The low-density lipoprotein receptor gene family codes for a class of structurally related cell surface receptors that fulfill diverse biological functions in different organs, tissues, and cell types. The role that is most commonly associated with this evolutionarily ancient family is cholesterol homeostasis (maintenance of appropriate concentration of cholesterol). In humans, excess cholesterol in the blood is captured by low-density lipoprotein (LDL) and removed by the liver via endocytosis of the LDL receptor. Recent evidence indicates that the members of the LDL receptor gene family are active in the cell signalling pathways between specialized cells in many, if not all, multicellular organisms. There are seven members of the LDLR family in mammals, namely: LDLR VLDL receptor (VLDLR) ApoER2, or LRP8 Low density lipoprotein receptor-related protein 4 also known as multiple epidermal growth factor (EGF) repeat-containing protein (MEGF7) LDLR-related protein 1 LDLR-related protein 1b Megalin. ...
TY - JOUR. T1 - Lack of association of very low density lipoprotein receptor gene polymorphism with caucasian Alzheimers disease. AU - Okuizumi, Kaoru. AU - Onodera, Osamu. AU - Seki, Koji. AU - Tanaka, Hajime. AU - Namba, Yoshio. AU - Ikeda, Kazuhiko. AU - Saunders, Ann M.. AU - Pericak-Vance, Margaret A. AU - Roses, Allen D.. AU - Tsuji, Shoji. PY - 1996/8/1. Y1 - 1996/8/1. N2 - To determine whether the association of the very low density lipoprotein receptor (VLDL-R) gene with AIzheimers disease (AD), which has recently been identified in Japanese AD patients, is commonly observed in AD patients of other ethnic backgrounds, we have investigated the allele frequency of the polymorphic CGG repeat in the 5-UTR of the VLDL-R gene using a data set of 84 caucasian AD patients with 104 caucasian controls. Although the allele frequency of the 8-repeat allele was slightly lower, and that of 9-repeat allele was slightly higher, in the caucasian AD patients than in caucasian controls, the differences ...
Background: Clinical studies have demonstrated that remnant lipoproteins play an important role in atherogenesis, and we have previously reported that very low-density lipoprotein receptor (VLDL-R), one of the major receptors for remnant lipoproteins, is involved in foam cell formation. Recent studies have indicated that the oxygenation state of atherosclerotic plaques vary with plaque thickness. Therefore, the goal of the present study was to determine the effect of hypoxia on VLDL-R expression in macrophages and vascular smooth muscle cells and to characterize the role of hypoxia-inducible factor-1 (HIF-1) in hypoxia-induced changes in VLDL-R expression.. Methods and Results: The expression of VLDL-R was assayed by real-time PCR and Western blot analysis in THP-1 macrophages and in human coronary artery smooth muscle cells (HCASMC). Treatment of THP-1 macrophages and HCASMC with CoCl2 resulted in upregulation of VLDL-R mRNA (4.5-fold in macrophages and 3.6-fold in HCASMC, respectively) and ...
Exchange of small molecules between cells through intercellular junctions is a widespread phenomenon implicated in many physiological and developmental processes. This type of intercellular communication can restore the activity of low-density lipoprotein (LDL) receptors in mammalian cells that are deficient in the enzyme UDP-Gal/UDP-GalNAc 4-epimerase. Pure cultures of the 4-epimerase mutant are unable to synthesize normal carbohydrate chains on LDL receptors and many other glycoproteins and therefore do not express LDL receptor activity. When these cells are cocultivated with cells expressing normal 4-epimerase activity, the structure and function of LDL receptors are restored to normal by the transfer of this enzymes products through intercellular junctions. The formation of functional junctions does not require normal glycosylation of membrane proteins. Because many convenient assays and selections for LDL receptor activity are available, this mutant can provide a powerful new tool for ...
