT-PCR Negative Patient Specimens…
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed ...
Video created by Exploratorium for the course Tinkering Fundamentals: Motion and Mechanisms. A Chain Reaction machine is a deceptively simple concept, but one that allows for an incredibly complex and deep investigation into something we ...
Chain Reaction News. Find breaking news, commentary, and archival information about Chain Reaction From The tribunedigital-thecourant
TY - JOUR. T1 - Dysfunctional gastric emptying with down-regulation of muscle-specific MicroRNAs in helicobacter pylori-infected mice. AU - Saito, Yoshimasa. AU - Suzuki, Hidekazu. AU - Tsugawa, Hitoshi. AU - Suzuki, Sachiko. AU - Matsuzaki, Juntaro. AU - Hirata, Kenro. AU - Hibi, Toshifumi. PY - 2011/1. Y1 - 2011/1. N2 - Background & Aims: Little is known about the pathogenic mechanisms of functional dyspepsia. We investigated the role of microRNAs (miRNAs) in gastric motility disorders associated with Helicobacter pylori infection. Methods: Male C57BL/6 mice were infected with H pylori. After long-term infection, gastric emptying was examined and compared with that of uninfected mice (controls). The miRNA expression profile was analyzed by miRNA microarray and quantitative reverse-transcriptase polymerase chain reaction. The results obtained from the animal study were confirmed by in vitro experiments. Results: Gastric emptying was significantly accelerated in mice after chronic infection with ...
MicroRNAs (miRNAs) are short, non-coding RNAs (~22 nt) that play important roles in the pathogenesis of human diseases by negatively regulating gene expression. Although miR-196a has been implicated in several other cancers, its role in non-small cell lung cancer (NSCLC) is unknown. The aim of the present study was to examine the expression pattern of miR-196a in NSCLC and its clinical significance, as well as its biological role in tumor progression. Expression of miR-196a was analyzed in 34 NSCLC tissues and five NSCLC cell lines by quantitative reverse-transcription polymerase chain reaction (qRT-PCR). The effect of DNA methylation on miR-196a expression was investigated by 5-aza-2-deoxy-cytidine treatment and bisulfite sequencing. The effect of miR-196a on proliferation was evaluated by MTT and colony formation assays, and cell migration and invasion were evaluated by transwell assays. Analysis of target protein expression was determined by western blotting. Luciferase reporter plasmids were
Purpose: We previously revealed that the calreticulin (CRT) gene is a candidate oncogene promoting cell migration and invasion and that neuropilin-1 (NRP1) is a possible effector downstream of CRT in esophageal squamous carcinoma cells. This study aims to explore the mechanisms underlying the migration and invasion of esophageal cancer cells regulated by CRT through NRP1.. Experimental Design: Quantitative reverse-transcription polymerase chain reaction, Western blot analysis, chromatin immunoprecipitation, and reporter gene assays were used to investigate the relationship between CRT and NRP1. In vitro and in vivo assays were carried out to evaluate the effects of NRP1 on malignant phenotypes of ESCC cells and tumor metastasis in NOD/SCID mice. Immunohistochemistry was performed to analyze the expression of CRT and NRP1 in esophageal squamous cell carcinomas (ESCC).. Results: Knockdown of CRT decreased the expression of NRP1. Inhibition of NRP1 reduced ESCC cell motility in vitro and ...
PubMed journal article Kallikrein-related peptidase 4 gene (KLK4) in prostate tumors: quantitative expression analysis and evaluation of its clinical significanc were found in PRIME PubMed. Download Prime PubMed App to iPhone, iPad, or Android
Polyunsaturated fatty acid (PUFA)-activated two-pore domain potassium channels (K2P ) have been proposed to be expressed in the pulmonary vasculature. However, their physiological or pathophysiological roles are poorly defined. Here, we tested the hypothesis that PUFA-activated K2P are involved in pulmonary vasorelaxation and that alterations of channel expression are pathophysiologically linked to pulmonary hypertension. Expression of PUFA-activated K2P in the murine lung was investigated by quantitative reverse-transcription polymerase chain reaction (qRT-PCR), immunohistochemistry (IHC), by patch clamp (PC) and myography. K2P -gene expression was examined in chronic hypoxic mice. qRT-PCR showed that the K2P 2.1 and K2P 6.1 were the predominantly expressed K2P in the murine lung. IHC revealed protein expression of K2P 2.1 and K2P 6.1 in the endothelium of pulmonary arteries and of K2P 6.1 in bronchial epithelium. PC showed pimozide-sensitive K2P -like K(+) -current activated by docosahexaenoic ...
Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) is a rapid and sensitive approach to identify miRNA and protein-coding gene expression in plants. However, because of the specially designated reverse transcription and shorter PCR products, very few reference genes have been identified for the quantitative analysis of miRNA expression in plants, and different internal reference genes are needed to normalize the expression of miRNAs and mRNA genes respectively. Therefore, it is particularly important to select the suitable common reference genes for normalization of quantitative PCR of miRNA and mRNA. In this study, a modified reverse transcription PCR protocol was adopted for selecting and validating universal internal reference genes of mRNAs and miRNAs. Eight commonly used reference genes, four stably expressed novel genes in Populus tremula, three small noncoding RNAs and three conserved miRNAs were selected as candidate genes, and the stability of their expression was examined
Introduction: Post-operative atrial fibrillation (POAF) develops in 1/3 of patients undergoing cardiac surgery and is associated with significant morbidity and mortality. MicroRNAs (miRs) are gene regulators linked to pathological atrial remodeling. Although genetic factors are implicated in susceptibility to POAF, no studies, to our knowledge, have examined atrial miR expression in relation to POAF.. Hypothesis: Changes in miR expression (estimated as fold difference in the delta cycle threshold compared to global mean) in human atria can be associated with POAF.. Methods: Atrial tissue (26 from right atrium; 2 from left atrium) was obtained from 28 participants with no history of atrial fibrillation undergoing elective cardiac surgery (36% coronary artery bypass grafting, 50% valve replacement and 14% combined surgeries or others). Based on pilot data and prior literature, the expression of 82 miRs was quantified using high-throughput quantitative reverse-transcriptase polymerase chain ...
In order to better understand cellular responses to viral infection at the transcriptional level, we employed differential display RT-PCR to analyze mRNAs from RD rhabdomyosarcoma cells following infection with a neurovirulent enterovirus 71 (EV71) strain, compared with mRNAs from uninfected cells. Of 250 expressed sequence tags (ESTs) isolated, sequenced, and identified, all were of cellular origin except 1 that was of viral origin. Of these, 156 were individual distinctive clones, comprising 45 mRNAs showing unaltered expression and 111 mRNAs exhibiting upregulation or downregulation. Of the 45 uniformly expressed mRNAs, 14 represented unknown genes. Of the 111 differentially expressed mRNAs, 63 did not match any known genes. Forty-eight of the 111 mRNAs modified by EV71 infection matched known genes, including those encoding components of cell cycle, cytoskeleton, and cell death mediators; protein degradation mediators; mitochondrial-related proteins; components of protein translation and ...
TY - JOUR. T1 - High-throughput real-time RT-PCR assay to detect the exotic Newcastle Disease Virus during the California 2002-2003 outbreak. AU - Crossley, Beate. AU - Hietala, Sharon K.. AU - Shih, Liu Mei. AU - Lee, Lou. AU - Skowronski, Evan W.. AU - Ardans, Alex. PY - 2005/3. Y1 - 2005/3. N2 - During the 2002-2003 Exotic Newcastle Disease (END) outbreak in Southern California, a high-throughput real-time reverse transcriptase-polymerase chain reaction (RRT-PCR) system was developed to respond to the large diagnostic and surveillance sample workload. A 96-well RNA extraction method, using magnetic bead technology, combined with a 96-well RRT-PCR assay, allowed 1 technician to process and test more than 400 samples per day. A 3-technician team could complete testing on approximately 1,900 samples per day. The diagnostic sensitivity of the high-throughput RRT-PCR assay was 0.9967 (95% CI 0.9937-0.9997) based on 926 virus isolation confirmed positive samples. Diagnostic specificity using an ...
Thank you for your interest in spreading the word about Haematologica.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.. ...
MicroRNAs (miRs) have been identified as critical regulatory molecules in myocardial ischemia/reperfusion injury; however, the exact expression profile of miR-199a-5p in reperfusion injury and the underlying pathogenic mechanisms remain unclear. In the present study, it was revealed that miR-199a-5p expression was significantly increased in the plasma of patients with acute myocardial infarction and in a H9c2 cell model of oxygen-glucose deprivation and reperfusion (OGD/R) via reverse transcription-quantitative PCR. H9c2 cells were transfected with miR-199a-5p mimic or inhibitor, or short interfering RNA (siRNA) specific to hypoxia-inducible factor-1α (HIF-1α). MTS, lactate dehydrogenase (LDH), TUNEL staining and flow cytometry assays were performed to determine the proliferation, LDH activity, apoptosis and mitochondrial membrane potential (ΔΨm) of H9c2 cells, respectively. The overexpression of miR-199a-5p in the OGD/R cell model significantly decreased the viability and increased the ...
