Our data of the direct involvement of RIP3 in NFκB-mediated vascular inflammation add support to the notion of necroptosis-independent function of RIP3, which has only been reported in a few studies thus far.44,45 Interestingly, we found in aortic SMCs that Rip3 knockdown significantly attenuated TNFα-induced expression of Ccl2 (monocyte chemoattractant protein-1), Il6, Tnf, and Vcam1 but not Ccl5, Ccl7, Il1b, Icam1, or Mmp2. Because all these molecules are known to be regulated by NFκB, we speculate that the selective requirement of RIP3 might be related to their sensitivity to serine536 phosphorylation of p65, which was attenuated in Rip3−/− SMCs treated with TNFα. Among the multiple phosphorylation sites within p65, serine536 is critical for enhancing the transcriptional activity of NFκB by recruitment of TATA-binding protein-associated factor II31.46 It is possible that not all cytokine genes require this fine-tuning mechanism for optimal expression.. Apoptosis and necrosis are 2 ...
Influenza A virus (IAV) is a lytic RNA virus that triggers receptor-interacting serine/threonine-protein kinase 3 (RIPK3)-mediated pathways of apoptosis and mixed lineage kinase domain-like pseudokinase (MLKL)-dependent necroptosis in infected cells. ZBP1 initiates RIPK3-driven cell death by sensing IAV RNA and activating RIPK3. Here, we show that replicating IAV generates Z-RNAs, which activate ZBP1 in the nucleus of infected cells. ZBP1 then initiates RIPK3-mediated MLKL activation in the nucleus, resulting in nuclear envelope disruption, leakage of DNA into the cytosol, and eventual necroptosis. Cell death induced by nuclear MLKL was a potent activator of neutrophils, a cell type known to drive inflammatory pathology in virulent IAV disease. Consequently, MLKL-deficient mice manifest reduced nuclear disruption of lung epithelia, decreased neutrophil recruitment into infected lungs, and increased survival following a lethal dose of IAV. These results implicate Z-RNA as a new ...
Mutations in the optineurin (OPTN) gene have been implicated in both familial and sporadic amyotrophic lateral sclerosis (ALS). However, the role of this protein in the central nervous system (CNS) and how it may contribute to ALS pathology are unclear. Here, we found that optineurin actively suppressed receptor-interacting kinase 1 (RIPK1)-dependent signaling by regulating its turnover. Loss of OPTN led to progressive dysmyelination and axonal degeneration through engagement of necroptotic machinery in the CNS, including RIPK1, RIPK3, and mixed lineage kinase domain-like protein (MLKL). Furthermore, RIPK1- and RIPK3-mediated axonal pathology was commonly observed in SOD1(G93A) transgenic mice and pathological samples from human ALS patients. Thus, RIPK1 and RIPK3 play a critical role in mediating progressive axonal degeneration. Furthermore, inhibiting RIPK1 kinase may provide an axonal protective strategy for the treatment of ALS and other human degenerative diseases characterized by axonal
RIP3 (Receptor-interacting Serine/Threonine-protein Kinase 3, RIP-like Protein Kinase 3, Receptor-interacting Protein 3, RIP-3, RIPK3), R2031-74N - Get the Best Quote/Price and read Reviews, Features and Research Applications
Progression of Type 1 Diabetes from the Prediabetic Stage Is Controlled by Interferon-α Signaling Blockade of IFN-α but not IFN-β signaling using either an antibody or a selective S1PR1 agonist, CYM-5442, prevented type 1 diabetes (T1D) in the mouse Rip-LCMV T1D model. [Proc Natl Acad Sci USA] Abstract Deletion of XIAP Reduces the Severity of Acute Pancreatitis via Regulation of Cell Death and Nuclear Factor-κB Activity Researchers investigated the potential role of X-linked inhibitor of apoptosis protein (XIAP) in regulation of cell death and inflammation during acute pancreatitis. Deletion of XIAP resulted in the reduction of amylase activity, decrease of nuclear factor-κB activation and less release of TNF-α and IL-6, together with increased caspases activities and receptor-interacting protein kinase1 degradation, leading to enhanced apoptosis and reduced necrosis in pancreatic acinar cells and ameliorated the severity of acute pancreatitis. [Cell Death Dis] Full Article The Endoplasmic ...