The low-density lipoprotein (LDL) receptor plays a central role in mammalian cholesterol metabolism, clearing lipoproteins which bear apolipoproteins E and B-100 from plasma. Mutations in this molecule are associated with familial hypercholesterolemia, a condition which leads to an elevated plasma cholesterol concentration and accelerated atherosclerosis. The N-terminal segment of the LDL receptor contains a heptad of cysteine-rich repeats that bind the lipoproteins. Similar repeats are present in related receptors, including the very low-density lipoprotein receptor and the LDL receptor-related protein/alpha 2-macroglobulin receptor, and in proteins which are functionally unrelated, such as the C9 component of complement. The first repeat of the human LDL receptor has been expressed in Escherichia coli as a glutathione S-transferase fusion protein, and the cleaved and purified receptor module has been shown to fold to a single, fully oxidized form that is recognized by the monoclonal antibody ...
The low-density lipoprotein (LDL) receptor plays a central role in mammalian cholesterol metabolism, clearing lipoproteins which bear apolipoproteins E and B-100 from plasma. Mutations in this molecule are associated with familial hypercholesterolemia, a condition which leads to an elevated plasma cholesterol concentration and accelerated atherosclerosis. The N-terminal segment of the LDL receptor contains a heptad of cysteine-rich repeats that bind the lipoproteins. Similar repeats are present in related receptors, including the very low-density lipoprotein receptor and the LDL receptor-related protein/alpha 2-macroglobulin receptor, and in proteins which are functionally unrelated, such as the C9 component of complement. The first repeat of the human LDL receptor has been expressed in Escherichia coli as a glutathione S-transferase fusion protein, and the cleaved and purified receptor module has been shown to fold to a single, fully oxidized form that is recognized by the monoclonal antibody ...
The LDL receptor knockout model serves as an established model for atherosclerotic pathomechanisms because of the opportunity to induce elevated pTC levels.. In our study pTC was significantly increased by LDL receptor deficiency as well as HF diet. LDL receptor deficient mice after HF diet showed the highest average pTC, which was 6.0 times more than in C57Bl/6J control mice consuming standard chow diet.. Furthermore, we demonstrated a structural degeneration of BrM with thickening and accumulation of membrane and non-membrane bound translucent particles in LDL receptor deficient mice correlating with significantly elevated pTC levels. The layer arrangement was affected as well. These degenerations were most prominent in LDL receptor deficient mice after HF diet. Hypercholesterolaemia as an atherosclerotic risk factor seems to predispose to these structural alterations in BrM.. The observed changes in murine BrM resemble those seen in human eyes of aged donors and donors with ARM.11-13 Electron ...
Binds VLDL and transports it into cells by endocytosis. In order to be internalized, the receptor-ligand complexes must first cluster into clathrin-coated pits. Binding to Reelin induces tyrosine phosphorylation of Dab1 and modulation of Tau phosphorylation.
UCL Discovery is UCLs open access repository, showcasing and providing access to UCL research outputs from all UCL disciplines.
Familial hypercholesterolemia (FH) is a condition caused by mutations in the low-density lipoprotein receptor (LDLR) gene. Expression of LDLR is highly regulated and excess receptor expression is cytotoxic. To incorporate essential gene regulation into a gene therapy vector for FH, we generated vectors in which the expression of therapeutic human LDLR gene, or luciferase reporter gene, is driven by 10 kb of human LDLR genomic DNA encompassing the promoter region including elements essential for physiologically regulated expression. Using luciferase expression and specific LDL binding and internalization assays, we have shown in vitro that the genomic promoter element confers long-term, physiologically regulated gene expression and complementation of receptor deficiency in culture for 240 cell-generations. This was demonstrated in the presence of sterols or statins, modifiers of LDLR promoter activity. In vivo, we demonstrate efficient liver-specific delivery and expression of luciferase following
UCL Discovery is UCLs open access repository, showcasing and providing access to UCL research outputs from all UCL disciplines.
Different dietary fatty acids exert specific effects on plasma lipids but the mechanism by which this occurs is unknown. Hamsters were fed on low-cholesterol diets containing triacylglycerols enriched in specific saturated fatty acids, and effects on plasma lipids and the expression of genes involved in hepatic lipoprotein metabolism were measured. Trimyristin and tripalmitin caused significant rises in low-density lipoprotein (LDL) cholesterol which were accompanied by significant reductions in hepatic LDL receptor mRNA levels. Tripalmitin also increased hepatic expression of the apolipoprotein B gene, implying an increased production of LDL via very-low-density lipoprotein (VLDL) and decreased removal of LDL in animals fed this fat. Hepatic levels of 3-hydroxy-3-methylglutaryl-CoA reductase mRNA did not vary significantly between the groups. Compared with triolein, tristearin had little effect on hepatic gene expression or total plasma cholesterol. However, it caused a marked decrease in VLDL ...