Real-time reverse-transcriptase Staurosporine purchase polymerase chain reaction (RT-PCR) was performed, as described previously,23 in a 96-well plate using a Bio-Rad iCycler iQ. The sequences of forward and reverse primers used for amplification are represented in Table 1. For each gene, a standard curve was established from four cDNA dilutions (1/10 to 1/10,000) and was used to determine relative gene-expression variation after normalization, with a geometric average of 18S and TATA box-binding protein expression. Results are expressed as means ± standard error of the mean (SEM). Data were subjected to one-way analysis of variance,. followed by the Tukey-Kramer post-hoc test. Differences were considered significant at P < 0.05. Concordant arguments from in vivo and in vitro studies suggest that hepatic expression of CB1R is submitted to an autoregulation process. HM781-36B cell line Activation of ECS by high-fat diets or by agonists is associated with an increase in the expression of CB1R, ...
We first examined whether there is any change in the expression of ARMS2 and HTRA1 between normal aged and AMD retinas without genotype constraints. The aged retinas were obtained from 20 unrelated individuals (average age=71.8 year), while the AMD group consisted of 12 retinas (average age=77.1 year). Gene expression was measured by real-time qRT-PCR and normalized to rRNA expression, with aged normal retinas as a reference. There was no significant difference in either ARMS2 or HTRA1 mRNA expression levels between the two groups (ARMS2, fold change average=1.051, p=0.487; HTRA1, fold change average=0.991, p=0.918). As predicted, the housekeeping genes (used as controls), HPRT1 and GAPDH, did not show significant change in expression with age (fold change average=0.963, p=0.376 and fold change average=0.997, p=0.934), validating a high quality of RNA from the human retinas for qRT-PCR analysis. To determine changes in RNA expression due to aging, we compared the gene expressions of normal young ...
MicroRNA-like RNAs (milRNAs) are short non-coding regulatory sRNAs which play an important role in regulating gene expression at the post-transcriptional level by targeting mRNAs for degradation or inhibiting protein translation. To explore the presence of milRNAs in Fusarium oxysporum f. sp. niveum (Fon) and analyze their expression at different propagules, two categories of sRNAs were identified ...
The quantitative polymerase chain reaction (qPCR) is a relatively new technique that combines the reliabiity of regular PCR with real-time screening.
Assessment of the reverse transcriptase polymerase chain reaction technique in the determination of the mRNA expression for the testicular angiotensin-converting enzyme in zinc treated rats ...
Sigma-Aldrich offers abstracts and full-text articles by [Youichi Higuchi, Motohiro Kojima, Genichiro Ishii, Kazuhiko Aoyagi, Hiroki Sasaki, Atsushi Ochiai].
cDNA library screening. A cDNA library constructed by H. Okayama (unpublished data) using mRNA from MCA16 cells (C3H10T1/2 mouse cells transformed by 3-methylcholanthrene; Shih et al., 1979) was screened with a 32P-labeled 782 bp PCR fragment (106 cpm/ml) coding for the motor domain of HsEg5 (human Eg5; nt 327-1109, accession number X85137; Blangy et al., 1995). A total of 1.5 × 105 colonies were transferred to nitrocellulose filters (Schleicher and Schuell, Keene, NH) and hybridized at 60°C for 24 hr in a hybridization buffer (6× SSC, 0.5× Denhardts solution, 0.1% SDS). Filters were washed four times at 60°C for 15 min in a solution containing 6× SSC and 0.5% SDS. Positive colonies were purified, and inserts were subcloned into pBluescript KS+ plasmid (Stratagene, La Jolla, CA). The remaining 120 bp at the 5′ end of the cDNA were obtained with a RT-PCR-based method using mRNA from mouse L cells primed with 5′ primer (5′-ATCTCGAGAACCATGGCGTCCCAGCCGAGTTC-3′) derived from genomic ...
We set out to investigate the serological response of TBE virus (TBEV)-specific IgM and IgG antibodies in stored serum and cerebrospinal fluid (CSF) in notified TBE patients, in order to confirm or reject the diagnosis. We applied the ELISA methods used in clinical practice, Enzygnost and Immunozym, and assessed RT-PCR as a diagnostic tool. A total of 173 TBE cases were notified to the Public Health Agency. Samples from 129 patients were eligible for the study. Stored serum samples were found for 111 patients and CSF samples for 88 patients. All serum samples were analyzed with both Enzygnost and Immunozym, as well as an additional 140 control samples. CSF samples, including samples from ten controls, were analyzed with Immunozym. RT-PCR for TBEV was performed on 126 serum, two whole blood, 96 CSF, two feces and four nasopharynx samples. Only two of 111 notified patients lacked detectable TBEV IgM in serum, from whom one sample was RT-PCR positive. According to the ECDC definition, 117/129 ...