To date, it has been difficult to investigate the potential mechanisms of necrosis, which is generally believed to be a passive cellular response to external damage. Recently, a new non-apoptotic pathway to necrosis called necroptosis was described by Yuan and colleagues. Given the central role of necrosis in myocardial infarction, we hypothesized that necrostatin-1, a specific inhibitor of necroptosis, can confer myocardial protection. Mouse hearts were subjected to 60 min of LAD ligation followed by 4 h of reperfusion. Necrostatin-1 (1.65 mg/kg, i.p.) was administered either 30 min before ligation or immediately after initiation of reperfusion. The infarct size/risk area was reduced from 51 ± 3% in the control to 20 ± 2.7% and 30 ± 3.6%, respectively (n=6, P,0.05). We also found that necrostatin-1 pretreatment reduced the troponin-I levels from 102 ± 6.8 ng/ml in the control plasma to 51 ± 5.7 ng/ml (P,0.05). Our studies show that necrostatin-1 confers myocardial protection when given 30 ...
DNA‐dependent activator of interferon regulatory factors/Z‐DNA binding protein 1 (DAI/ZBP1) is a crucial sensor of necroptotic cell death induced by murine cytomegalovirus (MCMV) in its natural host. Here, we show that viral capsid transport to the nucleus and subsequent viral IE3‐dependent early transcription are required for necroptosis. Necroptosis induction does not depend on input virion DNA or newly synthesized viral DNA. A putative RNA‐binding domain of DAI/ZBP1, Zα2, is required to sense virus and trigger necroptosis. Thus, MCMV IE3‐dependent transcription from the viral genome plays a crucial role in activating DAI/ZBP1‐dependent necroptosis. This implicates RNA transcripts generated by a large double‐stranded DNA virus as a biologically relevant ligand for DAI/ZBP1 during natural viral infection. ...
Sigma-Aldrich offers abstracts and full-text articles by [Katerina Vlantis, Andy Wullaert, Apostolos Polykratis, Vangelis Kondylis, Marius Dannappel, Robin Schwarzer, Patrick Welz, Teresa Corona, Henning Walczak, Falk Weih, Ulf Klein, Michelle Kelliher, Manolis Pasparakis].
Order monoclonal and polyclonal LIM Domain Kinase 1 antibodies for many applications. Selected quality suppliers for anti-LIM Domain Kinase 1 antibodies.
The product of this gene is a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases, and contains a C-terminal domain unique from other RIP family members. The encoded protein is predominantly localized to the cytoplasm, and can undergo nucleocytoplasmic shuttling dependent on novel nuclear localization and export signals. It is a component of the tumor necrosis factor (TNF) receptor-I signaling complex, and can induce apoptosis and weakly activate the NF-kappaB transcription factor. [provided by RefSeq, Jul 2008 ...
Special note about Community Feature Content. Any content and/or opinions uploaded, expressed or submitted through any Community Feature or any other publicly available section of the Web Site (including password-protected areas), and all articles and responses to questions, other than the content explicitly authorized by the Company, are solely the opinions and responsibility of the person or entity submitting them and do not necessarily reflect the opinions of the Company. By way of example, any recommended or suggested use of products or services available from the Company that is posted through a Community Feature is not a sign of approval or recommendation by the Company. If you choose to follow any such recommendation you do so at your own risk.. Links to Third Party Sites. The Web Site may contain links to other websites on the internet. The Company is not responsible for the content, products, services or practices of any third party websites, including without limitation sites linked to ...
Build: Fri Jul 27 09:23:34 EDT 2018 (commit: a5c8d99). National Center for Advancing Translational Sciences (NCATS), 6701 Democracy Boulevard, Bethesda MD 20892-4874 • 301-435-0888. ...