Human PCSK9 is known to enhance the degradation of membrane-bound receptors such as the hepatocyte low-density lipoprotein receptor (LDLR), ApoER2, and very low-density lipoprotein receptor. Because the LDLR is suspected to be involved in hepatitis C virus (HCV) entry, we also tested whether PCSK9 can affect the levels of CD81, a major HCV receptor. Interestingly, stable expression of PCSK9 or a more active membrane-bound form of the protein (PCSK9-ACE2) resulted in a marked reduction in CD81 and LDLR expression. Therefore, we analyzed the antiviral effect of PCSK9 in vitro using the HCV genotype 2a (JFH1) virus. The results clearly demonstrated that cells expressing PCSK9 or PCSK9-ACE2, but not the ACE2 control protein, were resistant to HCV infection. Furthermore, addition of purified soluble PCSK9 to cell culture supernatant impeded HCV infection in a dose-dependent manner. As expected, HuH7 cells expressing PCSK9-ACE2 were also resistant to infection by HCV pseudoparticles. In addition, we ...
Background and aims Pathogenic mutations in the Low Density Lipoprotein Receptor gene (LDLR) cause Familial Hypercholesterolemia (FH), one of the most common genetic disorders with a prevalence as high as 1 in 200 in some populations. FH is an autosomal dominant disorder of lipoprotein metabolism characterized by high blood cholesterol levels, deposits of cholesterol in peripheral tissues such as tendon xanthomas and accelerated atherosclerosis. To date, 2500 LDLRvariants have been identified in the LDLR gene; however, only a minority of them have been experimentally characterized and proven to be pathogenic. Here we investigated the role of Cys46 located in the first repeat of the LDL receptor binding domain in recognition of apolipoproteins. Methods Activity of the p.(Cys46Gly) LDLR variant was assessed by immunoblotting and flow cytometry in CHO-/d/A7 expressing the receptor variant. Affinity of p.(Cys46Gly) for LDL and VLDL was determined by solid-phase immunoassays and in silico analysis ...
Factors that up-regulate LDL receptor expression in normal and neoplastic cells include multiple growth factors, many hormones (such as insulin, glucagons, growth hormone) and steroid hormones, such as estrogens. Some authors have demonstrated, both in vivo and in vitro, a stimulation of LDL receptor mRNA and protein expression in hepatoma cell line HepG2 and in rat liver by a natural estrogen, 17β-estradiol, suggesting an estrogen regulation of hepatic LDL receptor expression [13, 15]. Recently, it has been showed that diets containing soy protein enhance the clearance of apoB-containing lipoproteins via LDL receptors expressed on the hepatocyte plasma membrane [7].. Dietary factors may regulate HMG-CoA reductase activity with implications for breast cancer development [16]. Kojima et al. have demonstrated that genistein itself and/or its metabolites may suppress hepatic lipid synthesis [20].. In this report, we show that LDL receptor and HMG-CoA reductase gene expression are affected by ...
Chatterjee, S.; Ghosh, N.; Castiglione, E.; Kwiterovich, P.O., 1988: Regulation of glycosphingolipid glycosyltransferase by low density lipoprotein receptors in cultured human proximal tubular cells
SWISS-MODEL Template Library (SMTL) entry for 1i0u.1. SOLUTION STRUCTURE AND BACKBONE DYNAMICS OF A CONCATEMER OF EGF-HOMOLOGY MODULES OF THE HUMAN LOW DENSITY LIPOPROTEIN RECEPTOR
TY - JOUR. T1 - Role of RAP in the biogenesis of lipoprotein receptors. AU - Bu, Guojun. AU - Marzolo, María Paz. PY - 2000/12/1. Y1 - 2000/12/1. N2 - The LDL receptor gene family is composed of several endocytic receptors that share structural homology and function in cellular uptake of various ligands including lipoprotein particles. The complex structure of these lipoprotein receptors is highlighted by the presence of clusters of cysteine-rich ligand-binding repeats. An important feature that is shared by all these receptors is the inhibition of ligand interaction by a 39-kDa receptor-associated protein (RAP). Recent studies have shown that under physiological conditions RAP serves as a molecular chaperone to assist the folding of lipoprotein receptors and their safe passage through the secretory pathway. Several non-exclusive models have been proposed regarding the molecular mechanisms of RAP function as an antagonist for ligand interaction with the receptors and as a molecular chaperone ...