Bioz Stars score, Techniques, Protocol Conditions and more for Polymerase Chain Reaction Pcr, supplied by . Data for Polymerase Chain Reaction Pcr gathered from related PubMed articles.
A literature search for non-uniform distributions of P values shows few citations [3, 5] and these both relate to statistical tests applied to expression results generated using Affymetrix microarrays. Huang et al. [5] compare gene expression profiles of tumours in three groups of mice using an Affymetrix Mouse Genechip array. When an ANOVA was performed on the expression of around 23,000 genes, a distribution of P values similar to Figure 1 was obtained. However when a t-test was applied to 2 of these groups, a distribution of P values similar to Figure 3 was obtained. The authors hypothesised that the reason for such a non-uniform distribution was due to excess biological similarity between some samples in the groups used for the t-test. This excess biological similarity was thought to be due to 2 pairs of samples being littermates of the same age and a further 2 pairs of samples were assayed at the same time. This resulted in the samples used for the t-test not being statistically ...
According to Stratistics MRC, the Global Polymerase Chain Reaction market is accounted for $6.95 billion in 2015 and is expected to reach $12.56 billion by...
Transparency Market Research (TMR) has recently published a market study on the global polymerase chain reaction (PCR) market, stating that...
Explore the structure of animal, plant, and bacteria cells along with their associated viruses with our three-dimensional graphics.
Targeting viral proteins early during infection may limit exacerbation of human cytomegalovirus infection. The viral chemokine-receptor homologue US28 interferes with leukocyte trafficking and, possibly, viral replication. Because US28 molecules are abundant on the surface of infected cells, this homologue is a potential target for antiviral therapy. To assess the relationship between US28 and disease activity, we measured, by quantitative reverse-transcription polymerase chain reaction, the levels of US28 and immediate-early (IE) 1 gene transcripts in the blood of lung-transplant recipients. We found that, during primary and secondary infection, the IE1 and US28 genes have early transcription kinetics and are expressed at similar levels. This may render US28 an attractive target for antiviral therapy ...
A neonate born to an Ebola virus-positive woman was diagnosed with Ebola virus infection on her first day of life. The patient was treated with monoclonal antibodies (ZMapp), a buffy coat transfusion from an Ebola survivor, and the broad-spectrum antiviral GS-5734. On day 20, a venous blood specimen tested negative for Ebola virus by quantitative reverse-transcription polymerase chain reaction. The patient was discharged in good health on day 33 of life. Further follow-up consultations showed age-appropriate weight gain and neurodevelopment at the age of 12 months. This patient is the first neonate documented to have survived congenital infection with Ebola virus ...
TY - JOUR. T1 - Quantitative real-time polymerase chain reaction (qRT-PCR) restriction fragment length polymorphism (RFLP) method for monitoring highly conserved transgene expression during gene therapy. AU - Bruzzone, Carol M.. AU - Belcher, John D.. AU - Schuld, Nathan J.. AU - Newman, Kristal A.. AU - Vineyard, Julie. AU - Nguyen, Julia. AU - Chen, Chunsheng. AU - Beckman, Joan D.. AU - Steer, Clifford J.. AU - Vercellotti, Gregory M.. PY - 2008/12. Y1 - 2008/12. N2 - Evaluation of the transfer efficiency of a rat heme oxygenase-1 (HO-1) transgene into mice requires differentiation of rat and mouse HO-1. However, rat and mouse HO-1 have 94% homology; antibodies and enzyme activity cannot adequately distinguish HO-1. We designed a quantitative real-time polymerase chain reaction (qRT-PCR) method to monitor HO-1 transcription relative to a housekeeping gene, GAPDH. The ratio of rat and mouse HO-1 mRNA could be estimated through restriction fragment length polymorphism (RFLP) analysis of the PCR ...
TY - JOUR. T1 - Hepatitis e virus (HEV) detection and quantification by a real-time reverse transcription-PCR assay calibrated to the world health organization standard for HEV RNA. AU - Germer, Jeffrey J.. AU - Ankoudinova, Irina. AU - Belousov, Yevgeniy S.. AU - Mahoney, Walt. AU - Dong, Chen. AU - Meng, Jihong. AU - Mandrekar, Jayawant. AU - Yao, Joseph D.. PY - 2017/5/1. Y1 - 2017/5/1. N2 - Hepatitis E virus (HEV) has emerged as a cause of chronic hepatitis among immunocompromised patients. Molecular assays have become important tools for the diagnosis and management of these chronically infected patients. A real-time reverse transcription-quantitative PCR (RT-qPCR) assay utilizing Pleiades probe chemistry and an RNA internal control for the simultaneous detection and quantification of HEV RNA in human serum was developed based on an adaptation of a previously described and broadly reactive primer set targeting the overlapping open reading frame 2/3 (ORF2/3) nucleotide sequence of HEV. A ...