Bagnjuk, K.; Blohberger, J.; Tiefenbacher, A.; Kunz, Lars; Mayr, D.; Mayerhofer, A. (2017): Necroptosis - an unexplored form of cell death in the ovary. In: Reproduction in Domestic Animals, Vol. 52, No. S1: p. 7 ...
Scientists at the NYU Langone Medical Center and the Laura and Isaac Perlmutter Cancer Center are researching a form of cancer treatment called necroptosis.
Necroptosis of Cusabio can help you to find the right products (antibodies, proteins, clone, Elisa kits, etc) for you research in a quick and easy way. And our technical team is always here for you.
RIPK2 - RIPK2 (untagged)-Kinase deficient mutant (K47M) of Human receptor-interacting serine-threonine kinase 2 (RIPK2) available for purchase from OriGene - Your Gene Company.
RIPK2 - RIPK2 (untagged)-Human receptor-interacting serine-threonine kinase 2 (RIPK2) available for purchase from OriGene - Your Gene Company.
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class="publication">Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href="http://www.nrbook.com/b/bookcpdf.php">Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
ネクローシス細胞による炎症惹起の機序 [in Japanese] Inflammation triggered by necroptotic cells [in Japanese] ...
This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain (CARD), and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of NF-kappaB and inducer of apoptosis in response to various stimuli ...
Reaktivität: Fledermaus, Rind (Kuh), Hund and more. verschiedene SH3KBP1 Antikörper vergleichen. Alle direkt auf antikörper-online bestellbar!
The major goal of this project is to understand how the negative regulation of necroptosis by RIPK1 and the positive regulation of necroptosis by RIPK3 affects hematopoieiss at steady state and following transplantation and infection. Aim 1b and Aim 3a have some overlap with this application ...
Certain clones of Jurkat cells are susceptible to necroptosis, but not all of them. In my experience, the FADD-deficient clone 5C3 is highly susceptible to necroptotic death induced by TNFa. The wild type jurkat cell line A3 is not and the caspase-8 deficient line I9.2 is only mildly susceptible by itself, but, surprisingly, becomes more susceptible upon addition of z-VAD-fmk, suggesting that caspase-8 is not essential to prevent necroptosis in these cells. The RIPK1-deficient jurkat cell line is not susceptible to necroptosis unless reconstituted with RIPK1 harbouring a cleavage site mutation, The parental clone doesnt undergo necroptosis upon TNFa stimulation in the presence of z-VAD-fmk. However, the RIPK1 deficient cells are extremely susceptible to all forms of apoptosis, suggesting either an important role of RIPK1 in preventing apoptosis or that these cells lack another anti-apoptotic factor in addition to RIPK1. These cells were initially generated by selecting randomly mutated jurkat ...
In the present study, we report that km23, a TGF-β receptor-interacting protein and a dynein motor protein light chain, was altered with high frequency (42.1%) in tissues from ovarian cancer patients. In 2 of 19 patients, a truncated form of km23 missing exon3 (Δexon3-km23) was detected. In addition to this alteration, six other missense mutations have been detected in an additional six patients. None of these alterations were detectable in normal ovarian tissue samples. Furthermore, functional studies showed that the km23 mutant Δexon3-km23 not only disrupted the interaction with DIC but also inhibited transcriptional activation of the TGF-β-dependent reporters p3TP-lux and ARE-lux. In addition, our results indicate that alterations in km23 disrupt TGF-β-signaling events, thereby implicating km23 in the TGF-β resistance associated with ovarian cancer development and/or progression. This report is the first demonstration of a link between cytoplasmic dynein and ovarian cancer.. Our results ...
In myocardial infarction (MI), a plenty of cardiomyocytes undergo necrosis and necroptosis due to the lack of oxygen and nutrients. The dead cardiomyocytes are promptly engulfed by phagocytes. When the dead cells are not engulfed, the noxious contents of the cells are released outside, and thus, induce inflammation, and obstruct the function of organs. Therefore, phagocytosis is crucial for maintaining homeostasis of organs. Herein, we describe a protocol of an in vitro phagocytosis assay of necroptotic cells.