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class="publication">Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href="http://www.nrbook.com/b/bookcpdf.php">Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
Boycott KM, Flavelle S, Bureau A, Glass HC, T Fujiwara M, Wirrell E, et al. Homozygous deletion of the very low density lipoprotein receptor gene causes autosomal recessive cerebellar hypoplasia with cerebral gyral simplification. Am J Hum Genet. 2005;77(3):477-83. ...
Boycott KM, Flavelle S, Bureau A, Glass HC, T Fujiwara M, Wirrell E, et al. Homozygous deletion of the very low density lipoprotein receptor gene causes autosomal recessive cerebellar hypoplasia with cerebral gyral simplification. Am J Hum Genet. 2005;77(3):477-83. ...
The low density lipoprotein (LDL) receptor removes LDL, the so-called "bad" cholesterol particles, from the blood through a mechanism that involves LDL binding and internalization into liver cells. Because the LDL receptor plays a pivotal role in heart disease risk, there is substantial interest in understanding how its expression is regulated, and a large body of previous work has established the importance of transcriptional control. A new study identifies a signaling pathway that appears to regulate the LDL receptor at the level of protein degradation. Zelcer et al. show that a sterol-responsive transcription factor called LXR induces the expression of Idol (for inducible degrader of the LDL receptor), a protein that triggers ubiquitination of the receptor and targets it for degradation. Activation of this pathway suppresses cellular uptake of LDL and, in a mouse model, leads to higher plasma LDL levels, raising the possibility that the pathway could be targeted pharmacologically to control ...
The aim of this study was to determine whether IR could be induced in LDLR−/− mice and to find out whether these mice are a suitable model to investigate whether IR enhances atherosclerosis. Our study yielded 3 main results. The first of these was the unexpected finding that a diet rich in fructose that consistently causes IR in rats resulted in marked hypercholesterolemia but failed to induce IR in LDLR−/− mice. The second result was the observation of marked and early onset IR in mice fed a standard, moderately high-fat, Western diet (42% of calories as fat). Diets with much higher fat content (55% to 65% of calories) have been used previously to induce IR in other animal models,27 28 29 30 46 and Surwit et al31 32 have shown that high-fat diets also induce IR in mice. Our study documents that Western-type diets also cause IR in LDLR−/− mice. This is important because it raises the possibility that IR may have occurred in many previous studies on atherogenesis in murine models that ...
The low-density lipoprotein receptor family consists of a large number of single transmembrane proteins that are involved both in endocytosis of extracellular ligands and in intracellular signaling processes. New evidence ties these receptors to the transactivation of Trk receptors. Thus, this single receptor family demonstrates several distinct mechanisms for transducing information across the plasma membrane.. ...
Compared with nondiabetic individuals, patients with type 2 diabetes are at a much greater risk for CVD. Consequently, the treatment of CVD risk factors is a healthcare priority in this patient population. A number of clinical trials with 3-hydroxy-3-methylglutaryl (HMG) CoA (HMG-CoA) reductase inhibitors (statins) have shown significant CVD risk reduction through LDL cholesterol lowering in patients with diabetes,172-177 mainly through increased LDL-receptor activity.178 Increased LDL-receptor activity may also correct chylomicron metabolism.179 Indeed, the recently published Collaborative Atorvastatin Diabetes Study (CARDS), a placebo-controlled trial of patients with type 2 diabetes, was terminated 2 years earlier than its anticipated length owing to the significant reduction in number of CVD events observed in patients randomized to receive low-dose atorvastatin versus placebo.172 The statin therapy in this trial resulted in significant reduction of CVD events in patients with type 2 ...