We describe an improvement of an earlier reported real-time RT-PCR assay for the detection of enterovirus RNA, based on the 5 exonuclease digestion of a dual-labeled fluorogenic probe by Taq DNA polymerase. A different extraction method, real-time RT-PCR instrument and primer set were evaluated. Our data show that the optimized assay yields a higher sensitivity and reproducibility and resulted in a significant reduced hands-on time per sample.
PubMed Central Canada (PMC Canada) provides free access to a stable and permanent online digital archive of full-text, peer-reviewed health and life sciences research publications. It builds on PubMed Central (PMC), the U.S. National Institutes of Health (NIH) free digital archive of biomedical and life sciences journal literature and is a member of the broader PMC International (PMCI) network of e-repositories.
TY - JOUR. T1 - MRNA quantification after fluorescence activated cell sorting using locked nucleic acid probes. AU - Maruo, Rie. AU - Yamada, Hiroya. AU - Watanabe, Mikio. AU - Hidaka, Yoh. AU - Iwatani, Yoshinori. AU - Takano, Toru. PY - 2011/9/1. Y1 - 2011/9/1. N2 - Recently, we have established an in-tube in situ hybridization method named mRNA quantification after fluorescence activated cell sorting (FACS-mQ), in which a specific RNA in a particular cell type is stained with a florescent dye, allowing the stained cells to be selected by FACS without suffering excessive RNA degradation. Using this method, the biological characteristics of the sorted cells can be determined by analyzing their gene expression profile. In this study, we used locked nucleic acid (LNA) oligonucleotides, which are known to enhance both the sensitivity and specificity of RNA detection, as hybridization probes in FACS-mQ. When we used a LNA probe targeting the human 28S sequence, we were able to efficiently separate ...
Real time quantitative PCR (qPCR) and semi-quantitative PCR Transcript detection analysis was carried out by real time quantitative PCR (qPCR) with HotStarTaq DNA Polymerase (Qiagen). Selected genes were amplified from normalized cDNA samples (5 ml) with specific primers (0.8 µM of each primer) and probes (0.5 µM each probe) for Salmonella dnaK gene (accession no. U58360.1) and groEL gene (accession no. 1255856) were designed in this study with Primer3 software v.0.4.0: dnaK-Salm-FP 5accggtaactgaagccgtta3; dnaK-Salm-RP 5cgccatcaacttcgtcgatt3; dnaK-Salm-P 5FAM-gctggcttacggtctggata-TAMRA3; groEL-Salm-FP 5tgcaggatatcgctaccctg3; groEL-Salm-RP 5ctggatggcagcttcttcac3; groEL-Salm-P 5FAM-acaccaccaccatcatcgat3. The specific primers and probe for 16S rRNA gene (accession no.L26168) were designed by Vanghele (2013). For the semi-quantitative PCR, the amplicons were analysed on 1.5% agarose gel and visualized by ethidium bromide staining. Amplification program (iQ5 Real Time PCR ...
1. Chockalingm A, Campbell NR, Fodor JG. Worldwide epidemic of hypertension. Can J Cardio. 2006;22:553-555 2. Tomson J, Lip GYH. Blood Pressure demographic: nature or nurture…… genes or environment?. BMC Med. 2005;3:3 3. WHO. World Health Report 2002: Reducing Risks, Promoting Healthy life. Geneva: World Health Organization. 2002 4. Heller RA. et al. Discovery and analysis of inflammatory disease related genes using cDNA microarrays. Proc Nat Acad Sci. 1997;94:2150- 2155 5. Lockhart DJ, Dong H, Byrne MC, Follettie MT, Gallo MV, Chee MS, Mittmann M, Wang C, Kobayashi M, Horton H, Brown EL. Expression monitoring by hybridization to high-density oligonucleotide arrays. Nat Biotechnol. 1996;14:1675-80 6. Tzouvelekis A, Patlakas G, Bouros D. Application of Microarray Technology in pulmonary diseases. Respir Res. 2004;5:26 7. King HC, Sinha AA. Gene expression profile analysis by DNA microarrays: promise and pitfalls. JAMA. 2001;286:2280-2288 8. LI JJ. Inflammation in hypertension: primary ...