Nonapoptotic forms of cell death may facilitate the selective elimination of some tumor cells or be activated in specific pathological states. The oncogenic RAS-selective lethal small molecule erastin triggers a unique iron-dependent form of nonapoptotic cell death that we term ferroptosis. Ferropto …
Programmed cell death has a vital role in embryonic development and tissue homeostasis. oxygen varieties (ROS) in tuberculosis illness. Experimental studies have also demonstrated that upregulation of RIPK3 and MLKL detected in alcoholic and drug-induced liver injury suggests that necroptosis is also involved in sterile inflammation. Application of Necrostatin (Nec)-1 or depletion of RIPK3 protects liver cells from these types of injuries [74]. Parasitic diseases like leishmaniasis and malaria generally caused hemolysis, Lenalidomide supplier anemia, and sometimes bleeding. These result due to rupturing of red blood corpuscles (RBCs) leading to release of hemoglobin (Hb) into circulation; heme is produced on oxidation of Hb leading to initiation of the Fenton reaction and culminates with generation of ROS. Heme is also responsible for direct activation of TLR4, leading to autocrine secretion of ROS and TNF, and they activate the RIPK1/3-dependent necroptosis in a synergistic manner [75]. In ...
Studies with recombinant receptors in cell lines and cultured neurons have defined rules for the trafficking of kainate receptors to the plasma membrane. The relative level of their surface expression depends on subunits and alternative splicing of their C-terminal domain, and on subunit composition of heteromeric receptors. Some subunit splice variants are endowed with a forward trafficking motif, whereas others are retained in the ER (endoplasmic reticulum) due to retention signals.. KA2 was initially thought to require the presence of other subunits to form receptor complexes, but KA2 can in fact form homomeric assemblies in heterologous cells, although it is retained in the ER in the absence of GluR5, GluR6 or GluR7 [3-5]. This subunit possesses an ER retention motif in its C-terminus (RRRRR), and a di-leucine endocytic motif that may mediate its rapid, clathrin-dependent endocytosis and low steady-state plasma membrane expression. The ER retention/retrieval signal in KA2 is sterically ...
cytoplasm, dendrite, dendritic shaft, glutamatergic synapse, membrane, neuron spine, plasma membrane, postsynaptic density, postsynaptic membrane, glutamate receptor binding
Necrostatin-1 | RIP1 inhibitor | CAS [4311-88-0] | Axon 1258 | Axon Ligand™ with >99% purity available from supplier Axon Medchem, prime source of life science reagents for your research
Gentaur molecular products has all kinds of products like :search , Biovis \ Necrostatin-7 \ 1866-25 for more molecular products just contact us
RIP1/3-mediated necroptosis: tumor necrosis factor (TNF) binding to itstrimeric receptor, TNF receptor-1 (TNFR1) leads to a conformational change togenerate TNF
Heat shock protein 90α (HSP90α) maintains cell stabilization and regulates cell death, respectively. Recent studies have shown that HSP90α is involved in receptor interacting protein 3 (RIP3)-mediated necroptosis in HT29 cells. It is known that oxygen and glucose deprivation (OGD) can induce necroptosis, which is regulated by RIP3 in neurons. However, it is still unclear whether HSP90α participates in the process of OGD-induced necroptosis in cultured neurons via the regulation of RIP3. Our study found that necroptosis occurs in primary cultured cortical neurons and PC-12 cells following exposure to OGD insult ...
So far GSK3B has been described to be involved in modulating biological processes as opposite as proliferation or apoptosis, depending on the cellular, molecular, and developmental context (28-37). In fact, GSK3B is known to play an antiproliferative role by promoting APC-dependent phosphorylation-and hence proteosome-mediated degradation-of β-catenin, a transcription factor positively regulating Myc and cyclin D1 expression (14). In HCT116 colon carcinoma cell line it has been showed that GSK3B inhibition leads to apoptosis via p53 activation (38, 39). Here we present a novel role for GSK3B in colon carcinomas showing that its inhibition resensitizes drug-resistant p53-null colon cancer cells to chemotherapy both in vitro and in vivo and that GSK3B negatively regulates RIP1-independent necroptosis in response to chemotherapy. Moreover, in accordance with in vitro and in vivo data, we showed that GSK3B is activated in a high percentage (63.6%) of samples from 5FU-treated stage II colon ...