Selection for increasing intramuscular fat content would definitively improve the palatability and juiciness of pig meat as well as the sensorial and organoleptic properties of cured products. However, evidences obtained in human and model organisms suggest that high levels of intramuscular fat might alter muscle lipid and carbohydrate metabolism. We have analysed this issue by determining the transcriptomic profiles of Duroc pigs with divergent phenotypes for 13 fatness traits. The strong aptitude of Duroc pigs to have high levels of intramuscular fat makes them a valuable model to analyse the mechanisms that regulate muscle lipid metabolism, an issue with evident implications in the elucidation of the genetic basis of human metabolic diseases such as obesity and insulin resistance. Muscle gene expression profiles of 68 Duroc pigs belonging to two groups (HIGH and LOW) with extreme phenotypes for lipid deposition and composition traits have been analysed. Microarray and quantitative PCR analysis showed
Thank you for your interest in spreading the word on Circulation Research.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address. ...
Dendritic cells (DCs) can be sub-divided into various subsets that play specialized roles in priming of adaptive immune responses. Atherosclerosis is regarded as a chronic inflammatory disease of the vessel wall and DCs can be found in non-inflamed and diseased arteries. We here performed a systematic analyses of DCs subsets during atherogenesis. Our data indicate that distinct DC subsets can be localized in the vessel wall. In C57BL/6 and low density lipoprotein receptor-deficient (Ldlr−/−) mice, CD11c+ MHCII+ DCs could be discriminated into CD103− CD11b+F4/80+, CD11b+F4/80− and CD11b−F4/80− DCs and CD103+ CD11b−F4/80− DCs. Except for CD103− CD11b− F4/80− DCs, these subsets expanded in high fat diet-fed Ldlr−/− mice. Signal-regulatory protein (Sirp)-α was detected on aortic macrophages, CD11b+ DCs, and partially on CD103− CD11b− F4/80− but not on CD103+ DCs. Notably, in FMS-like tyrosine kinase 3-ligand-deficient (Flt3l−/−) mice, a specific loss of CD103+ ...
Background: At a tenth of the dose of unmodified omega-3 fatty acids, Icosabutate (a structurally modified omega-3 fatty acid) achieves potent lowering of both plasma triglycerides (TG) and non-HDL cholesterol (C) in APOE*3Leiden.CETP transgenic mice. The mechanism/s by which Icosabutate exerts its hypolipidemic effect was investigated.. Methods: Male APOE*3Leiden.CETP mice were fed a semi-synthetic Western-type diet (WTD, 15% cocoa butter, 40% sucrose and 0.25% cholesterol; all w/w) without or with Icosabutate (112 mg/kg bw/day). Hepatic production and clearance of lipids/lipoproteins, lipolytic activity, hepatic lipids and expression of LDL receptor protein (LDLr) were assessed.. Results: After 4 to 6 weeks of treatment Icosabutate lowered both plasma TG and C, confined to the non-HDL particles, by 68% (p,0.001 vs. control). No significant effects were seen in lipoprotein lipase and hepatic lipase activity. However, hepatic uptake of VLDL-like 14C-cholesteryl oleate particles (as marker for ...
LRP1b and the closely related LRP1 are large members of the low-density lipoprotein receptor family. At the protein level LRP1b is 55% identical to LRP1, a multifunctional and developmentally essential receptor with roles in cargo transport and cellular signaling. Somatic LRP1b mutations frequently …
The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. Low density lipoprotein (LDL) is normally bound at the cell membrane and taken into the cell ending up in lysosomes where the protein is degraded and the cholesterol is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010] ...
Cardiovascular diseases are the number one killer across the globe, with an estimated 17.5 million people dying from one of these disorders in 2012 - 31% of all deaths. One of the risk factors is atherosclerosis: caused when high levels of LDL cholesterol (LDL-C) in the blood build up in the inner walls of arteries, thickening them and provoking an inflammatory response, it can lead to heart attack or stroke. Levels of LDL-C are therefore often used as a surrogate marker for the risk of having a cardiovascular event.. Statins have been a mainstay of heart attack and stroke prevention for the past 20 years, but the race is on to bring a new drug to market that targets an enzyme called PCSK9. The PCSK9 protein interferes with the clearance of LDL-C from the blood. LDL receptors on liver cells remove LDL-C from the blood by binding it and then moving it into the cell for elimination. The lipid-free receptors then return to the surface of the cell. When PCSK9 binds to the LDL receptor, however, the ...