Cholesterol sulfate (CS) is a component of cell membranes that plays a role in stabilizing the cell membrane. We previously reported that CS increased in the endometrium during implantation, suggesting that CS plays an important role in reproduction. It has been reported that CS regulates progesterone and pregnenolone production in the placenta, adrenal glands and ovary. The regulatory mechanisms of steroid hormone production by CS, however, are still unknown. In the present study, we investigated the effect of CS on the expression of progesterone production-related genes in KGN cells, derived from human granulosa-like tumor. KGN cells were cultured with CS (10 μM) or cholesterol (10 μM) in the presence of 8-bromo-cAMP (1 mM). Progesterone levels in the culture media were measured by enzyme linked fluorescent assay at 24 h after treatment of CS and cAMP. Total RNAs were extracted for quantitative real time RT-PCR with specific primer of StAR protein, P450scc, HSD3B2, ferredoxin and ferredoxin ...
Search Results for Quantitative Real Time Pcr Qpcr on Bioz, providing objective ratings for all products used in life science research.
Two main patterns of gene expression of Streptococcus pneumoniae were observed during infection in the host by quantitative real time RT-PCR; one was characteristic of bacteria in blood and one of bacteria in tissue, such as brain and lung. Gene expression in blood was characterized by increased expression of pneumolysin, pspA and hrcA, while pneumococci in tissue infection showed increased expression of neuraminidases, metalloproteinases, oxidative stress and competence genes. In vitro situations with similar expression patterns were detected in liquid culture and in a newly developed pneumococcal model of biofilm respectively. The biofilm model was dependent on addition of synthetic competence stimulating peptide (CSP) and no biofilm was formed by CSP receptor mutants. As one of the differentially expressed gene sets in vivo were the competence genes, we exploited competence-specific tools to intervene on pneumococcal virulence during infection. Induction of the competence system by the ...
Background In this study, we investigated whether PKR protein expression is correlated with mRNA levels and also evaluated molecular biomarkers that are associated with PKR, such as phosphorylated PKR (p-PKR) and phosphorylated eIF2α (p-eIF2α). Methodology and Findings We determined the levels of PKR protein expression and mRNA in 36 fresh primary lung tumor tissues by using Western blot analysis and real-time reverse-transcriptase PCR (RT-PCR), respectively. We used tissue microarrays for immunohistochemical evaluation of the expression of p-PKR and p-eIF2α proteins. We demonstrated that PKR mRNA levels are significantly correlated with PKR protein levels (Spearmans rho = 0.55, p|0.001), suggesting that PKR protein levels in tumor samples are regulated by PKR mRNA. We also observed that the patients with high p-PKR or p-eIF2α expression had a significantly longer median survival than those with little or no p-PKR or p-eIF2α expression (p = 0.03 and p = 0.032, respectively). We further evaluated
In this study, we analyzed the expression of type I growth factor receptor gene family in a large series of primary breast cancers to establish the relationships between expression and the pathological, clinical, and biological parameters and the clinical outcome. The expression was quantified with a real-time RT-PCR assay. We recently developed a one-step RT-PCR method for the routine quantification of c-erbB-2 expression using a 7700 ABI PRISM sequence detector system (Perkin-Elmer-Applied Biosystems; Ref. 23 ). On the basis of this experience, we adapted the method to quantify the expression of the three other genes of the type I growth factor receptor family. The TBP gene was used to normalize the expression of the type I growth factor receptors. The use of TBP as a control RNA was relevant in these studies investigating prognosis because we observed that its expression was not associated with tumor aggressiveness (data not shown), in contrast with the widely used glyceraldehyde-3-phosphate ...
In biological research the analysis of gene expression levels in cells and tissues can be a powerful tool to gain insights into biological processes. For this, quantitative RT-PCR (RT-qPCR) is a popular method that often involve the use of constitutively expressed endogenous reference (or housekeeping) gene for normalization of data. Thus, it is essential to use reference genes that have been verified to be stably expressed within the specific experimental setting. Here, we have analysed the expression stability of 12 commonly used reference genes (Actb, B2m, Gapdh, Hprt, Pgk1, Rn18s, Rpl13a, Rps18, Rps29, Sdha, Tbp and Ubc) across several juvenile and adult rat tissues (liver, adrenal, prostate, fat pad, testis and ovaries), both under normal conditions and following exposure to various chemicals during development. Employing NormFinder and BestKeeper softwares, we found Hprt and Sdha to be amongst the most stable genes across normal and manipulated tissues, with several others also being suitable
This is a temporary file and hence do not link it from a website, instead link the URL of this page if you wish to link the PDF file ...