The worlds first wiki where authorship really matters. Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts.
Knowing what to do if caught in a rip currents grip can save your life or the life of a friend. Trying to swim straight to the beach against a rip current is just too difficult. Even a good swimmer will become tired and might even drown. The best escape is to turn sideways to the shore, and wade or swim until you are out of the rip current. Then move back toward shore at an angle away from the rush of water. The NOAA rip current sign depicts this method of escape. However, in in a chaotic situation, it is often difficult to tell which way to swim. An alternate way of thinking about it would be to swim towards the breaking waves This is depicted by the green arrows on the NOAA rip current sign. If you can float, you might even just relax and go with the flow. Rip currents do not usually go out very far. Let the rip current carry you until it slows down a short distance offshore. Then swim toward the beach away from the rip current (again you can think of it as swimming toward the breaking ...
RIP2 antibody (receptor-interacting serine-threonine kinase 2) for ELISA, ICC/IF, WB. Anti-RIP2 pAb (GTX31647) is tested in Human samples. 100% Ab-Assurance.
pFN21AE2049 6718 bp TCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGGCTA TTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCC AATATGACCGCCATGTTGGCATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGG GTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCC GCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCAT AGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGC CCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTATTGACGTCAATGA CGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTG GCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACAC CAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGT CAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCC CGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGC TGGTTTAGTGAACCGTCAGATCACTAGAAGCTTTATTGCGGTAGTTTATCACAGTTAAAT TGCTAACGCAGTCAGTGCTTCTGACACAACAGTCTCGAACTTAAGCTGCAGAAGTTGGTC GTGAGGCACTGGGCAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAA ACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTAC ...
Abstract: Necroptosis in a novel form of programmed cell death that has been implicated in many disease states including ischemia-reperfusion injuries, Huntingtons disease, pancreatitis, and Crohns disease. It has also been shown to play an important role in inflammatory diseases such as Systemic Inflammatory Response Syndrome (SIRS). Work done in recent years has shown that necroptosis is a hig... read morehly regulated process. Many signaling proteins, most importantly RIP1 and RIP3 kinases, have been discovered to be involved in the regulation of necroptosis. However, a complete understanding of molecular mechanisms involved in necroptosis remains to be elucidated. The goal of this work was to characterize the role of Akt kinase in necroptosis by gaining an understanding of how it becomes activated in response to pro-necroptotic stimuli and elucidating the downstream consequences of its activation in the process of cell death. We also sought to identify novel Akt interacting proteins and to ...
Renal fibrosis is a common pathogenic response to injury in chronic kidney disease (CKD). The receptor-interacting protein kinase-3 (RIPK3), a regulator of necroptosis, has been implicated in disease pathogenesis. In mice subjected to unilateral ureteral obstruction-induced (UUO-induced) or adenine diet-induced (AD-induced) renal fibrosis, models of progressive kidney fibrosis, we demonstrate increased kidney expression of RIPK3. Mice genetically deficient in RIPK3 displayed decreased kidney fibrosis and improved kidney function relative to WT mice when challenged with UUO or AD. In contrast, mice genetically deficient in mixed-lineage kinase domain-like protein (MLKL), a downstream RIPK3 target, were not protected from UUO-induced kidney fibrosis. We demonstrate a pathway by which RIPK3 promotes fibrogenesis through the AKT-dependent activation of ATP citrate lyase (ACL). Genetic or chemical inhibition of RIPK3 suppressed the phosphorylation of AKT and ACL in response to TGF-β1 in fibroblasts. ...