The KOMP Repository Collection is located at the MMRRC at the University of California, Davis and Childrens Hospital Oakland Research Institute. Question? Comments? For Mice, Cells, and germplasm please contact us at [email protected], US 1-888-KOMP-MICE or International +1-530-752-KOMP, or for vectors [email protected] or +1-510-450-7917 ...
gtgatttccgggtgggactgagccctgggccccctctgcgcttcctgacatggcaaccaa 1060+60 . . . . . . acccctcatgcctcagtttccccatctgttaagtgtgcttgaaagcagttaggagggttt 1060+120 . . . . . . catgagattccacctgcatggaaaactatcattggctggccagagtttcttgcctctggg 1060+180 . . . . . . gattagtaattaagaaatttcaggccgggtgcgtaatccctgtaatcccaacaccttggg 1060+240 . . . . . . acgccgaggcgggcagatcacctgaggtcgggagttccagaccagcctgaccaacatgga 1060+300 . . . . . . gaaaccccgtctctactaaaaatacaaaattagccgggcttggtggtgcatgcctataat 1060+360 . cccagctactc 1060+371 --------------------- middle of intron --------------------- . 1061-371 aggaggctgag 1061-361 . . . . . . gcaggagaatcacttgaacctgggaggtggaggttgtggtgagccaagatcgtgccattg 1061-301 . . . . . . cactccagcctgggcaacaagagtgaaactccatccaaaaaaaaaagaaaagaaaagaaa 1061-241 . . . . . . aaaaagaaaagaaatttcagctgacacagcttcacactcttggttgggttcccgtggtga 1061-181 . . . . . . atgatgaggtcaggtgatgactggggatgacacctggctgtttccttgattacatctccc 1061-121 . . . . . . gagaggctgggctgtctcctggctgccttcgaaggtgtgggttttggcctgggccccatc 1061-61 . . . ...
We seek to elucidate the interactive roles that atherosclerosis and Abeta play in the pathogenesis of co-morbid Alzheimers disease (AD) and vascular dementia....
Unfortunately, in vivo studies do not always provide consistent findings. In a wire-induced vascular injury model, myeloid HIF-1α promotes vascular inflammation and remodeling manifested by increases in TNF-α and IL-6 levels proximal to the injury site and neointimal thickening of injured arteries (125). However, a recent in vivo genetic and drug-based approach suggested the opposite effect in a different mouse model, indicating that HIF-1α and HIF-2α accumulation correlates with reduced atherosclerosis development. The authors inhibited PHD2, resulting in HIF-1α and HIF-2α stabilization, by administering a pharmacological inhibitor (FG-4497) in an LDL receptor-deficient model of atherosclerosis or by crossing Hif-p4h-2 hypomorphic (Hif-p4h-2gt/gt) mice with LDL receptor-deficient mice. PHD2 inhibition led to reductions in levels of atherosclerotic plaque formation, weight gain, insulin resistance, liver and white adipose tissue (WAT) mass, adipocyte size, number of inflammation-associated ...
Expression and Characterization of a Very Low Density Lipoprotein Receptor Variant Lacking the O-Linked Sugar Region Generated by Alternative Splicing (1998 ...
The LDL receptor has an essential role in regulating plasma LDL-C levels. Genetic variation in the LDLR gene can be associated with either lower or moderately raised plasma levels of LDL-C, or may cause familial ...
Hong Yu Wang, Chao Quan, Chunxiu Hu, Bingxian Xie, Yinan Du, Liang Chen, Wei Yang, Liu Yang, Qiaoli Chen, Bin Shen, Bian Hu, Zhihong Zheng, Haibo Zhu, Xingxu Huang, Guowang Xu, Shuai Chen ...
Sigma-Aldrich offers abstracts and full-text articles by [A Etxebarria, A Benito-Vicente, M Stef, H Ostolaza, L Palacios, C Martin].