Poon, L.L.M.; Peiris, J.S.Malik., 2008: Detection of group 1 coronaviruses in bats using universal coronavirus reverse transcription polymerase chain reactions
TY - JOUR. T1 - Serum dickkopf-1 as a biomarker for the diagnosis of hepatocellular carcinoma. AU - Kim, Seung Up. AU - Park, Jeon Han. AU - Kim, Hyon Suk. AU - Lee, Jae Myun. AU - Lee, Hyun Gyu. AU - Kim, Hyemi. AU - Choi, Sung Hoon. AU - Baek, Shinhwa. AU - Kim, Beom Kyung. AU - Park, Jun Yong. AU - Kim, Do Young. AU - Ahn, Sang Hoon. AU - Lee, Jong Doo. AU - Han, Kwang Hyub. PY - 2015/9/1. Y1 - 2015/9/1. N2 - Purpose: Dickkopf-1 (DKK-1) is a Wnt/β-catenin signaling pathway inhibitor. We investigated whether DKK-1 is related to progression in hepatocellular carcinoma (HCC) cells and HCC patients. Materials and Methods: In vitro reverse-transcription polymerase chain reaction (RT-PCR), wound healing assays, invasion assays, and ELISAs of patient serum samples were employed. The diagnostic accuracy of the serum DKK-1 ELISA was assessed using receiver operating characteristic (ROC) curves and area under ROC (AUC) analyses. Results: RT-PCR showed high DKK-1 expression in Hep3B and low in 293 ...
A novel nested reverse-transcriptase polymerase chain reaction method for rapid hepatitis C virus detection and genotyping. Saha, K.; Firdaus, R.; Biswas, A.; Mukherjee, A.; Sadhukhan, P. C. // Indian Journal of Medical Microbiology;Apr2014, Vol. 32 Issue 2, p130 Rapid and specific detection of viral nucleic acid is increasingly important in the diagnosis of infectious diseases. The objective was to develop a rapid, efficient process of nucleic acid based detection of hepatitis C virus (HCV) infection for its diagnosis and treatment follow-up. Materials... ...
TY - JOUR. T1 - Sustained upregulation of inflammatory chemokine and its receptor in aneurysmal and occlusive atherosclerotic disease. T2 - Results from tissue analysis with cDNA macroarray and real-time reverse transcriptional polymerase chain reaction methods. AU - Yamagishi, Masakazu. AU - Higashikata, Takeo. AU - Ishibashi-Ueda, Hatsue. AU - Sasaki, Hiroaki. AU - Ogino, Hitoshi. AU - Iihara, Koji. AU - Miyamoto, Susumu. AU - Nagaya, Noritoshi. AU - Tomoike, Hitonobu. AU - Sakamoto, Aiji. PY - 2005/12/1. Y1 - 2005/12/1. N2 - Background: Although cytokines are known to be pivotal in the development of atherosclerotic diseases, few data exist regarding their expressions in the established stages such as aneurysmal or occlusive lesions. Therefore, in the present study the gene expression levels of cytokine-related substances in abdominal aortic aneurysm (AAA) and carotid artery stenosis (CAS) were determined using cDNA macroarray and real-time reverse transcriptase polymerase chain reaction ...
Gene expression studies employing real-time PCR has become an intrinsic part of biomedical research. Appropriate normalization of target gene transcript(s) based on stably expressed housekeeping genes is crucial in individual experimental conditions to obtain accurate results. In multiple sclerosis (MS), several gene expression studies have been undertaken, however, the suitability of housekeeping genes to express stably in this disease is not yet explored. Recent research suggests that their expression level may vary under different experimental conditions. Hence it is indispensible to evaluate their expression stability to accurately normalize target gene transcripts. The present study aims to evaluate the expression stability of seven housekeeping genes in rat granule neurons treated with cerebrospinal fluid of MS patients. The selected reference genes were quantified by real time PCR and their expression stability was assessed using GeNorm and NormFinder algorithms. Both methods reported transferrin
Molecular characterization of two rocio flavivirus strains isolated during the encephalitis epidemic in são paulo state, brazil and the development of a one-step rt-pcr assay for diagnosis; Caracterização molecular de duas cepas do flavivírus Rocio, isoladas durante a epidemia de encefalite no Estado de São Paulo, Brasil e desenvolvimento do teste one-step RT-PCR para ...
The Ct or threshold cycle value is the cycle number at which the fluorescence generated within a reaction crosses the fluorescence threshold, a fluorescent signal significantly above the background fluorescence. At the threshold cycle, a detectable amount of amplicon product has been generated during the early exponential phase of the reaction. The threshold cycle is inversely proportional to the original relative expression level of the gene of interest ...