Necroptosis has emerged as an important pathway of programmed cell death in embryonic development, tissue homeostasis, immunity and inflammation1, 2, 3, 4, 5, 6, 7, 8. RIPK1 is implicated in inflammatory and cell death signalling9, 10, 11, 12, 13 and its kinase activity is believed to drive RIPK3-mediated necroptosis14, 15. Here we show that kinase-independent scaffolding RIPK1 functions regulate homeostasis and prevent inflammation in barrier tissues by inhibiting epithelial cell apoptosis and necroptosis. Intestinal epithelial cell (IEC)-specific RIPK1 knockout caused IEC apoptosis, villus atrophy, loss of goblet and Paneth cells and premature death in mice. This pathology developed independently of the microbiota and of MyD88 signalling but was partly rescued by TNFR1 (also known as TNFRSF1A) deficiency. Epithelial FADD ablation inhibited IEC apoptosis and prevented the premature death of mice with IEC-specific RIPK1 knockout. However, mice lacking both RIPK1 and FADD in IECs displayed ...
O43353: Receptor-interacting serine/threonine-protein kinase 2; 2.7.11.1; CARD-containing interleukin-1 beta-converting enzyme-associated kinase; CARD-containing IL-1 beta ICE-kinase; RIP-like-interacting CLARP kinase; Receptor-interacting protein 2; RIP-2; Tyrosine-protein kinase RIPK2; 2.7. ...
CRSP complex subunit 6 (Cofactor required for Sp1 transcriptional activation subunit 6) (Transcriptional coactivator CRSP77) (Vitamin D3 receptor-interacting protein complex 80 kDa component) (DRIP80) (Thyroid hormone receptor-associated protein complex 8 [Source:Uniprot/SWISSPROT;Acc:Q9NVC6]CRSP complex subunit 6 (Cofactor required for Sp1 transcriptional activation subunit 6) (Transcriptional coactivator CRSP77) (Vitamin D3 receptor-interacting protein complex 80 kDa component) (DRIP80) (Thyroid hormone receptor-associated protein complex 8 [Source:Uniprot/SWISSPROT;Acc:Q9NVC6] BY ORTHOLOGY TO: ...
Product Name: PrEST Antigen HMGN1Synonym: FLJ27265; FLJ31471; HMG14; MGC104230; MGC117425Product Type: ChemicalCAS NO: 130495-35-1RIP kinase inhibitorsAssay:
RIP1 promotes proliferation through G2/M checkpoint progression and mediates cisplatin-induced apoptosis and necroptosis in human ovarian cancer cells
NCOA2/GRIP1 (nuclear receptor coactivator 2/glucocorticoid receptor-interacting protein 1 (GRIP1)) is a 159 kD member of the p160/steroid receptor…
The journal focuses on neuroimmunology and neuroinflammation, and the coverage extends to other basic and clinical studies related to neuroscience including molecular biology, psychology, pathology, physiology, endocrinology, pharmacology, oncology, etc.
Neural cell death occurs in many retinal degenerations including AMD. Although partial therapies exist for the wet form of AMD there is no effec...
Tom Petty......RIP I cant believe noone brought it up..... Mary Janes Last Dance Well, I dont know, but Ive been told You never slow down, you never grow old..... https://www.azlyrics.com/lyrics/tompettyandtheheartbreakers/maryjaneslastdance.html
Bacterial pneumonia and sepsis are two important causes of mortality in the world. Emergence of multidrug resistant bacteria has necessitated the development of new treatment and/or prevention strategies to augment host immune defense. In this context, the innate host defense is critical in clearing pathogenic bacteria from the host. Early neutrophil recruitment is a critical step in a multistep requence leading to bacterial clearance. Pattern recognition receptors (PRRs) play a critical role in the innate immune system. Receptor interacting protein 2 (RIP-2) is an adaptor for the nod-like receptors (NLR) NOD1 and NOD2. Nucleotide oligomerisation domain 2 (NOD2) is an intracellular PRR that is shown to be important for host defense against intracellular bacterial pathogens. However, the role of NOD2 and RIP-2 during Gram-negative bacterial pneumonia and polymicrobial sepsis has not been explored. Thus, we hypothesize that the NOD2/RIP-2 axis is critical for host defense during bacterial pneumonia and