Over the last 5 years, major randomized clinical trials and meta-analyses of these trials have indicated that statin therapy, which inhibits 3-hydroxy-3-methylg
HOOGENDIJK CF, SCHOLTZ CL, PIMSTONE SM, EHRENBORG E, KASTELEIN JJP, DEFESCHE JC, THIART R, DU PLESSIS L, DE VILLIERS JNP, ZAAHL MG, DELPORT R, RUBINSZTEIN DC, RAFFEL LJ, GRIM CE, MEDIENE-BENCHEKOR S, AMOUYEL P, BROUSSEA T, STEYN K, LOMBARD CJ, HAYDEN MR, KOTZE MJ (2003) Allelic variation in the promoter region of the LDL receptor gene: analysis of an African-specific variant in the FP2 cis -acting regulatory element. Molecular and Cellular Probes 17:175- ...
Resumo: A incidência de riscos de doença aterosclerótica cardiovascular é maior em homens do que em mulheres na fase reprodutiva, essa diferença diminui quando diminui a produção de estrógenos após a menopausa. Uma série de estudos sugere que essa diferença em ambos os sexos pode ser causada em parte, pela ação pró-aterogênica dos andrógenos. O objetivo deste estudo foi verificar a participação do dimorfismo sexual em camundongos adultos LDLr-/- no efeito vasculoprotetor promovido pelo tratamento com a S-nitrosotiol-N-acetilcisteína (SNAC) na fase inicial da aterogênese por meio dos seguintes avaliações : a) expressão fenotípica da hipertensão; b) desenvolvimento de ateroma; c) perfil lipídico; d) imunorreatividade das isoformas das NOS vasculares. Camundongos machos e fêmeas com 3 meses de idade foram avaliados nos seguintes grupos experimentais: selvagens C57BL/6 (WT) sob dieta comercial; LDLr-/- sob dieta comercial com os controles (CT);LDLr-/-sob dieta ...
TY - JOUR. T1 - Leukocyte low density lipoprotein receptor (LDL-R) does not contribute to LDL clearance in vivo. T2 - Bone marrow transplantation studies in the mouse. AU - Fazio, Sergio. AU - Hasty, Alyssa H.. AU - Carter, Kathy J.. AU - Murray, Alisa B.. AU - Price, James O.. AU - Linton, MacRae R.F.. PY - 1997/2/1. Y1 - 1997/2/1. N2 - The targeted disruption of the low density lipoprotein (LDL) receptor gene in mice results in accumulation of plasma LDL cholesterol and in predisposition to diet-induced aortic atherosclerosis. Although the liver is the central organ for receptor mediated clearance of LDL, the in vivo role of other organs and tissues in LDL catabolism has not been directly studied. Since bone marrow-derived cells such as blood leukocytes and tissue macrophages express LDL receptors and contribute a large cell mass to the body, we designed bone marrow transplantation (BMT) experiments to reconstitute LDL receptor null mice [LDL-R(-/-)] with marrow obtained from LDL-R wild-type ...
Looking for online definition of low-density lipoprotein receptor class A domain-containing protein 1 in the Medical Dictionary? low-density lipoprotein receptor class A domain-containing protein 1 explanation free. What is low-density lipoprotein receptor class A domain-containing protein 1? Meaning of low-density lipoprotein receptor class A domain-containing protein 1 medical term. What does low-density lipoprotein receptor class A domain-containing protein 1 mean?
Sepsis is the leading cause of death in critically ill patients. While decreased Proprotein Convertase Subtilisin/Kexin type 9 (PCSK9) function improves clinical outcomes in murine and human sepsis, the mechanisms involved have not been fully elucidated. We tested the hypothesis that lipopolysaccharide (LPS), the major Gram-negative bacteria endotoxin, is cleared from the circulation by hepatocyte Low Density Lipoprotein Receptors (LDLR)-receptors downregulated by PCSK9. We directly visualized LPS uptake and found that LPS is rapidly taken up by hepatocytes into the cell periphery. Over the course of 4 hours LPS is transported towards the cell center. We next found that clearance of injected LPS from the blood was reduced substantially in Ldlr knockout (Ldlr-/-) mice compared to wild type controls and, simultaneously, hepatic uptake of LPS was also reduced in Ldlr-/- mice. Specifically examining the role of hepatocytes, we further found that primary hepatocytes isolated from Ldlr-/- mice had ...