Voltage-dependent K(+) channels play a pivotal role in controlling cellular excitability within the nervous system. The aim of the present study was to investigate the expression in the adult rat brain of the three ether-a-gogo-related gene (ERG) family members ERG1, ERG2, and ERG3, encoding for K(+) channel subunits. To this aim, the distribution of ERG transcripts was studied by means of reverse-transcription polymerase chain reaction (RT-PCR) and nonradioactive in situ hybridization histochemistry (NR-ISH). Furthermore, ERG1 subunit distribution was studied by immunohistochemical analysis. RT-PCR analysis revealed ERG1, ERG2, and ERG3 expression in the olfactory bulb, cerebral cortex, hippocampus, hypothalamus, and cerebellum. NR-ISH experiments detected transcripts encoded by all three ERG genes in the cerebral cortex and in all CA subfields and in the granular cell layer of the dentate gyrus of the hippocampus; strong ERG1 signals were also detected in scattered large elements throughout ...
Chinese people; Western blotting; amino acids; anti-inflammatory activity; aspartate transaminase; asthma; blood serum; collagen; enzyme-linked immunosorbent assay; eosin; epinephrine; gene expression; guinea pigs; histopathology; immunoglobulin E; inflammation; interleukin-13; interleukin-4; interleukin-5; lungs; mass spectrometry; messenger RNA; metabolism; metabolites; metabolomics; ovalbumin; phospholipids; phosphorylation; protective effect; quantitative polymerase chain reaction; reverse transcriptase polymerase chain reaction; signal transduction; sphingolipids; staining; therapeutics; transcription factor NF-kappa B; ultra-performance liquid ...
in British Journal of Haematology (2012), 156(1), 76-88. The PRDM16 (1p36) gene is rearranged in acute myeloid leukaemia (AML) and myelodysplastic syndrome (MDS) with t(1;3)(p36;q21), sharing characteristics with AML and MDS with MECOM (3q26.2) translocations ... [more ▼]. The PRDM16 (1p36) gene is rearranged in acute myeloid leukaemia (AML) and myelodysplastic syndrome (MDS) with t(1;3)(p36;q21), sharing characteristics with AML and MDS with MECOM (3q26.2) translocations. We used fluorescence in situ hybridization to study 39 haematological malignancies with translocations involving PRDM16 to assess the precise breakpoint on 1p36 and the identity of the partner locus. Reverse-transcription polymerase chain reaction (PCR) was performed in selected cases in order to confirm the partner locus. PRDM16 expression studies were performed on bone marrow samples of patients, normal controls and CD34(+) cells using TaqMan real-time quantitative PCR. PRDM16 was rearranged with the RPN1 (3q21) locus in ...
Our portfolio of mRNA gene expression products include sample to insight solutions to enable quick, reliable gene expression analysis. As a leader in the field of high-performance SYBR® Green real-time PCR analysis, our qRT-PCR assays and arrays with comprehensive, easy-to-use data analysis tools deliver focused and accurate results, allowing you to overcome the bottlenecks in your gene expression studies. We provide you with the products that allow you to spend less time at the bench and more time interpreting your results ...
Fig. 4. ESR1 recruits HDAC1 to the ASE region to exclude p300 from the Xnr1-dependent transcriptional complex. (A) The experimental strategy of animal cap assay. Zygotic transcription starts at stage 8. (B) Twenty pg activin RNA was injected into 2-cell-stage embryos with or without 100 pg E1A RNA and animal caps were dissected at the stage 8. Caps were cultured until sibling embryos reached stage 10, and Pitx2 gene expression was evaluated by semi-quantitative RT-PCR analysis. (C) Two ng flag-p300 RNA and/or 20 pg activin RNA was injected into 2-cell-stage embryos with or without 2 ng HA-ESR1 RNA, and embryonic extracts were isolated at stage 10 for ChIP analysis. ChIP assays were performed using α-flag antibody. (D) Twenty pg activin RNA was injected into 2-cell-stage embryos with or without 2 ng HA-ESR1 RNA, and animal caps were dissected at the stage 8. Caps were cultured with or without 50 nM TSA until sibling embryos reached stage 10, and Pitx2 gene expression was evaluated by ...
Touch DNA evidence is increasingly being collected and analyzed during criminal investigations. The purpose of this study was to determine if a significant amount of male (suspect) touch DNA can be collected from the clothes of assaulted victims after varying time intervals. A "grab and struggle" model was used to ...