We investigated whether primary hypercholesterolaemia per se affects glucose homeostasis and insulin secretion in low-density lipoprotein receptor knockout mice (LDLR(-/-)). Glucose plasma levels were increased and insulin decreased in LDLR(-/-) compared to the wild-type mice. LDLR(-/-) mice presented impaired glucose tolerance, but normal whole body insulin sensitivity. The dose-response curve of glucose-stimulated insulin secretion was shifted to the right in LDLR(-/-) islets. Significant reductions in insulin secretion in response to L-leucine or 2-ketoisocaproic acid were also observed in LDLR(-/-). Islet morphometric parameters, total insulin and DNA content were similar in both groups. Glucose uptake and oxidation were reduced in LDLR(-/-) islets. Removal of cholesterol from LDLR(-/-) islets corrected glucos-estimulated insulin secretion. These results indicate that enhanced membrane cholesterol content due to hypercholesterolaemia leads to a lower insulin secretion and glucose intolerance ...
Human PCSK9 is known to enhance the degradation of membrane-bound receptors such as the hepatocyte low-density lipoprotein receptor (LDLR), ApoER2, and very low-density lipoprotein receptor. Because the LDLR is suspected to be involved in hepatitis C virus (HCV) entry, we also tested whether PCSK9 can affect the levels of CD81, a major HCV receptor. Interestingly, stable expression of PCSK9 or a more active membrane-bound form of the protein (PCSK9-ACE2) resulted in a marked reduction in CD81 and LDLR expression. Therefore, we analyzed the antiviral effect of PCSK9 in vitro using the HCV genotype 2a (JFH1) virus. The results clearly demonstrated that cells expressing PCSK9 or PCSK9-ACE2, but not the ACE2 control protein, were resistant to HCV infection. Furthermore, addition of purified soluble PCSK9 to cell culture supernatant impeded HCV infection in a dose-dependent manner. As expected, HuH7 cells expressing PCSK9-ACE2 were also resistant to infection by HCV pseudoparticles. In addition, we ...
Негізгі ғылыми жарияланымдары: [1] Expression of the familial hypercholesterolemia gene in heterozygotes: mechanism for a dominant disorder in man. Science. 1974 Jul 5;185(4145):61-3. [2] Regulation of the activity of the low density lipoprotein receptor in human fibroblasts. Cell. 1975 Nov;6(3):307-16. [3] Release of low density lipoprotein from its cell surface receptor by sulfated glycosaminoglycans. Cell. 1976 Jan;7(1):85-95. [4] Receptor-mediated control of cholesterol metabolism. Science. 1976 Jan 16;191(4223):150-4. [5] Heterozygous familial hypercholesterolemia: failure of normal allele to compensate for mutant allele at a regulated genetic locus. Cell. 1976 Oct;9(2):195-203. [6] Analysis of a mutant strain of human fibroblasts with a defect in the internalization of receptor-bound low density lipoprotein. Cell. 1976 Dec;9(4 PT 2):663-74. [7] Role of the coated endocytic vesicle in the uptake of receptor-bound low density lipoprotein in human fibroblasts. Cell. ...
Основні наукові публікації: [1] Expression of the familial hypercholesterolemia gene in heterozygotes: mechanism for a dominant disorder in man. Science. 1974 Jul 5; 185 (4145) :61-3. [2] Regulation of the activity of the low density lipoprotein receptor in human fibroblasts. Cell. 1975 Nov; 6 (3) :307-16. [3] Release of low density lipoprotein from its cell surface receptor by sulfated glycosaminoglycans. Cell. 1976 Jan; 7 (1) :85-95. [4] Receptor-mediated control of cholesterol metabolism. Science. 1976 Jan 16; 191 (4223) :150-4. [5] Heterozygous familial hypercholesterolemia: failure of normal allele to compensate for mutant allele at a regulated genetic locus. Cell. 1976 Oct; 9 (2) :195-203. [6] Analysis of a mutant strain of human fibroblasts with a defect in the internalization of receptor-bound low density lipoprotein. Cell. 1976 Dec; 9 (4 PT 2) :663-74. [7] Role of the coated endocytic vesicle in the uptake of receptor-bound low density lipoprotein in human ...